Патентная документация ЕАПВ

 
Запрос :  ea201491821a*\id

больше ...
Термины запроса в документе


Полный текст патента

(57) Реферат / Формула:

Изобретение относится к модифицированным олигонуклеотидам, имеющим две или более тиольных функциональных группы, которые могут быть зафиксированы на золотой поверхности или на привитой поверхности, в частности на поверхности, включающей по меньшей мере одну углерод-углеродную двойную связь, или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы. Изобретение также относится к способу детекции нуклеиновой кислоты в биологическом образце, включающему стадию детекции гибридизации между модифицированным олигонуклеотидом и нуклеиновой кислотой-мишенью, амплифицированной из биологического образца. Изобретение относится, в частности, к способу детекции, генотипирования или секвенирования патогенного организма, предпочтительно вируса.


2420-519390ЕА/035
МОДИФИЦИРОВАННЫЕ ОЛИГОНУКЛЕОТИДЫ, ВКЛЮЧАЮЩИЕ ТИОЛЬНЫЕ ФУНКЦИОНАЛЬНЫЕ ГРУППЫ, И ИХ ПРИМЕНЕНИЕ ДЛЯ ДЕТЕКЦИИ НУКЛЕИНОВЫХ
КИСЛОТ
ОБЛАСТЬ ТЕХНИКИ
Настоящее изобретение относится к модифицированным
олигонуклеотидам, содержащим две или более тиольные
функциональные группы, которые могут быть зафиксированы на
золотой поверхности или на привитой поверхности, в частности,
на поверхности, включающей по меньшей мере одну углерод-
углеродную двойную связь или углерод-углеродную тройную связь,
или галогенацетамидные группы, предпочтительно малеимидные или
акриламидные функциональные группы. Изобретение также относится
к способу детекции нуклеиновых кислот в биологическом образце,
включающему стадию детекции гибридизации между модифицированным
олигонуклеотидом и нуклеиновой кислотой-мишенью,
амплифицированной из биологического образца. Изобретение относится, в частности, к способу детекции, генотипирования или секвенирования патогенного организма, предпочтительно вируса.
ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ
По причине физико-химической стабильности и специфичности, обеспечиваемых успешным расположением различных нуклеотидов, из которых они состоят, нуклеиновые кислоты обозначают собой молекулы, чрезвычайно хорошо пригодные для использования в способах специфической детекции и распознавания человеческого, животного, растительного, бактериального или вирусного организмов.
Эти свойства привели к развитию надежных и чувствительных биосенсоров (по-английски "biosensors"), традиционно состоящих из элемента молекулярного распознавания и преобразователя. Элемент молекулярного распознавания, называемый "зонд", который обычно фиксируют на поверхности преобразователя, проявляет высокую специфичность и чувствительность к молекуле нуклеиновой кислоты, "мишени". Роль преобразователя заключается в
конвертации события молекулярного распознавания, такого как гибридизация между нуклеотидными последовательностями зонда и мишени, в сигнал, который можно легко измерить. Таким образом, биосенсоры используют возможности слияния двух комплементарных нуклеотидных последовательностей, содержащихся в зонде и мишени, и порождают сигнал в случае, когда происходит гибридизация двух последовательностей.
Биосенсоры характеризуют методом преобразования, который используют для обнаружения гибридизации последовательностей зонда и мишени.
Биосенсоры с прямым преобразованием позволяют
детектировать гибридизацию последовательностей без
использования специального введения метки. Они содержат, например, электрохимические системы, в которых преобразование осуществляется посредством реакций электронного переноса, таких как амперометрия, основанная на детекции изменений силы тока при постоянном потенциале, кондуктометрия, основанная на детекции изменений электропроводности между двумя электродами, или потенциометрия, основанная на детекции изменений потенциала при постоянной силе тока. Биосенсоры с прямым преобразованием также содержат гравиметрические системы, основанные на пьезоэлектрических технологиях, и используют, например, свойства кварцевого кристалла, частота которого варьируется в соответствии с изменениями, происходящими на поверхности. Биосенсоры с прямым преобразованием обычно быстрые и специфические, однако имеют ограниченную чувствительность (от 1СГ9 до 1СГ12 М) . Биосенсоры с прямым преобразованием хорошо подходят для изготовления недорогих, одноразовых и переносных систем диагностирования.
Что касается биосенсоров с косвенным преобразованием, то они требуют введения метки в последовательности нуклеиновой кислоты-мишени и стадий промывания, которые проводят перед детекцией. Биосенсоры с косвенным преобразованием обычно обозначают собой вид оптических систем, в которых детекцию осуществляют в датчике считывания, соединенном с конфокальным микроскопом, основанных на эмиссии света одним или более
флуоресцентным маркером в соответствии с вызванным лазерным облучением возбуждением. Таким образом, биосенсоры с косвенным преобразованием обычно требуют тяжелых инструментов, сложных в обращении и требующих квалифицированного персонала, но они имеют высокую чувствительность детекции (от 1СГ12 до 1СГ15 М) . Биосенсоры с косвенным преобразованием составляют технологию, которую чаще всего используют в области диагностирования, основанного на нуклеиновых кислотах.
Биосенсоры с прямым или косвенным преобразованием обеспечивают одновременную детекцию тысяч или десятков тысяч гибридизаций последовательностей нуклеиновых кислот и обычно организованы в форме упорядоченной последовательности фиксированных зондов в форме точек на твердом носителе. Каждая точка вмещает около 106 аналогичных зондов, содержащих одинаковую нуклеотидную последовательность, и нуклеотидная последовательность различается от одной точки к другой.
"Микрочипы" (по-английски "microarrays") являются
чрезвычайно сложными биосенсорами, включающими от 1000 до 106 точек размером около 2 0 до 50 мкм. Они технически очень сложные и дорогие и в основном предназначены для секвенирования ДНК, для исследования генетических заболеваний и для анализа полиморфизма. Этот тип биосенсора разрабатывают, в частности, компании Affymetrix, Illumina и Agilent. Что касается "макрочипов" (по-английски "macroarrays"), то это биосенсоры низкой сложности, включающие от 1000 до 10000 точек размером больше или равным 2 00 мкм.
Зонды можно фиксировать на биосенсорах посредством ковалентного или нековалетного присоединения. Ковалентного присоединения зонда с преобразователем можно достигнуть, например, фотолитографией или реакцией аминированного олигонуклеотида с поверхностью, покрытой функционализированным силаном. Зонд также можно фиксировать на металлической поверхности и, в частности, на золотой поверхности, например, посредством связи между атомом золота и атомом серы. Однако связь Au-S средней силы, и одинарной связи золото-сера недостаточно для очень прочного фиксирования зонда на
поверхности золота. В действительности методы детекции содержат стадии, в частности, промывания, которые вызывают сильные механические напряжения гибридизации, которые могут дестабилизировать связь Au-S.
Зонд также можно присоединить к преобразователю
нековалентным способом, например, электростатической
адсорбцией. Нековалентное присоединение может, например, возникать в результате взаимодействия между отрицательно заряженными фосфатами в ДНК зонда и поверхностью преобразователя, покрытой у-аминопропилсиланом или слоем поли-L-лизина. Нековалентные взаимодействия между зондом и преобразователем плохо выдерживают стадии промывания, которые осуществляют во время процедур детекции, особенно когда детекцию осуществляют косвенным преобразованием. Это обусловлено тем, что для детекции гибридизации требуется, после стадии собственно гибридизации, устранение меченых последовательностей нуклеиновой кислоты-мишени, не связавшихся с нуклеотидной последовательностью зонда. Дополнительно, нековалентное присоединение не допускает значительных изменений условий эксплуатации для того, чтобы увеличить точность стадий гибридизации или промывания и, таким образом, сделать их более специфическими.
В документе ЕР 0 52 3 97 8 раскрыты фосфорамидитные или фосфонатные соединения, которые можно использовать для получения тиол-модифицированных олигонуклеотидов. Однако эти соединения могут быть введены только один раз и только на конец 5' нуклеотида.
В документе US 7601848 раскрыто полифункциональное соединение, включающее два атома серы, которые предназначены для включения в состав олигомеров для того, чтобы создать по меньшей мере две связи золото-сера и, таким образом, стабилизировать олигонуклеотид на золотой поверхности. Некоторые из этих соединений содержат фосфорамидитную функциональную группу. Однако соединения, которые используют в этом документе, получают из очень дорогих соединений, и
присоединение полифункционального соединения к олигонуклеотидам не имеет удовлетворительного выхода по причине стерических затруднений этого соединения. В этом документе требуется связующий элемент для того, чтобы связать тиольные соединения друг с другом и, таким образом, осуществить многократное введение тиольных соединений в олигонуклеотид.
Следовательно, цель изобретения заключается в разработке зонда, образованного из олигонуклеотида, содержащего по меньшей мере две тиольные функциональные группы, который можно легко и эффективно привить на различные поверхности, включающие поверхности, покрытые металлом (например, золотом), и привитые поверхности, включающие по меньшей мере одну двойную углерод-углеродную или тройную углерод-углеродную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы. Зонд данного изобретения по меньшей мере частично исправляет вышеописанные недостатки и позволяет увеличить специфичность и чувствительность детекции нуклеотидных последовательностей-мишеней в независимости от типа преобразования (прямого или косвенного), использованного во время детекции.
Изобретение также ставит целью разработку экономного, быстрого, чувствительного, более легкого, чем существующие способы, поддающегося изменениям и автоматизируемого способа детекции, секвенирования и/или генотипирования нуклеиновых кислот патогенных или инфекционных организмов или генов, определяющих заболевания или участвующих в заболеваниях.
СУЩНОСТЬ ИЗОБРЕТЕНИЯ
Первая задача изобретения относится к модифицированным олигонуклеотидам, соответствующим формуле (XIlb):
(ХПЬ) N1-N2-.. .-Nn_i-Nn-(I'b)y-(Mi-.. .-Mm_i-Mm)p-(Fb)y'
или формуле (XIIlb):
(ХШЬ) flc')-fl'b)y-i-Ni-N2-.. ..N^-Nn-a'bV-CMi-Mz-.. .-M^i-M^p-a'^y
в которых
Ni, Nn обозначают, независимо друг от друга, нуклеотид,
Mi, Mm обозначают, независимо друг от друга, нуклеотид, (I'b) обозначает соединение формулы:
,О-Р-
Y О X-W
-о \ /
(1с') обозначает соединение формулы: ,о-н
X-W
-о \ /
п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, р обозначает 0 или 1,
у' обозначает целое число от 0 до 12, если р равно 1, и у' равняется 0, если р равно 0,
у' ' обозначает целое число от 0 до 12, если р равно 1, и, если р равно 0, то у' равно 0,
сумма целых чисел (у+у') или (у+у'+у'Ч находится в интервале между 2 и 12,
X выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
Y выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
Z выбирают из С1-С12 алкоксильных групп,
кислородсодержащих или азотсодержащих СЗ-С12
циклогетероалкильных групп, С1-С12 NCO-алкильных групп, С1-С12 CON-алкильных групп,
W выбирают из С1-С12 алкантриильных групп, С6-С18 арилтриильных групп и С6-С18 аралкантриильных групп, предпочтительно группы, выбранной из СН, ССН3, ССН2СН3, циклогексантриильной или бензолтриильной,
R обозначает Н или выбирают из С1-С12 ацильных, С1-С12 S-
алкильных, С6-С12 S-арильных, S-2-пиридиновой,
кислородсодержащих или азотсодержащих С1-С12 S-гетероалкильных, СЗ-С12 S-циклоалкильных, кислородсодержащих или азотсодержащих СЗ-С12 S-циклогетероалкильных групп, и
осуществления изобретения изобретения соответствуют
R1 выбирают из 2-цианоэтильной или R' ±R' 2R' 3SiCH2CH2 групп, в которых R'i, R'2 и R'3 могут быть одинаковыми или разными и обозначают группу, выбранную из линейных или разветвленных алкилов, включающих от 1 до 12 углеродных атомов и С6-С12 арилов.
В одном из вариантов модифицированные олигонуклеотиды формуле:
RS.
-О-Х'
N2 I
в которой п, у, N1,..., Nn-i, X, Y, Z, W и R имеют такое же
толкование, как описано выше, и Вп обозначает основание п-ного
нуклеотида.
Согласно другому варианту осуществления изобретения
модифицированные олигонуклеотиды изобретения соответствуют
формуле:
RS.
HO-Y" ^X-O-
-P-O-Y-
I _ О
x-o-
N2 0-P=0
O-i .0
-p-o
I _ о
y-1
в которой n, у, N2,..., Nn, X, Y, Z, W и R имеют такое же толкование, как описано выше, и Вп обозначает основание 1-ого нуклеотида.
В одном из вариантов осуществления изобретения модифицированные олигонуклеотиды, как описано выше, включают нуклеотидную последовательность (Ni-N2-...-Nn-i-Nn) и, если требуется, нуклеотидную последовательность (Mi-M2-...-Mm-i-Mm) , специфические к вирусу, бактерии или гену, определяющему заболевание или участвующему в заболевании.
В одном из вариантов осуществления изобретения нуклеотидную последовательность (Ni-N2-...-Nn-i-Nn) и, если требуется, нуклеотидную последовательность (Mi-M2-...-Mm-i-Mm) выбирают из:
- последовательностей SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 35 или SEQ ID NO: 36, специфических к вирусу гепатита С (ВГС),
- последовательностей SEQ ID N0: 16, SEQ ID NO: 17 или SEQ ID NO: 40, специфических к флавивирусам,
- последовательностей SEQ ID NO: 18 или SEQ ID NO: 41, специфических к вирусу денге, или
- последовательности SEQ ID N0: 19, специфической к вирусу Западного Нила (ВЗН).
В одном из вариантов осуществления изобретения нуклеотидная последовательность (Ni-N2-...-Nn-i-Nn) и, если требуется, нуклеотидная последовательность (Mi-M2-...-Mm-i-Mm)
имеют структуры альфа-аномера, бета-аномера, линейную или типа стебель-петля ("улитка").
Дополнительно изобретение относится к субстрату, привитому по меньшей мере одним модифицированным олигонуклеотидом, как описано выше. Упомянутый субстрат содержит по меньшей мере одну зону приема, покрытую веществом, выдерживающим прививку упомянутого модифицированного олигонуклеотида.
В одном из вариантов осуществления изобретения упомянутая зона приема упомянутого привитого субстрата покрыта тонким слоем золота или платины, и упомянутый субстрат обозначает собой металл, предпочтительно, медь; или упомянутая зона приема содержит на своей поверхности по меньшей мере одну углерод-углеродную двойную связь (алкенильную функциональную группу) или углерод-углеродную тройную связь (алкинильную функциональную группу) или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы, и упомянутый субстрат обозначает собой пластик, предпочтительно полистирол. В одном из вариантов осуществления изобретения используемые субстраты обозначают собой непроводящие полимеры. Согласно другому варианту осуществления изобретения используемые субстраты для осуществления изобретения обозначают собой проводящие полимеры.
В одном из вариантов осуществления изобретения привитый субстрат ровный (частично или полностью) или кривой и может быть предпочтительно сферической формы. В одном из вариантов осуществления изобретения субстрат неплоский, например, в форме микрочастиц или наночастиц, и предпочтительно магнитный.
Дополнительно изобретение относится к способу детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце, включающему стадию детекции упомянутой нуклеиновой кислоты-мишени по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида, как описано выше.
В одном из вариантов осуществления изобретения способ детекции изобретения содержит стадии:
получения по меньшей мере одной исходной нуклеиновой кислоты из биологического образца,
- получения ампликона амплификацией упомянутой нуклеиновой кислоты-мишени из исходной нуклеиновой кислоты, и
- детекцию гибридизации упомянутого ампликона по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида, как описано выше.
В одном из вариантов осуществления изобретения способ детекции изобретения обеспечивает детекцию вирусного генотипа и/или подтипа, присутствующего в биологическом образце, и включает:
- формирование ампликона амплификацией последовательности нуклеиновой кислоты-мишени, соответствующей геномному участку вируса, несущего информацию, относящуюся к вирусному генотипу и/или подтипу, и
- детекцию гибридизации упомянутого ампликона по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида, как описано выше, с зондом, специфическим к вирусному генотипу и/или подтипу.
В одном из вариантов осуществления изобретения стадию получения ампликона по способу детекции изобретения проводят со смесью нуклеотидных праймеров, предпочтительно выбранных из пар праймеров:
- SEQ ID NO: 8 и SEQ ID NO: 9, когда ампликон получают из ВГС, в независимости от используемого вирусного генотипа. Данная пара праймеров является общей и обеспечивает амплификацию "длинного" ампликона длиной 4 01 н.п., исходя из любого генотипа ВГС;
- SEQ ID NO: 10 и SEQ ID NO: 9, пара, обеспечивающая формирование "коротких" ампликонов длиной 191 н.п., специфических к генотипу la/lb;
- SEQ ID NO: 29 и SEQ ID NO: 9, пара, обеспечивающая формирование "коротких" ампликонов длиной 108 н.п., специфических к генотипу 2;
- SEQ ID NO: 8 и SEQ ID NO: 11, пара, обеспечивающая формирование "коротких" ампликонов длиной 143 н.п., специфических к генотипу За;
- SEQ ID NO: 8 и SEQ ID NO: 30, пара, обеспечивающая
формирование "коротких" ампликонов длиной 175 н.п., специфических к генотипу 4a/4d; и
- SEQ ID N0: 20 и SEQ ID N0: 21, и/или SEQ ID N0: 22 и SEQ ID N0: 21, когда ампликон получают из флавивируса.
Дополнительно изобретение относится к набору для детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце, включающем:
- по меньшей мере один модифицированный олигонуклеотид,
как описано выше, и по меньшей мере один субстрат, содержащий
по меньшей мере одну зону приема, покрытую веществом,
выдерживающим прививку упомянутого модифицированного
олигонуклеотида; упомянутая зона предпочтительно покрыта
золотом с платиной или содержит по меньшей мере одну углерод-
углеродную двойную связь или углерод-углеродную тройную связь,
или галогенацетамидные группы, предпочтительно малеимидные или
акриламидные функциональные группы,
по меньшей мере один привитый субстрат, как описано
выше.
Дополнительно изобретение относится к олигонуклеотиду, содержащему нуклеотидную последовательность, выбранную из последовательностей SEQ ID N0: 1, SEQ ID N0: 4, SEQ ID N0: 27, SEQ ID NO: 28, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 40 и SEQ ID NO: 41.
Дополнительно, изобретение относится к применению олигонуклеотида или модифицированного олигонуклеотида, как описано выше, или привитого субстрата, как описано выше, для детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце.
В одном из вариантов осуществления изобретения упомянутое применение обеспечивает диагностирование или генотипирование вирусных штаммов, предпочтительно ВГС, вируса денге или вируса Западного Нила.
Преимущества настоящего изобретения заключаются в следующем:
- модифицированный олигонуклеотид изобретения, содержащий
тиольные функциональные группы, является недорогим для производства,
- модифицированный олигонуклеотид изобретения можно прочно зафиксировать на золотой поверхности или на поверхности, включающей по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы,
- применение модифицированного олигонуклеотида изобретения в способах детекции, секвенирования и/или генотипирования нуклеиновых кислот позволяет специфически детектировать нуклеотидные последовательности-мишени нескольких сотен нуклеотидов,
нуклеотидная последовательность модифицированного олигонуклеотида изобретения предпочтительно короче, чем нуклеотидные последовательности зондов, которые используют в известных способах детекции и/или генотипирования, и в то же время обладают лучшей чувствительностью и специфичностью детекции.
Другие признаки и преимущества изобретения станут
понятными при прочтении нижеследующего описания
предпочтительного варианта осуществления изобретения, данного в виде примера, и которое ссылается на приложенные чертежи.
КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ
Фигура 1 показывает схему, описывающую способ синтеза соединений (I).
Фигуры 2А и 2В показывают, соответственно, схему, описывающую способ синтеза олигомера из соединений изобретения, исходя из соединений (1а) и исходя из соединений (lb).
Фигура 3 показывает схему, описывающую способ синтеза олигонуклеотидного соединения (XIIc), привитого к олигомеру соединения (I) по концу 5'.
Фигура 4 показывает схему, представляющую способ синтеза олигонуклеотидного соединения (ХШс) , привитого к олигомеру соединения (I) по концу 3'.
Фигура 5 показывает гистограмму степени прививки модифицированного олигонуклеотида на золотую поверхность.
Фигура б показывает диаграмму, представляющую устойчивость модифицированного олигонуклеотида на золотой поверхности в зависимости от времени при 60°С.
Фигура 7 показывает диаграмму, представляющую устойчивость модифицированного олигонуклеотида на золотой поверхности в зависимости от времени при 8 0°С.
Фигуры 8 и 9 показывают схематические диаграммы результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом типа За.
Фигура 10 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом типа 1а/lb.
Фигура 11 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с зондом типа 1а/lb, содержащим 1, 2, 4, б или 8 тиольных функциональных групп.
Фигура 12 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с монотиольным зондом типа 1а/lb при различных значениях плотности прививки.
Фигура 13 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с дитиольным зондом типа 1а/lb при различных значениях плотности прививки.
Фигура 14 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом типа 1а/lb при различных значениях плотности прививки.
Фигура 15 показывает результаты теста по гибридизации зонд/мишень с тетратиольным зондом, привитым на золотую поверхность.
Фигура 16а показывает реакции между модифицированным олигонуклеотидом по изобретению и поверхностью с привитыми
активированными алкенильными или алкинильными группами.
Фигура 1бЬ показывает реакции между модифицированным олигонуклеотидом по изобретению и поверхностью с привитыми алкенильными или алкинильными группами с активацией светом (А=2 65 нм).
Фигура 17 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным ВГС зондом типа 1а/lb.
Фигура 18 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят со смесью двух тетратиольных ВГС зондов типов 2а/2с и/2Ь.
Фигура 19 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным ВГС зондом типа За.
Фигура 2 0 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным ВГС зондом типа 4a/4d.
Фигура 21 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом, общим для флавивирусов.
Фигура 22 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом, специфическим для серотипа 4 денге.
Фигура 23 показывает схематическую диаграмму результатов ELOSA тестов с флуоресцентной детекцией, которые проводят с тетратиольным зондом, общим для вируса Западного Нила.
ОПИСАНИЕ ПРЕДПОЧТИТЕЛЬНОГО ВАРИАНТА ОСУЩЕСТВЛЕНИЯ
ИЗОБРЕТЕНИЯ
Настоящая патентная заявка описывает получение соединений со структурой фосфорамидита, Н-фосфоната или соединений, содержащих защищенную тиольную функциональную группу, связанных с твердым носителем. Данные тиольные соединения предназначены для введения в олигонуклеотиды для того, чтобы сформировать модифицированные олигонуклеотиды по изобретению. Таким образом, полученные модифицированные олигонуклеотиды могут иметь несколько тиольных функциональных групп.
Следовательно, настоящее изобретение относится к модифицированным олигонуклеотидам, которые можно получить по способу, описанному ниже, и содержащему от 2 до 12 тиольных функциональных групп. Дополнительно изобретение относится к применению данных модифицированных олигонуклеотидов для детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце.
Тиольное соединение
Тиольные соединения, предназначенные для введения в модифицированные олигонуклеотиды настоящего изобретения, соответствуют следующей формуле (I):
X-W D-0 z
Ss (I) R
в которой:
Т обозначает группу, выбранную из -0-Р (ORi) N (R2) 2Г ~0-РН(0)0~, -ОС (О) JC (О) NH-,
Ri выбирают из 2-цианоэтильной, R' {R' 2R' 3SiCH2CH2 групп, и R'i, R'2, R'3/ которые могут быть одинаковыми или разными, обозначают группу, выбранную из линейных или разветвленных алкильных групп, содержащих от 1 до 12 углеродных атомов и Сб-С12 арильных групп,
R2 выбирают из линейных или разветвленных алкильных групп, содержащих от 1 до 12 углеродных атомов, пирролидина,
J выбирают из одинарной связи, -СН2-, -СН2СН2-, -СН2ОСН2-, -CH2OPhOCH2- группы, где Ph обозначает бензильную группу,
обозначает твердый носитель,
D обозначает защитную группу спиртов,
W выбирают из С1-С12 алкантриильных групп, С6-С18 арилтриильных групп и С6-С18 аралкантриильных групп,
Z выбирают из С1-С12 алкоксильных групп,
кислородсодержащих или азотсодержащих СЗ-С12
циклогетероалкильных групп, С1-С12 NCO-алкильных групп, С1-С12
CON-алкильных групп,
Y выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
X выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
R выбирают из С1-С12 ацильных, С1-С12 S-алкильных, С6-С12
S-арильных, S-2-пиридиновой, кислородсодержащих или
азотсодержащих С1-С12 S-гетероалкильных, СЗ-С12 S-
циклоалкильных, кислородсодержащих или азотсодержащих СЗ-С12 S-циклогетероалкильных групп.
Согласно настоящему изобретению под "алкантриильными
группами" имеют в виду линейные, разветвленные или циклические
алкантриильные группы, по желанию замещенные одной или более
алкильными группами. Среди арилтриильных групп, которые могут
присутствовать в соединении по изобретению, могут быть
упомянуты бензолтриильные или нафталинтриильные группы. Среди
аралкановых групп могут быть упомянуты 1,3,5-
триметилбензолтриил и триметилнафталинтриил.
Вещество (I) можно разделить на три подкатегории (1а), (lb) и (1с), соответствующие следующим формулам (la), (lb) и (1с), в которых параметры X, Y, Z, R, Rlr R2 и D имеют такое же толкование, как описано выше для формулы (I).
Y 0-P(OR1)N(R2)2
X-W
D-0 \ (1а) /
°v°
Y-OAH
x-w
D-0 z /
/ ° (lb)
о о
I H
X-W n ч
/ \ (Ic)
D-0 xz /
Предпочтительно Ri выбирают из 2-цианоэтильной и
R' iR' 2R' 3SiCH2CH2 групп, и R'i, R'2/ которые могут быть
одинаковыми или разными, обозначают группу, выбранную из
линейных или разветвленных алкильных групп, содержащих от 1 до
б углеродных атомов и фенил; предпочтительно Ri выбирают из 2-
цианоэтильной и R' iR' 2R' 3SiCH2CH2 групп, и R'i, R'2/ которые
могут быть одинаковыми или разными, соответствуют группе,
выбранной из линейных или разветвленных алкильных групп,
содержащих от 1 до 3 углеродных атомов и фенил; еще более
предпочтительно Ri выбирают из 2-цианоэтильной, 2-
(триметилсилил)этильной, 2-(трифенилсилил)этильной, 2-
(дифенилметилсил)этильной групп.
Предпочтительно R2 выбирают из линейных или разветвленных алкильных групп, содержащих от 1 до б углеродных атомов. Предпочтительно R2 соответствует изопропильной группе (iPr).
Предпочтительно твердый носитель выбирают из полимерных
смол, в частности, из полимерных смол, основанных на
полистироле, полиакриламиде, полиэтиленгликоле, целлюлозе,
полиэтилене, полиэстере, латексе, полиамиде,
полидиметилакриламиде, синтетических или природных гидрофильных полимерах, стеклянных гранулах, силикагелях.
Предпочтительно W выбирают из Cl-Сб алкантриильных групп, С6-С12 арилтриильных групп и С6-С12 аралкантриильных групп,
более подробно, из группы, выбранной из СН, ССН3, ССН2СН3, циклогексантриильной или бензолтриильной групп.
Предпочтительно D выбирают из защитных групп спиртов, которые позволяют ортогональное снятие защитной группы относительно других групп в соединении (I) . Более подробно, D выбирают из 4,4'-диметокситритильной (DMTr), 9-фенилксантен-9-ильной (пиксил) или флуоренилметилоксикарбонильной (Fmoc) групп. Пиксильная защитная группа описана, в частности, в документе Chattopadhyaya and Reese, Chem. Soc. Chem. Comm., 1978, 639-640. Другой возможной защитной группе спиртов соответствует трет-бутил-диметилсилильная группа, и в этом случае особенно предпочитают полистироловый носитель.
Предпочтительно Z выбирают из С1-С6 аминоалкильных, С1-С6 алкоксильных групп, кислородсодержащих или азотсодержащих СЗ-Сб циклогетероалкильных групп, С1-С6 NCO-алкильных групп, С1-С6 CON-алкильных групп.
Предпочтительно Y выбирают из линейных или разветвленных
С1-Сб алкильных групп, С1-С6 аминоалкильных групп, С1-С6
алкоксильных групп, СЗ-Сб циклоалкильных групп,
кислородсодержащих или азотсодержащих СЗ-Сб
циклогетероалкильных групп.
Предпочтительно X выбирают из линейных или разветвленных
С 1-С б алкильных групп, С1-Сб аминоалкильных групп, С 1-С б
алкоксильных групп, СЗ-Сб циклоалкильных групп,
кислородсодержащих или азотсодержащих СЗ-Сб
циклогетероалкильных групп.
Предпочтительно R выбирают из С1-С12 ацильных, С1-С6 S-алкильных, Сб S-арильных, кислородсодержащих или азотсодержащих Сб S-гетероалкильных, Сб S-циклоалкильных, кислородсодержащих или азотсодержащих Сб-циклогетероалкильных групп.
В одном из вариантов линейные или разветвленные алкильные
группы выбирают из метильной, этильной, пропильной, бутильной,
пентильной, гексильной, гептильной, октильной, нонильной,
децильной, ундецильной, додецильной, изопропильной,
изобутильной, трет-бутильной групп.
В одном из вариантов аминоалкильные группы выбирают из
аминометильной, аминоэтильной, аминопропильной, аминобутильной,
аминопентильной, аминогексильной, аминогептильной,
аминооктильной, аминононильной, аминодецильной,
аминоундецильной, аминододецильной, аминоизопропильной,
аминоизобутильной, амино-трет-бутильной групп, включающих один или более атом азота.
В одном из вариантов алкоксильные группы выбирают из
метоксильной, этоксильной, пропилоксильной, оксибутилоксильной,
пентилоксильной, гексилоксильной, гептилоксильной,
октилоксильной, нонилоксильной, децилоксильной,
ундецилоксильной, додецилоксильной, изопропилоксильной,
изобутилоксильной, трет-бутилоксильной групп, включающих один или более атом кислорода.
В одном из вариантов циклоалкильные группы выбирают из колец, возможно, включающих один или более ненасыщенный фрагмент, включающих 3-12 углеродных атомов, предпочтительно б углеродных атомов.
В одном из вариантов циклогетероалкильные группы выбирают из колец, замещенных одним или более атомами азота и/или кислорода, возможно, включающих один или более ненасыщенный фрагмент и включающих 3-12 углеродных атомов, предпочтительно 5 углеродных атомов и один атом азота или атом кислорода.
В одном из вариантов NCO-алкильные и CON-алкильные группы, в которых алкильные группы могут быть линейными или разветвленными, выбирают из метильной, этильной, пропильной, бутильной, пентильной, гексильной, гептильной, октильной, нонильной, децильной, ундецильной, додецильной, изопропильной, изобутильной, трет-бутильной групп.
В одном из вариантов R2 обозначает изопропильную группу (iPr) и/или Ri обозначает цианоэтильную группу.
По предпочтительному варианту осуществления тиольное соединение (1а) обозначает соединение (VI), соответствующее следующей формуле:
(VI)
в которой
n обозначает целое число между 1 и 12, предпочтительно между 1 и б,
Rif R2 и D имеют такое же толкование, как описано выше для (1а).
Предпочтительно R2 обозначает изопропильную группу (iPr) и Ri обозначает цианоэтильную группу.
Предпочтительно R обозначает ацетильную группу.
Предпочтительно D обозначает 4,4'-диметокситритил.
Согласно другому варианту осуществления тиольное соединение (1а) обозначает соединение (VII), соответствующее следующей формуле:
(VII)
в которой
п обозначает целое число между 1 и 12, предпочтительно, между 1 и б,
Rv Rif R2 и D имеют такое же толкование, как описано выше для (1а).
Предпочтительно R2 обозначает изопропильную группу (iPr), и Ri обозначает цианоэтильную группу.
Предпочтительно R обозначает ацетильную группу.
Предпочтительно D обозначает 4,4'-диметокситритил.
В одном из вариантов тиольное соединение (1с) обозначает соединение (VIII), соответствующее следующей формуле:
(VIII)
в которой
n обозначает целое число между 1 и 12, предпочтительно между 1 и б,
R и ? имеют такое же толкование, как описано выше для
(1с) .
Предпочтительно R обозначает ацетильную группу. Предпочтительно J обозначает этильную группу. Предпочтительно D обозначает 4,4'-диметокситритил.
В одном из вариантов тиольное соединение (1а) обозначает соединение (IX), соответствующее следующей формуле:
(IX)
в которой
п обозначает целое число между 1 и 12, предпочтительно между 1 и б,
Rif R2 и D имеют такое же толкование, как описано выше для (1а).
Предпочтительно R2 обозначает изопропильную группу (iPr), и Ri обозначает цианоэтильную группу.
Предпочтительно R обозначает ацетильную группу.
Предпочтительно D обозначает 4,4'-диметокситритил.
В одном из вариантов тиольное соединение (1а) обозначает
соединение (X), соответствующее следующей формуле:
(X)
в которой
п обозначает целое число между 1 и 12, предпочтительно между 1 и б,
Rif R2 и D имеют такое же толкование, как описано выше для (1а).
Предпочтительно R2 обозначает изопропильную группу (iPr), и Ri обозначает цианоэтильную группу.
Предпочтительно R обозначает ацетильную группу.
Предпочтительно D обозначает 4,4'-диметокситритил.
Предпочтительно R2 обозначает изопропильную группу (iPr), и Ri обозначает цианоэтильную группу.
В одном из вариантов тиольное соединение (1а) обозначает соединение (XI), соответствующее следующей формуле:
(XI)
в которой
п обозначает целое число между 1 и 12, предпочтительно между 1 и б,
Rv Rif R2 и D имеют такое же толкование, как описано выше для (1а).
Предпочтительно R2 обозначает изопропильную группу (iPr), и Ri обозначает цианоэтильную группу.
Предпочтительно R обозначает ацетильную группу. Предпочтительно D обозначает 4,4'-диметокситритил. Процесс получения
Процесс получения соединений (la), (lb) и (1с) представлен на схеме на фигуре 1.
Соединения (la), (lb) и (1с) получают из того же вещества (II), имеющего следующую формулу:
/ХЧ (ID
D-0 z / S
в которой D, X, W, Y, Z и R имеют такое же толкование, как и для тиольного соединения (I).
Соединение формулы (1а) можно получить по реакции, представленной на следующей схеме:
НО ci-p(0Rl) /0-P(OR.,)N(R2)2
/Y N-R2 /
X-W R{ x-w
D-0 Z ^ D-0 z
R R (II) (la)
или по реакции, представленной на следующей схеме,
предпочтительно в присутствии соли тетразолида
диизопропиламина:
D-0
X-W
\ 2
/ S
R2.
/0Ri)
N-P
N-R2
x-w
D-0 z / S
O-PfOR^NCR^
(И)
(la)
Соединение формулы (lb) можно получить по реакции, представленной на следующей схеме:
% -о
Y Ьо / Н-
НЧ OQ Р ,Н
J-0 н
D-0 z /
' \ OQ' X-W.
(II)
D-0 z . п_гГ 4
\ S R R
(lb)
в которой Q и Q' обозначают, независимо друг от друга, замещенную или незамещенную бензольную группу.
Предшествующую реакцию получения соединения (1а) или (lb) проводят, исходя из соединения (II), предпочтительно в присутствии основания, например, диизопропилэтиламина (ДИЭА) в безводном растворителе, таком как безводный дихлорметан.
Соединение формулы (1с) можно также получить из соединения (II), но предпочтительно по стадии реакции, представленной на следующей схеме:
о о
О О
А А -°
?П / ^ / / - О J N
НОЧ НО J N I Н
Н Y
x-w ^ x-w
D-0 \ °-° \
/ sy (1с)
s ь\
(И) R
Предшествующую реакцию получения соединения (1с) предпочтительно проводят в безводном растворителе, таком как пиридин, в присутствии основания, такого как триэтиламин.
Соединение формулы (1с) также можно получить по следующей схеме реакции:
X-W ' \
D-0
(II)
АЛЛ °
x-w
Л T
о о
о о
Л A
(1С)
D-O
Соединение (II) приведенной выше формулы, в которой X, W, Z, Y и R группы имеют такое же толкование, как и в соединении (I), соответствует одному варианту осуществления.
Соединение формулы (II) можно получить из соединения (III) по стадии реакции, описанной ниже:
X-W
' \
G (III)
RS"K+
X-W ' \
D-0
в котором G обозначает галоген, предпочтительно, бром или
иод,
Вышеописанную реакцию предпочтительно проводят в безводном растворителе, таком как безводный толуол, и в присутствии краун-эфира.
Соединение (III) можно получить из соединения (IV) по стадии реакции, описанной ниже:
но у
/ G-Z"-G' х_уу
x-w ^ ' \
D-O > \
(IV) (Ml)
в котором G и G' обозначают атомы галогенов, которые могут быть одинаковыми или разными, предпочтительно G и G' обозначают атомы брома или йода,
Z' обозначает С1-С12 аминоалкильные группы, С1-С12 алкоксильные группы, кислородсодержащие или азотсодержащие СЗ-С12 циклогетероалкильные группы, С1-С12 NCO-алкильные группы, С1-С12 CON-алкильные группы,
Z" обозначает С1-С12 линейные или разветвленные алкильные группы, С1-С12 аминоалкильные группы, С1-С12 алкоксильные группы, С1-С12 циклоалкильные группы, кислородсодержащие или азотсодержащие СЗ-С12 циклогетероалкильные группы, С1-С12 NCO-алкильные группы, С1-С12 CON-алкильные группы,
дигалогенированное соединение G-Z"-G' предназначено для реакции с Z' группой соединения (IV), чтобы привести к образованию Z-G группы соединения (III) .
Стадию получения соединения (III) предпочтительно проводят в присутствии гидрида щелочного металла, такого как NaH.
Соединение (IV) можно получить из коммерческого соединения (V) защитой спиртовой группы по следующей стадии реакции:
но но
> >
x-w x-wN
/ N ' -71
HO Z' D-0 Z
(V) (IV)
Данную стадию защиты спиртовой группы проводят при условиях, хорошо известных специалисту в данной области техники, в зависимости от выбора D.
В одном из вариантов соединение (IV) получают из соединения (V) по реакции 4, 4'-диметокситритилхлорида (DMTr-
С1), предпочтительно в растворителе, таком как пиридин, для того, чтобы защитить спиртовую функциональную группу.
Согласно другому варианту осуществления соединение (IV) получают из соединения (V) , исходя из 9-фенилксантен-9-илхлорида (пиксил-С1) при условиях, описанных в документе Chattopadhyaya and Reese, Chem. Soc. Chem. Comm., 1978, 639640 .
Согласно другому варианту осуществления соединение (IV)
получают из соединения (V) по реакции с
флуоренилметилоксикарбонилхлоридом (Fmoc-Cl) при условиях, хорошо известных специалисту в данной области техники.
В вышеупомянутых формулах от (II) до (V), X, Y, W, Z, D, R/ Rif R2 имеют такое же толкование, как и толкование соединения (I), приведенное выше.
Предпочтительно, исходным соединением (V) является 1,1,1-трис(гидроксиметил)этан или 2,2-бис(гидроксиметил)пропионовая кислота, или 1,3,5-трис(гидроксиэтокси)бензол, или 1,3,5-трис(гидроксиметил)циклогексан, или 2-амино-1,3-пропандиол.
Олигомер тиольного соединения
Олигомер можно получить из тиольных соединений формулы (I), описанных выше. Способ синтеза данных олигомеров описан на схеме на фигуре 2А для олигомеризации соединений формулы (1а) и на схеме на фигуре 2В для олигомеризации соединений формулы (lb) .
На первой стадии со спиртовой функциональной группы соединения (1с) снимают защитную группу для того, чтобы привести к соединению (Ic,1). Данную стадию снятия защитной группы осуществляют с помощью средств, хорошо известных специалисту в данной области техники, предпочтительно в присутствии ди- или трихлоруксусной кислоты для DMTr и пиксильной групп и в присутствии пиперидина для Fmoc группы.
О О
I н 9 J И
Y I Н
i Y
ORi X-W
,0-Р-о
x-w
D-O z /
?R1 X-W
,O-P-о \
II 7
Y О
x-w
D-O z /
N Н
Затем таким же образом соединение (XIV)1 реагирует с (к-1) соединениями (1а), что приводит после (к-1) окислений к соединению (XIV)к:
D-0
о о
?R1 x-w ,ОР-о \
I I
(XIV)1
N Н
(к-1 )la
OR, I 1 О-Р-
X-W
-о \ /
О I
x-w'
' \
(XIV)K
О о
А.Л..-П
и со спиртовой функциональной группы соединения (XV') 1 снимают защитную группу, чтобы получить (XV") 1, которое реагирует с (к-1) соединениями (lb), что приводит к соединению (XV) к:
о о
Л Л
О О
Л Л
,0-Р-о
x-w
Н-0 z
x-w
(XV")1
(к-1) lb
x-w
,0-Р-Ц О" \_
x-w'
(XV')K
-о \ /
Затем соединение (XV') к окисляют, предпочтительно в присутствии дийода и воды, что приводит к фосфодиэфирному соединению (XV)к.
О О
N Н
Х.А..Д]
X-W
.о-р-1- о \_ /
x-w
(XV)
,0-Р-
x-w
О о
А л.. А
о I
x-w'
> \
(XV)K
В заключение, возможная последняя стадия состоит из снятия защитной группы с соединений (XIV)k или (XV)к, что приводит к такому же соединению (I)k.
он I
x-w
о-р-1- о Ч /
x-w
-о \ /
!- S
(Ok
Предпочтительно олигомер образуется в результате олигомеризации от 2 до 12 соединений (I), в частности, между 2 и 8 соединениями (I), т.е. олигомер может содержать 2, 3, 4, 5, б, 7 или 8 соединений (I) . Предпочтительно тиольный олигомер предназначен для прививки на золотую поверхность, включающую между 3 и 8, предпочтительно, между 4 и 8 соединениями (I) . Тиольный олигомер предназначен для связывания с поверхностью, включающей по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные функциональные группы, предпочтительно малеимидные или акриламидные функциональные группы, предпочтительно включающие между 2 и б соединениями (I).
В одном из вариантов олигомер получают исключительно из соединений формулы (1а) или из соединений формулы (lb). Олигомеризацию проводят по реакции между незащищенной спиртовой функциональной группой первого соединения (I) и фосфорамидитной или Н-фосфонатной функциональными группами второго соединения (I) •
Также возможно рассматривать получение олигомера, исходя
из смеси соединений (1а) и соединений (lb), этот вариант осуществления представляет меньший интерес.
Предпочтительно олигомер получают, используя химию фосфорамидита, т.е. олигомеризацией соединений типа (1а).
Олигомеризацию можно проводить на твердом носителе или в растворе. Предпочтительно олигомеризацию проводят на твердом носителе. Фактически, олигомеризация в растворе предполагает стадии очистки хроматографией, стадии, которые экономически бесперспективны, особенно для маленьких количеств, требуемых при применениях в диагностировании.
Твердый носитель, привитый олигомером соединения (1а) или соединения (lb), соответствует следующей формуле (XVI)к:
(1с) - (Г)к (XVI)k
в которой:
к обозначает целое число между 1 и 11,
(1с) имеет такое же толкование, как и выше,
(I') обозначает (1'а) или (I'b), с
OR.
I 1
^ОР
Y О
(Га) = x-W и
-О \ / S
О II
А-Р-
(ГЪ)= X о
x-w
-о \ /
Олигомер на твердом носителе, полученный из соединения (1с) и из соединений формулы (1а), соответствует следующей формуле (XIV)k:
OR,
,o-p-
Y О о
x-w
' \
О О
АЛ./°
N H
X-W
(xiv)k
в которой D, X, Y, W, Z, J, R и Ri имеют такое же толкование, как описано выше, и R может дополнительно представлять Н; к обозначает целое число между 1 и 11.
Олигомер на твердом носителе, полученный из соединения (1с) и из соединений формулы (lb), соответствует следующей формуле (XV)к:
О О
x-w
' \
Х.Х.Л
(XV)k
.о-р-У о
x-w
в которой D, X, Y, W, Z, J и R имеют такое же толкование, как описано выше, и R может дополнительно представлять Н; к обозначает целое число между 1 и 11.
В случае, когда олигомер формируют на твердом носителе, исходя из соединения (1с) и соединений (lb), полученное соединение (XV)k соответствует такой же формуле, как и соединение (XIV)к, но в котором Ri обозначает атом водорода после окисления Н-фосфонатдиэфирных связей.
В конце реакции олигомеризации можно рассмотреть снятие защитных групп с тиольных функциональных групп стандартными способами, и тогда R обозначает Н.
Модифицированные олигонуклеотиды
Предмет настоящего изобретения относится к
модифицированным нуклеотидам, включающим по меньшей мере десять
нуклеотидов и по меньшей мере два тиольных соединения (I), как описано выше.
В настоящей патентной заявке термин олигонуклеотид обозначает цепь, включающую от 4 до 100 нуклеотидов.
Тиольное соединение по изобретению привито по положению 3' в цепи или по положению 5' олигонуклеотида.
Процесс получения упомянутого модифицированного
олигонуклеотида содержит по меньшей мере:
стадию прививки соединения (I) на олигонуклеотид для получения 5'-тиольного олигонуклеотида, или
- стадию прививки нуклеотида на олигомер соединения (I) для получения З'-тиольного олигонуклеотида.
В одном из вариантов привитый олигонуклеотид соответствует следующей формуле (XI1а):
? - Ni - N2- ...- Nn-i- Nn- (Г)у "(Mi -...- Mm_i- Mm)p - (I')y'
(Xlla)
в которой
Ni, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид, (I') обозначает соединение формулы (1'а) или (I'b), п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, р обозначает 0 или 1,
у' обозначает целое число от 0 до 12, если р равно 1, и у' равно 0, если р равно 0,
сумма целых чисел (у+у') не больше 12, ? обозначает твердый носитель.
Модифицированный олигонуклеотид (Xlla) имеет два или более тиольных соединения в положении 5' олигонуклеотида N или в нуклеотидной цепи. Его получают прививкой соединения (I), за которой следует удлинение олигомера, полученного из (I) в положении 5' олигонуклеотида. Затем в случае, когда р=1, удлинение нуклеотидной цепи продолжается. Затем таким же образом можно рассмотреть прививку одного или более
дополнительных соединений (I) в положении 5' олигонуклеотида М.
Схема получения соединения (XI1а) описана на фигуре 3, в которой тиольные соединения обозначают тип (1а), и р равно 0. Первые три стадии в приготовлении соединения (Xlla) обеспечивают синтез олигонуклеотида. Олигонуклеотид синтезируют на твердом носителе по стандартным методам, хорошо известным специалисту в данной области техники. На первой стадии первый нуклеотид прививают на твердый носитель, затем другие нуклеотиды прививают по способам синтеза, хорошо известным специалисту в данной области техники. Получают следующее соединение:
(ХПа.1)
?_Nl-N2"Nn-l
Затем другой нуклеотид прививают идентичным способом, приводящим к соединению формулы (XI1а.2).
На следующей стадии тиольное соединение типа (1а), описанное выше, прививают по положению 5' олигонуклеотида (Xlla.2), что приводит к соединению (ХИа.З) :
- Ni - N2- ...- Nn-i- Nn- (Га) (ХПа.З)
На этой стадии прививку проводят стандартно по реакции фосфорамидитной функциональной группы соединения (1а) со спиртовой функциональной группой в положении 5' концевого нуклеотида соединения (XI1а.2).
На схеме на фигуре 3 описывают пример синтеза с олигомеризацией тиольного соединения типа (1а); аналогичный способ синтеза используют для синтеза олигонуклеотидов, модифицированных тиольными соединениями типа (lb).
Затем протекает олигомеризация, как описано ранее, в частности, на фигурах 2А и 2В, исходя из соединения (ХПа.З) выше, по реакции с одним или более соединением (1а) или (lb), что приводит к соединению (Xlla.4) формулы:
? -N1-N2- ...-Nn-i-Nn-(I'a)y
или в качестве структурной формулы (в случае, когда р=0):
(XIIa.4)
в которой
D, R, X, Y, W, Z, Ri имеют такое же толкование, как для соединения (I), и R может дополнительно представлять Н,
п, у и Ni, N2, ...Nn_i имеют такое же толкование, как для соединения (Xlla),
Вп обозначает основание, которое стандартно используют в нуклеотидной цепи.
В случае, когда удлинение олигомера проводят с
соединениями типа (lb), модифицированный олигонуклеотид имеет
структуру, аналогичную структуре модифицированного
олигонуклеотида, но в которой Ri обозначает Н.
Следующая далее прививка нуклеотидных соединений Mi, М2 ...Mm тогда возможна, что приводит к продукту (Xlla) с р=1. В данных случаях удлинение также происходит на твердом носителе.
Эту стадию прививки проводят стандартными способами, хорошо известными специалисту в данной области техники.
Согласно другому варианту осуществления привитый олигонуклеотид соответствует следующей формуле (ХШа) :
(1с) - (Г)у-1 - N1 - N2- ...- Nn-i- Nn - (Г)у- -[Mi - М2 -... - Mm_i - Mm]p-(I V
(ХШа)
в которой
N1, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид, (I') обозначает соединение формулы (1'а) или (I'b),
п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, у' обозначает целое число от 2 до 12,
р равно 0 или 1, если у' отлично от 0, и если у' равно 0, тогда р равно 0,
у' ' обозначает целое число от 2 до 12, если р равно 1, и если р равно 0, тогда у'' равно 0,
сумма целых чисел (у+у'+у'') не больше 12.
Схема, представляющая способ синтеза соединения (ХШс) , описана на фигуре 4 при применении олигомера, полученного из соединения типа (1с), где J обозначает этильную группу, и соединений типа (lb).
Синтез соединения формулы (ХШс) содержит первую стадию, состоящий из олигомеризации тиольного соединения формулы (I) по изобретению, способ выполнения которого описан выше, что приводит к соединению формулы (ХШа.1) :
(Ic)-(F)y-i (ХШа.1)
в которой
(1с) имеет такое же толкование, как раньше,
(I') обозначает группу типа (1'а) или (I''b), где
^S-R
- P-O-Y Х-0- I
или в качестве структурной формулы в случае, когда (I') обозначает (!''Ь):
S /
n" YY
4w-x
Y О
х-о
(XV')y
о о
На второй стадии первый нуклеотид Ni прививают на олигомер формулы (ХШа.1), что приводит к соединению следующей формулы (ХШа.2) :
(Ic)-(F)y-i-Ni (ХШа.2)
Данную стадию прививки проводят по реакции между незащищенной спиртовой функциональной группой на конце олигомерной цепи соединения (ХШа.1) и фосфорамидитной или Н-фосфонатной функциональными группами первого нуклеотида Ni.
Далее модифицированный олигонуклеотид синтезируют по любому способу, известному специалисту в данной области техники, в частности, по стандартному способу, хорошо известному специалисту в данной области техники, по реакции между спиртовой функциональной группой у 5' первого нуклеотида, присутствующей в олигомере тиольного соединения, и фосфорамидитной или Н-фосфонатной функциональными группами в положении 3' второго нуклеотида. Синтез продолжают по аналогичным успешным стадиям удлинения нуклеотидной цепи, хорошо известным специалисту в данной области техники, что приводит к соединению формулы (ХШа) .
Объект настоящего изобретения относится к соединениям, полученным из соединений формулы (Xlla) и (ХШа) выше, после разрыва связи, которая присоединяет модифицированный олигонуклеотид к твердому носителю. Разрыв связи происходит на уровне сложноэфирной функциональной группы.
Таким образом, В одном из вариантов осуществления изобретения неподдерживаемый модифицированный олигонуклеотид
изобретения имеет следующую структуру (XIlb):
Ni - N2- ...- Nn-i- Nn- (ГЬ)У -(Mi -...- Mm_i- Mm)p - (ГЬ)у
(Xllb)
в которой
N1, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид, (I'b) обозначает соединение формулы, как обозначено выше, п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, р обозначает 0 или 1,
у' обозначает целое число от 2 до 12, если р равно 1, и у' равно 0, р равно 0,
сумма целых чисел (у+у') не больше 12.
Удаление носителя проводят в две стадии, сначала с ненуклеофильным сильным основанием (пиперидином или ДБУ) для того, чтобы удалить цианоэтильные группы, если имеются (в случае фосфорамидитов), и затем по стандартному способу, известному специалисту в данной области техники, предпочтительно обработкой соединения (Xlla) гидроксидом аммония (NH4OH). Необходимо удалить цианоэтильные группы до снятия защиты с тиольных групп, так как они образуют акрилонитрил во время их удаления, который энергично реагирует с тиольными функциональными группами.
Согласно другому варианту осуществления изобретения неподдерживаемый модифицированный олигонуклеотид изобретения имеет следующую структуру (XIlib):
(Ic')-(I'b)y-i - N1 - N2- Nn-i- Nn - (ГЬ)у -[Mi - M2 - ... - Mm_i - Mm]p-(Fb)y" (XHIb)
в которой
N1, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид, (1'с) обозначает соединение, полученное из (1с) по разрыву
сложноэфирной связи с твердым носителем, и предпочтительно
имеет структуру
(1С)
,о-н
x-w
-о \ /
(I'b) обозначает соединение формулы, как обозначено выше, п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, у' обозначает целое число от 0 до 12,
р равно 0 или 1, если у' отлично от 0, и если у' равно 0, тогда р равно 0,
у' ' обозначает целое число от 0 до 12, если р равно 1, и если р равно 0, тогда у'' равно 0,
сумма целых чисел (у+у'+у'') не больше 12.
Удаление носителя проводят по стандартному способу, известному специалисту в данной области техники, предпочтительно обработкой соединения (ХШа) гидроксидом аммония (NH4OH).
В одном из вариантов настоящего изобретения в случае, когда р=0, модифицированный олигонуклеотид соответствует структурной формуле (XIlb):
0=Р-0
(XII b)
в которой п, у, Ni,...,Nn_i, X, Y, Z, W и R имеют такое же толкование, как и выше, и Вп обозначает основание п-ного нуклеотида.
Согласно другому варианту осуществления настоящего изобретения в случае, когда р=0, модифицированный олигонуклеотид соответствует структурной формуле (ХШЬ) :
(XIII b)
RS.
HO-Y'
чх-о-
-P-O-Y'
I _ О
x-o-
0-P=0
O-i /О
-p-o
I _ о
y-1
в которой n, у, N2,...,Nn, X, Y, Z, W и R имеют такое же толкование, как и выше, и Bi обозначает основание 1-ого нуклеотида.
Настоящее изобретение дополнительно относится к модифицированным олигонуклеотидам (ХПс) и (ХШс) , полученным, соответственно, исходя из соединений (Xlla) и (ХШа) снятием защиты с тиольной функциональной группы и разрывом связи, соединяющей соединение с твердым носителем (Фигуры 3 и 4, соответственно).
В случае, когда олигонуклеотид модифицируют одним или более тиольным соединением типа (1а) после снятия защиты с тиольной функциональной группы и с фосфорамидитной функциональной группы соединения (Xlla) при обработке, известной специалисту в данной области техники, получают соединение формулы (ХПс) :
N1 - N2- ...- Nn-i- Nn- (I")y "(Mi -...- Mm_i- Mm)p - (Г'V
(XIIc)
в которой
Ni, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид,
HS^
(I")
I о I II
,0-Х Y-0 I О
п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, р обозначает 0 или 1,
у' обозначает целое число от 0 до 12, если р равно 1, и у' равно 0, р равно 0,
сумма целых чисел (у+у') не больше 12.
или в качестве структурной формулы в случае, когда р=0:
HS4
z о
_w Р_ о-х v-o |
(ХПс)
(ХПс)
О=Р-О-
Nn-1
N-|
в которой
X, Y, W, Z, Ri имеют такое же толкование, как для соединения (I),
Ni, ...Nn, п, у имеют такое же толкование, как для соединения (ХПа) ,
Вп обозначает основание, которое стандартно используют в нуклеотидной цепи.
В случае, когда олигонуклеотид модифицируют одним или более тиольным соединением типа (lb) после снятия защиты с тиольной функциональной группы и с фосфорамидитной
функциональной группы соединения (ХШа) при обработке, известной специалисту в данной области техники, получают соединение формулы (ХШс) :
(Ic')-(I')y-i-Ni -N2- ...-Nn-i-Nn-a")y-[Mi -М2 -... -M^i-MJp-a'V
(ХШс)
в которой
Ni, ...Nn обозначают, независимо друг от друга, нуклеотид, Mi, ...Mm обозначают, независимо друг от друга, нуклеотид, (1с') обозначает соединение, полученное из (1с) по разрыву сложноэфирной связи с твердым носителем,
(I")
,о-х'
о II
/Р-
Y-O I-О
п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, у' обозначает целое число от 2 до 12,
р равно 0 или 1, если у' отлично от 0, и если у' равно 0, тогда р равно 0,
обозначает целое число от 0 до 12, если р равно 1, и
если р равно 0, тогда у'' равно 0,
сумма целых чисел (у+у'+у'') не больше 12.
или в качестве структурной формулы в случае, когда у'=р=0
HS.
HO-Y'
чх-о-
HSN
о II
P-O-Y"
I _ L О
x-o-
O-P=O I
O-v ,0
O II
-P-0
I _
(XIIIc)
в которой
X, Y, W, Z имеют такое же толкование, как для соединения
(D ,
N2, ...Nn, n и у имеют такое же толкование, как для соединения (Xlla),
Вп обозначает основание, которое стандартно используют в нуклеотидной цепи.
Во время синтеза олигонуклеотида тиольную функциональную группу предпочтительно защищают. Фактически, тиольная функциональная группа может реагировать с вводимой фосфорамидитной функциональной группой.
Стадию снятия защиты с тиольных функциональных групп и удаление твердого носителя можно проводить в одну стадию обработки модифицированных олигонуклеотидов (Xlla) или (ХШа) .
Удаление твердого носителя можно также проводить в одну стадию, и снятие защиты тиольных функциональных групп также проводят на второй стадии.
Конечный олигонуклеотид (ХПс) (соответственно, конечный олигонуклеотид (ХШс) ) получают независимо от исходного тиольного соединения, исходя либо из соединения (1а), либо соединения (lb) . Фактически, независимо от того, используют ли мономер (1а) или (lb), тиольный мономерный элемент, получаемый из реакции олигомеризации, соответствует соединению (I'')/ описанному выше.
Привитые носители формул (XVI)к, описанные выше, позволяют инициировать олигонуклеотидный синтез. Можно, в частности, разработать промышленное или полупромышленное получение твердых носителей с последовательностями олигомеров, которые будут использованы в качестве политиольной последовательности в положении 3' олигонуклеотида.
В одном из вариантов осуществления изобретения нуклеотидная последовательность (Ni-N2-...-Nn-i-Nn) и, если требуется, нуклеотидная последовательность (Mi-M2-...-Mm-i-Mm) модифицированного нуклеотида изобретения, как описано выше, являются специфичными к вирусу, бактерии или гену, определяющему заболевание или участвующему в заболевании.
В рамках значения патентной заявки под "специфическим" имеют в виду, что последовательность (Ni-N2-...-Nn_i-Nn) и, если требуется, нуклеотидная последовательность (Mi-M2-...-Mm_i-Mm)
дополняют друг друга полностью или частично по меньшей мере в
одной последовательности нуклеиновой кислоты-мишени,
содержащейся в гене или геноме вируса, или бактерии, и характеризующей последние. Таким образом, понимают, что гибридизация последовательности (Ni-N2-...-Nn_i-Nn) и, если требуется, последовательности (Mi-M2-...-Mm-i-Mm) с частью или всеми последовательностями-мишенями, соответствующими ей, приводит к образованию двойного комплекса нуклеиновых кислот, содержащих, самое большее, 2 ошибочных спаривания. В одном варианте осуществления изобретения термин "специфический" обозначает, что сформированный двойной комплекс не содержит ни одного ошибочного спаривания. Под "последовательностью, характеризующей ген или геном вируса, или бактерии" подразумевают геномный, хромосомный или плазмидный участок организма, вируса или бактерии, содержащий организацию нуклеотидов, не найденных в других организмах, по причине уникальных генетических изменений.
В рамках изобретения термины "модифицированный олигонуклеотид" и "зонд" используют как синонимы и обозначают олигонуклеотид с 4 до 100 нуклеотидами и содержащий по меньшей мере 2 тиольные функциональные группы, как описано выше. Предпочтительно, когда его используют при генотипировании, модифицированный олигонуклеотид изобретения содержит от 13 до 2 0 нуклеотидов, предпочтительно 14 или 15 нуклеотидов. Следовательно, зонд имеет способность к прививке на подходящую поверхность, такую как поверхность, покрытую золотом или с малеимидными группами, и также имеет способность к гибридизации через его нуклеотидную часть для того, чтобы сделать нуклеотидную последовательность мишенью.
Предпочтительно модифицированный нуклеотид изобретения содержит от 2 до 12 тиольных функциональных групп, в частности, между 2 и 8 функциональными группами, т.е. модифицированный нуклеотид может содержать 2, 3, 4, 5, б, 7 или 8 функциональных групп. Предпочтительно модифицированный нуклеотид предназначен для прививки на золотую поверхность, включающую между 3 и 8, предпочтительно между 4 и 8 тиольными функциональными группами.
Модифицированный олигонуклеотид, предназначенный для связывания с поверхностью, содержащей по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы, предпочтительно содержит от 2 до 8 тиольных функциональных групп и предпочтительно 4 тиольных функциональных группы.
Термин "последовательность-мишень", используемый в
контексте изобретения, обозначает последовательность,
комплементарную или частично комплементарную зонду изобретения и амплифицированную из гена или из генома вируса или бактерии, предпочтительно из характерного участка последних.
Термин "вирус" обозначает биологическое существо, которому требуется клетка-хозяин для самовоспроизведения, и которое содержит как минимум нуклеиновую кислоту и протеины, более того, нуклеиновая кислота может быть одноцепочечной или двухцепочечной ДНК и/или РНК. Вирусы содержат вирусы, способные к паразитированию на прокариотах (например, Myoviridae, Siphoviridae, Podoviridae, Microviridae и Inoviridae), вирусы, способные к паразитированию на растениях (фитовирусы, такие как тобамовирус), на насекомых (например, бакуловирусы), грибах и человеке. В контексте изобретения вирусы также содержат арбовирусы. Группа арбовирусов объединяет морфологически гетерогенные вирусы, принадлежащие к нескольким разным родам, включающим более подробно роды Flavivirus (семейство Flaviviridae), Alphavirus (семейство Togaviridae), Coltivirus
(семейство Reoviridae) , Phlebovirus (семейство Bunyaviridae) . Более широко, семейство Flaviviridae в частности содержит роды Flavivirus (вирус желтой лихорадки, вирус Западного Нила, вирус клещевого энцефалита (ВКЭ) , вирус японского энцефалита, вирус энцефалита Сент-Луис, вирус усуту и вирус денге), Hepacivirus
(вирус гепатита С) и Pestivirus (вирусная диарея крупного рогатого скота (ВД КРС), вирус свиной чумы). Семейство Togaviridae, в частности, содержит роды Alphavirus (вирус Синдбис, лихорадка реки Росс, вирус о"Нъонг-нъонг, вирус чикунгунья) и Rubivirus (вирус коревой краснухи). Семейство
Reoviridae, в частности, содержит вирусы, поражающие пищеварительную систему (такие как Rotavirus) или дыхательную систему. Семейство Bunyaviridae, в частности, содержит роды Hantavirus (хантавирусный легочный синдром, корейская геморрагическая лихорадка), Nairovirus (вирус Дугбе), Orthobunyavirus (вирус Буньямвера), Phlebovirus (лихорадки долины Рифт) и Tospovirus.
В контексте изобретения вирусы, способные к заражению человека, содержат Vesiculoviruses (вирус везикулярного стоматита, и т.д.), Lyssaviruses (вирус бешенства, Австралийский лиссавирус летучих мышей); Picornaviruses
(Rhinovirus, Poliovirus, вирус гепатита А, и т.д.),
Herpesviruses (авипоксвирус, опоясывающий герпес,
цитомегаловирус ЦМВ, вирус Эпштейна-Барра ЭБВ, и т.д.), Orthomyxoviruses (вирус гриппа, и т.д.), Paramyxoviruses (вирус кори, вирус свинки, и т.д.), Poxviruses (вирус оспы человека, и т.д.), Coronaviruses (атипичная пневмония, и т.д.), Filoviruses
(Эбола, и т.д.), Hepadnaviruses (вирус гепатита В) и ретровирусы (СПИД, вирус человеческого Т-клеточного лейкоза, и т.д. ) .
Термин "бактерия" обозначает любой прокариотический живущий организм, характеризуемый отсутствием ядра и органелл и обеспеченный клеточной стенкой. Данный термин, в частности, содержит бактерии, которые могут быть патогенными и могут вызвать заболевания и/или инфекции в человеке, такие как Corynebacterium diphtheriae (дифтерия), Treponema pallidum
(сифилис), Mycobacterium tuberculosis (туберкулез),
Mycobacterium leprae (проказа), Neisseria gonorrhoeae
(гоноррея), Rickettsia (тиф), Clostridium tetani (столбняк) ,
Vibrio cholerae (холера), Pseudomonas aeruginosa и
Staphylococci (условные патогены). Этот термин также включает
бактерии, вовлеченные в риски при переливании крови и во
внутрибольничные инфекции, такие как, например
грамотрицательные бактерии Escherichia coli, Klebsiella
oxytoca, Klebsiella pneumoniae, Serratia marcescens, Yersinia
enterocolitica, Enterobacter aerogenes, Acinetobacter
baumannii, и Pseudomonas aeruginosa, или грамположительные бактрии Staphylococcus epidermidis, Staphylococcus aureus, Bacillus cereus, Streptococcus pyogenes, Propionibacterium acnes и Clostridium perfringens.
В одном из вариантов осуществления изобретения нуклеотидную последовательность (Ni-N2-...-Nn-i-Nn) и, если требуется, нуклеотидную последовательность (Mi-M2-...-Mm-i-Mm) выбирают из:
- последовательностей SEQ ID N0: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 35 или SEQ ID NO: 36, специфических к вирусу гепатита С (ВГС),
- последовательностей SEQ ID N0: 16, SEQ ID NO: 17 или SEQ ID NO: 40, специфических к флавивирусам,
- последовательностей SEQ ID N0: 18 или SEQ ID NO: 41, специфических к вирусу денге, или
- последовательности SEQ ID N0: 19, специфической к вирусу Западного Нила (ВЗН).
В одном из вариантов осуществления изобретения нуклеотидная последовательность (Ni-N2-...-Nn_i-Nn) и, если требуется, нуклеотидная последовательность (Mi-M2-...-Mm_i-Mm) имеют структуру альфа-аномера, бета-аномера, линейную или типа "улитка". Когда нуклеотидная последовательность имеет структуру типа бета-аномер, модифицированный олигомер изобретения (тиолы которого находятся на конце 5') гибридизируется в антипараллельной ориентации к последовательности-мишени. Когда нуклеотидная последовательность имеет структуру типа альфа-аномер, модифицированный олигомер изобретения (тиолы которого находятся на конце 3' ) гибридизируется в параллельной ориентации к последовательности-мишени.
Функционализация поверхности
Модифицированные олигонуклеотиды по изобретению можно переместить на субстрат для того, чтобы функционализировать поверхность данного субстрата. Субстрат может быть металлическим или изготовленным из полимера, проводящим или непроводящим. Он может быть ровным (частично или полностью) или кривым и может быть предпочтительно сферической формы.
В одном из вариантов осуществления изобретения субстрат
неплоский, например, в форме микрочастиц или наночастиц. Модифицированные олигонуклеотиды по изобретению можно затем привить на данные микрочастицы или наночастицы. Предпочтительно данные частицы магнитные. Фактически, данные магнитные частицы можно затем легко перенести на поверхность электрода или на нижнюю часть ячеек микропланшета с целью проведения теста на детекцию, генотипирование и секвенирование с использованием магнита. Использование неплоского носителя типа микрочастиц или наночастиц в контексте метода детекции изобретения предпочтительно обеспечивает увеличение области поверхности, на которую можно привить модифицированные олигонуклеотиды изобретения и, таким образом обеспечивает увеличение пропорции гибридизации между зондами и последовательностями-мишенями.
В одном из вариантов осуществления изобретения субстрат является металлическим, например, медью или титаном, и его поверхность покрыта частично или полностью тонким слоем золота или платины, предпочтительно золотом.
В одном из вариантов осуществления изобретения субстрат является полимером, предпочтительно проводящим полимером.
В одном из вариантов осуществления изобретения субстрат может содержать зоны приема, покрытые тонким слоем золота или платины или покрытые алкенильными, алкинильными или галогенацетамидными функциональными группами, такими как малеимидные или акриламидные функциональные группы, на которые помещают модифицированные олигонуклеотиды.
В одном из вариантов осуществления изобретения группы, включающие по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь выбирают из алкенов, активированных карбонильной функциональной группой в альфа-положении, и алкены предпочтительно выбирают из малеимидных и акриламидных групп.
В одном из вариантов осуществления изобретения галогенацетамидные группы выбирают из бромоацетамидных и йодоацетамидных групп.
В одном из вариантов осуществления изобретения группы, включающие по меньшей мере одну углерод-углеродную тройную
связь, выбирают из алкинов, активированных карбонильной функциональной группой в альфа-положении, и алкины предпочтительно выбирают из 2-пропинамидных групп.
Как изображено на фигуре 16а, в которой соединение gpt -SH обозначает модифицированный олигонуклеотид по изобретению, тиольная функциональная группа реагирует с углерод-углеродной двойной связью или углерод-углерод тройной связью, активированной карбонильной функциональной группой в альфа-положении. Сверху вниз на фигуре 13а первая реакция функционализации соответствует поверхности с привитым малеимидом, вторая реакция соответствует поверхности с привитым акриламидом, третья реакция соответствует поверхности с привитым йодоацетамидом или бромоацетамидом, и четвертая реакция соответствует поверхности с привитым 2-пропинамидом, изготовленной в случае, если модифицированный олигонуклеотид по изобретению содержит два тиольных соединения.
В случае фигуры 16Ь, поверхность привита с неактивированными алкенильными группами (1ая реакция) или алкинильными группами (2ая реакция). Реакцию между тиольными функциональными группами модифицированного олигонуклеотида и группами на поверхности проводят, используя активацию светом (А=2 65 нм) . Первую реакцию функционализации проводят, используя олигонуклеотид, модифицированный монотиолом, представленный схематически как gpt-SH, и вторую реакцию проводят, используя олигонуклеотид, модифицированный дитиолом.
В случае, когда носитель привит с алкинильными функциональными группами, функционализация поверхности с олигонуклеотидом, модифицированным политиолом, является очень интересной, так как она приводит к циклической структуре вследствие двух успешных реакций между первой тиольной функциональной группой и -иновой группой на первой стадии и затем между второй тиольной функциональной группой и -еновой группой на второй стадии (фигуры 16а и 16Ь).
По предпочтительному варианту осуществления субстрат прививают с малеимидными или акриламидными группами.
Таким образом, изобретение обеспечивает, например,
функционализацию золотой поверхности посредством создания связи(ей) золото-сера между поверхностью субстрата и модифицированным олигонуклеотидом или функционализацию поверхности, привитой с малеимидными или акриламидными функциональными группами посредством создания тиоэфирной(ых) связи(ей).
Фиксирование модифицированных олигонуклеотидов на поверхность субстрата проводят посредством погружения поверхности для обработки в раствор, включающий модифицированные олигонуклеотиды по изобретению, описанному выше. Обычно обеспечивают одну или более следующих стадий промывания и сушки. Обычно раствор модифицированных олигонуклеотидов имеет концентрацию между 0,10 мкМ и 500 мкМ, предпочтительно между 0,5 мкМ и 100 мкМ, когда поверхность субстрата изготовлена из золота, и между 50 нМ и 200 нМ, предпочтительно между 75 нМ и 150 нМ, когда поверхность субстрата образована из малеимида. За погружением следует промывание для того, чтобы удалить все, что не прореагировало.
Наличие нескольких атомов серы в олигонуклеотидах обеспечивает формирование нескольких связей золото-сера или нескольких тиоэфирных связей, которые обеспечивают стабилизацию олигонуклеотида на поверхности.
Следовательно, предмет изобретения содержит субстрат, привитый по меньшей мере с одним модифицированным олигонуклеотидом, как описано выше, упомянутый субстрат, включающий по меньшей мере одну зону приема, покрытую соединением, которое выдерживает прививку упомянутого модифицированного олигонуклеотида. В одном из вариантов осуществления изобретения субстрат находится в форме электрода. Согласно другому варианту осуществления изобретения субстрат находится в форме микропланшета с 9 6 или более ячейками.
В одном из вариантов осуществления изобретения, привитая поверхность по изобретению изготовлена из металла, предпочтительно меди или титана, и содержит по меньшей мере одну зону приема, покрытую тонким слоем золота или платины. Согласно другому варианту осуществления изобретения привитая
поверхность по изобретению изготовлена из пластика, предпочтительно полистирола, и зона приема покрыта малеимидными группами и/или содержит на поверхности по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы.
В одном из вариантов осуществления изобретения плотность прививки модифицированного олигонуклеотида по изобретению, полученная на зоне приема, возникает как результат использования растворов для прививки от 10 нМ на ячейку до 500 нМ на ячейку, когда в качестве субстрата используют микропланшет с 9 6 ячейками. Предпочтительно, плотность прививки модифицированного олигонуклеотида по изобретению в зоне приема субстрата получают при использовании раствора для прививки 100 нМ на ячейку, когда в качестве субстрата используют микропланшет с 9 6 ячейками.
Фиксирование к маркерам или лигандам
Модифицированные олигомеры настоящего изобретения можно
также связать через одну или более точек прикрепления к
маркерам или лигандам, которые могут являться, например,
ферментными, хромогенными, флуорогенными, радиоактивными или
хемилюминесцентными маркерами, металлами, ионами металлов,
гормонами, протеинами, пептидами, сахаридами, олигосахаридами,
нуклеолитическими или протеолитическими агентами, связывающими
веществами, такими как биотин, антиген, гаптен, антитело или
рецептор. Предпочтительно, чтобы данный маркер или лиганд
обеспечивал детекцию события гибридизации между
модифицированным олигонуклеотидом изобретения и типичной последовательностью-мишенью гена, вируса или бактерии.
Согласно другому варианту осуществления изобретения маркер
или лиганд связывается с типичной нуклеотидной
последовательностью-мишенью гена, вируса или бактерии и
обеспечивает детекцию события гибридизации между
модифицированным олигонуклеотидом изобретения и
последовательностью-мишенью.
Метод детекции
Настоящее изобретение дополнительно относится к методу детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце, включающему стадию детекции упомянутой нуклеиновой кислоты по меньшей мере одним детектирующим зондом, полученным из модифицированного олигонуклеотида, как описано выше.
В одном из вариантов осуществления изобретения способ детекции изобретения содержит стадии:
- получения по меньшей мере одной "исходной" нуклеиновой кислоты из биологического образца,
- получения ампликона амплификацией упомянутой нуклеиновой кислоты-мишени из исходной нуклеиновой кислоты, и
- детекции гибридизации между ампликоном и по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида, как описано выше.
Под "биологическим образцом" имеется в виду любое вещество, содержащее или предположительно содержащее нуклеиновую кислоту, такую как ДНК или РНК, и полученное от человека, животного, овоща или любого образца жидкого или твердого содержания. Биологический образец включает в себя, например, образцы тканей или жидкостей, выделенных из индивидуума или индивидуумов, включающих, но не ограниченных кожей, кровью, плазмой, сывороткой крови, спинномозговой жидкостью, лимфатической жидкостью, синовиальной жидкостью, мочой, слезами, клетками крови, костным мозгом, органами, опухолями, а также образцами компонентов in vitro клеточных культур. Биологический образец можно предпочтительно обрабатывать для разрушения структуры тканей или клеток, для того, чтобы ввести их внутриклеточные компоненты в раствор.
Под "ампликоном" подразумевают молекулу нуклеиновой кислоты, произведенной во время процедуры амплификации характерной последовательности нуклеиновой кислоты-мишени гена, вируса или бактерии, содержащейся в биологическом образце. В одном из вариантов осуществления изобретения ампликон получают по технике полимеразно-цепной реакции (ПЦР) (по-английски, "polymerase-chain reaction" или PCR) . Ампликон, используемый в
способе детекции изобретения, предпочтительно имеет размер, изменяющийся от 75 п.о. до около 500 п.о. В частности, получается, что одно из преимуществ способа изобретения заключается в возможности использования ампликонов, имеющих длину в один или несколько сотен нуклеотидов, которое является невозможным в способах детекции, известных в предшествующем уровне техники. Таким образом, способ детекции изобретения обеспечивает выборку и амплификацию более крупных нуклеотидных последовательностей-мишеней в генах, вирусах или бактериях.
В одном из вариантов осуществления изобретения способ детекции обеспечивает установление вирусного генотипа и/или подтипа, присутствующего в биологическом образце. Ампликон более специфически получают амплификацией нуклеотидной последовательности-мишени, соответствующей геномному участку вируса, содержащего информацию, относящуюся к вирусному генотипу и/или подтипу, и детекцию проводят зондом, специфическим к определенному вирусному генотипу и/или подтипу. Таким образом, способ изобретения обеспечивает эффект детекции, основанный на последовательностях-мишенях, содержащих больше информации о типе или подтипе вируса или бактерии. Это преимущество является прямым следствием модифицированных олигонуклеотидов по изобретению, способа изобретения и возможности фиксировании к зоне фиксирования субстрата. Предпочтительно из этого следует, что больше не требуется определять праймеры для амплификации как можно более короткой последовательности-мишени из вирусного или бактериального генома. Вместо этого способ изобретения обеспечивает выборку праймеров, находящихся в консервативных областях семейств исследуемых вирусов или бактерий, и амплификацию более длинных последовательностей-мишеней. Следствиями являются существенная экономия и увеличение легкости использования, поскольку можно использовать одинаковые праймеры для амплификации геномной зоны, встречающейся в нескольких типах и/или подтипах вирусов или бактерий, без опасения обнаружить, что гибридизация приводит к результатам, искаженным размером используемого ампликона.
В одном из вариантов осуществления изобретения стадии получения ампликона по способу детекции изобретения проводят со смесью нуклеотидных праймеров, предпочтительно, выбранных из пар праймеров:
- SEQ ID N0: 8 и SEQ ID N0: 9, когда ампликон получают из ВГС, в независимости от используемого вирусного генотипа. Данная пара праймеров является общей и обеспечивает амплификацию "длинного" ампликона длиной 4 01 н.п., исходя из любого генотипа ВГС;
- SEQ ID N0: 10 и SEQ ID N0: 9, пара, обеспечивающая формирование "коротких" ампликонов длиной 191 н.п., специфических к генотипу la/lb;
- SEQ ID N0: 29 и SEQ ID N0: 9, пара, обеспечивающая формирование "коротких" ампликонов длиной 108 н.п., специфических к генотипу 2;
- SEQ ID N0: 8 и SEQ ID N0: 11, пара, обеспечивающая формирование "коротких" ампликонов длиной 143 н.п., специфических к генотипу За;
- SEQ ID N0: 8 и SEQ ID N0: 30, пара, обеспечивающая формирование "коротких" ампликонов длиной 175 н.п., специфических к генотипу 4a/4d; и
- SEQ ID N0: 20 и SEQ ID N0: 21, и/или SEQ ID N0: 22 и SEQ ID N0: 21, когда ампликон получают из флавивируса.
В одном из вариантов осуществления изобретения модифицированный нуклеотид по изобретению используют в способе детекции при плотности, возникающей в результате соприкосновения раствора для прививки от 10 нМ на ячейку до 500 нМ на ячейку с ячейкой, когда в качестве субстрата используют микропланшет с 9 6 ячейками. Предпочтительно плотность прививки модифицированного олигонуклеотида по изобретению равна 100 нМ, когда в качестве субстрата используют микропланшет с 96 ячейками. Когда модифицированный олигонуклеотид по изобретению содержит 2 тиольные функциональные группы, используемый раствор для прививки имеет концентрацию модифицированного нуклеотида по меньшей мере 10 нМ, когда в качестве субстрата используют микропланшет с 96 ячейками, и концентрация ампликона,
используемая в способе детекции, равна по меньшей мере 100 пМ. Когда модифицированный олигонуклеотид по изобретению содержит 4 тиольных функциональных группы, используемый раствор для прививки имеет концентрацию модифицированного нуклеотида по меньшей мере 10 нМ на ячейку, и концентрация ампликона, используемая в способе детекции, равна по меньшей мере 10 пМ, когда в качестве субстрата используют микропланшет с 96 ячейками.
Способ детекции по изобретению предоставляет особое преимущество для генотипирования ВГС, так как данный способ, в частности, обеспечивает распознавание различных известных генотипов и подтипов ВГС, используя простой молекулярный детектирующий тест.
Инфекции, связанные с вирусом гепатита С, фактически обозначают чрезвычайно важную проблему здоровья, поскольку инфицированные индивидуумы рискуют развить заболевания печени, циррозы и первичные карциномы печени и поскольку они также являются резервуаром инфекции. Эпидемиологические исследования предсказывают трехкратное увеличение ежегодного числа смертей от ВГС в течение следующих 10 лет, если не будут разработаны новые диагностические и терапевтические системы.
ВГС характеризуют значительной генетической изменчивостью и классифицируют по б основным генотипам, включающим более 8 0 подтипов. Точное определение инфекционного генотипа и/или подтипа имеет наибольшее значение для терапевтических стратегий и обеспечивает прогноз эффективности антивирусной реакции и определение длительности терапии, также как и тип лечения и дозировку. Определение точной классификации вирусов ВГС, обнаруженных в инфицированных индивидуумах, также имеет важность для эпидемиологического контроля с целью контроля распространения вирусных штаммов и идентификации факторов передачи.
Многие из коммерчески доступных тестов для детекции и/или количественной оценки РНК ВГС основаны на последовательностях, найденных на некодированном участке 5' (5'NCR, по-английски "noncoding region") , который обозначает собой одну из наиболее
консервативных и хорошо охарактеризованных областей ВГС. Таким
образом, участок 5'NCR выбирают в качестве мишени в различных
известных способах генотипирования, распространяемых
коммерчески, таких как INNO LiPA HCV II тест от Bayer, Trugene HCV 5'NCR набор от Bayer/Siemens Healthcare (WO2007/076493), основанный на анализе последовательностей и тесте на подвижность двойного комплекса ("duplex mobility test"), или система детекции гибридизации, разработанная Roche Molecular Systems (US 2007/014160), включающая множественное типирование вирусов ВГС, созданных на участке 5'NCR или на участке NS5.
Однако, наличие мутаций на участке 5'NCR приводит к некачественной классификации генотипов ВГС в 5 до 8% случаев, что приводит к серьезным последствиям для результатов анализа. По всей видимости, участок 5'NCR больше не обеспечивает достаточной надежности для идентификации генотипов 2 и 4 вируса.
Кроме того, стандартный способ осуществления
генотипирования ВГС заключается в секвенировании специфических участков ВГС и, в частности, участка NS5b вируса, кодирующего РНК-зависимую РНК-полимеразу. Однако секвенирование получается дорогим и времязатратным и требует специального оборудования и обученных операторов. Следовательно, оно не является подходящим для проведения крупномасштабных клинических исследований.
Следовательно, необходимы улучшенные способы детекции и/или генотипирования ВГС распознавания различных известных генотипов и подтипов ВГС, используя простой молекулярный детектирующий тест, такой как тест изобретения.
Дополнительно, настоящее изобретение относится к олигонуклеотиду, содержащему нуклеотидную последовательность, выбранную из последовательностей SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 4 0 и SEQ ID NO: 41. Предпочтительно олигонуклеотид последовательности SEQ ID NO: 1 соответствует нуклеотидной последовательности, найденной специфически в ВГС типа 1а/lb, и обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 27 соответствует нуклеотидной
последовательности, найденной специфически в ВГС типа 2, и
обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 35 соответствует нуклеотидной
последовательности, найденной специфически в ВГС типа 2а/2с, и
обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 36 соответствует нуклеотидной
последовательности, найденной специфически в ВГС типа 2Ь, и
обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 4 соответствует нуклеотидной
последовательности, найденной специфически в ВГС типа За, и
обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 28 соответствует нуклеотидной
последовательности, найденной специфически в ВГС типа 4a/4d, и
обеспечивает детекцию последнего в контексте способа детекции,
как описано выше. Предпочтительно олигонуклеотид
последовательности SEQ ID N0: 16, SEQ ID NO: 17 или SEQ ID NO: 4 0 соответствуют нуклеотидной последовательности, найденной специфически во флавивирусах, и обеспечивают детекцию последнего в контексте способа детекции, как описано выше. Предпочтительно олигонуклеотид последовательности SEQ ID N0: 18 соответствует нуклеотидной последовательности, найденной специфически в вирусе денге, и обеспечивает детекцию последнего в контексте способа детекции, как описано выше. Предпочтительно олигонуклеотид последовательности SEQ ID N0: 41 соответствует нуклеотидной последовательности, найденной специфически в вирусе денге серотипа 4, и обеспечивает детекцию последнего в контексте способа детекции, как описано выше. Предпочтительно олигонуклеотид последовательности SEQ ID N0: 19 соответствует нуклеотидной последовательности, найденной специфически в вирусе Западного Нила, и обеспечивает детекцию последнего в
контексте способа детекции, как описано выше. Наборы для детекции
Другой предмет изобретения состоит из наборов для детекции и/или диагностирования, включающих по меньшей мере один носитель, включающий по меньшей мере одну зону приема, на которую по изобретению помещают по меньшей мере один модифицированный олигонуклеотид.
Таким образом, набор для детекции можно использовать для скрининга биологически активных молекул или для диагностических тестов или тестов для секвенирования. Можно рассмотреть набор для диагностирования, включающий несколько отдельных зон приема, на которые помещают твердый носитель с привитыми одинаковыми или разными олигонуклеотидами. Например, твердые носители с привитыми одинаковыми или разными модифицированными олигонуклеотидами можно поместить на отдельные зоны приема субстрата, покрытого тонким слоем золота, или субстрата с функциональными группами, включающими по меньшей мере одну двойную углерод-углеродную или тройную углерод-углеродную связь или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы, для того, чтобы сформировать тестовый и/или диагностический носитель.
В частности, носитель может являться золотым электродом.
Тестовый набор может предпочтительно содержать
электрохимическую ячейку, содержащую рабочий электрод, противоэлектрод и электрод сравнения. Рабочий электрод может быть из золота, противоэлектрод - из платины и электрод сравнения - из серебра. Исследование взаимодействия модифицированного олигонуклеотида с тестируемой молекулой может содержать стадию циклической вольтамперометрии.
Прививание поверхности, включающей по меньшей мере одну углерод-углеродную двойную связь (алкенильная функциональная группа) или углерод-углеродную тройную связь (алкинильная функциональная группа), или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы, можно, например, использовать для проведения тестов типа ELOSA (по-английски "Enzyme-linked OligoSorbent Assay"). В
ходе выполнения данного типа теста поверхности ячеек прививают
с алкенильными, алкинильными или галоацетамидными
функциональными группами, предпочтительно малеимидными или
акриламидными функциональными группами 1. Далее поверхность
приводят в соприкосновение с модифицированными
олигонуклеотидами по изобретению. Таким образом, по причине присутствия одной или более тиольной функциональной группы на олигонуклеотидах по изобретению формируется одна или более тиоэфирная связь. Далее тест состоит из вступления в контакт тестового образца, включающего нуклеотидную последовательность-мишень, с ячейками, модифицированными таким образом, чтобы, в частности, измерять гибридизацию олигонуклеотидов. Измерение может быть, например, основано на флуоресценции посредством введения метки в олигонуклеотидные цепи.
Изобретение также относится к использованию
модифицированного нуклеотида, как описано выше, и включающего по меньшей мере две тиольные функциональные группы для прививки поверхности, включающей по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы. В одном из вариантов осуществления изобретения соединение может содержать три или четыре тиольных функциональных группы. Модифицированный олигонуклеотид, фиксированный на поверхность, включающую по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно малеимидные или акриламидные функциональные группы, через по меньшей мере две тиольные функциональные группы демонстрирует очень хорошую устойчивость для использования в диагностическом тесте, таком как тест типа ELOSA, также как и лучшую пригодность применительно мишеней. Когда возрастает число тиольных функциональных групп в соединении, возрастает число гибридизаций на всем привитом носителе во время детектирующего теста. Таким образом, модифицированный олигонуклеотид, содержащий 4 тиольных функциональных группы, обеспечивает более эффективную
гибридизацию мишени. ПРИМЕРЫ
В примерах под "зондом" подразумевают олигонуклеотидную цепь, включающую по меньшей мере одно тиольное соединение по изобретению, предназначенное для фиксирования на поверхности.
Под "мишенью" подразумевают олигонуклеотидную цепь, предназначенную для гибридизации с зондом, например, во время диагностического теста.
Пример 1. Синтез олигомера
Синтез соединения 1-0- (4, 4 ' - диметокситритил) -2- ( 6-S-
ацетилтиогексилоксиметил)-2-метилпропан-1,3-диола 4
Вг-
DMTr - CI
(сн2)6
ОН Вг-(СН2)6-Вг
ОН DMTrO'^y^OH
AcSK+
AcS-
DMTrtV^r^OH
Соединение 3 получают из соединения 1, следуя протоколу, описанному в Pourceau, G., Meyer, A., Vasseur, J. J., and Morvan, F., Journal of Organic Chemistry 74, 2009, 1218-1222.
Краун-эфир 18-6 (70 мг, 0,26 ммоль) добавляют к раствору 1-0-(4,4'-диметокситритил)-2-(б-бромгексилоксиметил)-2-метил-1,3-пропадиола 3 (556 мг, 0,95 ммоль) и тиоацетата калия (162 мг, 1,42 ммоль) в безводном толуоле (10 мл) . Смесь подвергают перемешиванию с магнитной мешалкой в течение 2 часов при 50°С. После разбавления дихлорметаном (150 мл) смесь отфильтровывают и органический слой промывают водой (2x50 мл, и затем сушат над Na2S04. После упаривания необработанный продукт реакции очищают хроматографией на силикагеле (от 0 до 30% этилацетата в циклогексане), что приводит к желаемому продукту в виде бесцветного масла (413 мг, 75%).
Синтез
1-0-(4,4'-диметокситритил)-2-(6-S-
ацетилтиогексилоксиметил)-2-метил-З-О-(2-цианоэтил-Ы,N'-
диизопропилфосфорамидит)-пропан-1,3-диола 5
AcS-
- <рн2)6
DMTrO
AcS-
-iPr
cAo
2-Цианоэтил-Ы,N'-диизопропилхлорфосфорамидит (190 мкл, 0,85 ммоль) добавляют в раствор 1-0-(4,4'-диметокситритил)-2-(б-Б-ацетилтиогексилоксиметил)-2-метилпропан-1, 3-диола 4 (413 мг, 0,71 ммоль) и диизопропилэтиламина (18 6 мкл, 1,0 6 ммоль) в безводном дихлорметане (10 мл) . Смесь подвергают перемешиванию с магнитной мешалкой в течение 1 часа при комнатной температуре. Избыток реагента нейтрализуют добавлением 500 мкл
воды,
затем смесь разбавляют дихлорметаном (150
Органический слой промывают насыщенным водным раствором ЫаНСОз (100 мл) и затем сушат над Na2S04. После упаривания необработанный продукт реакции очищают хроматографией на силикагеле (от 0 до 30% этилацетата в циклогексане, содержащем 4% триэтиламина), что приводит к желаемому продукту 5 в виде бесцветного масла (400 мг, 72%).
Синтез тиольного твердого носителя 6
AcS-
¦р2), О
DMTrO
~ОН
AcS-
"(сн2)6
DMTrO
/ NH
В колбе из матового стекла 1-0-(4,4'-диметокситритил)-2-(б-Б-ацетилтиогексилоксиметил)-2-метил-1,3-пропандиол 4 (178 мг, 0,3 ммоль) и диметиламинопиридин (ДМАП 36 мг, 0,3 ммоль) упаривают вместе с 3 мл безводного пиридина. Далее добавляют сукцинил-длинноцепочечный алкиламин -CPG (Controlled Роге
Glass) (1 г), безводный пиридин (5 мл), безводный триэтиламин (160 мл, 1,2 ммоль) и этилдиметиламинопропилкарбодиимид (EDC, 280 мг, 2,0 ммоль). Далее смесь промывают 1 мл безводного пиридина. Смесь перемешивают в течение ночи.
Смесь отфильтровывают и промывают CH2CI2 (10 мл) и затем сушат в эксикаторе. Тиольное соединение на твердом носителе обрабатывают раствором уксусного ангидрида, N-метилимидазола, 2,6-лютидина в ТГФ в течение 3 часов при перемешивании. Смесь отфильтровывают и промывают CH2CI2 (10 мл) и затем сушат в эксикаторе, что приводит к тиольному твердому носителю б (94 0 мг) с функционализацией 2 9 мкмоль/г.
Пример 2. Получение модифицированных олигонуклеотидов Три олигонуклеотида, включающие ферроценовую группу в положении 5' и возрастающее количество тиольных соединений типа (1а) по изобретению (1, 2 и 4 тиольных соединения), синтезировали в ДНК-синтезаторе. Ферроценовую группу использовали для того, чтобы представить в видимой форме фиксирование олигонуклеотида на золотой поверхности посредством циклической вольтамперометрии. Одну, две или четыре тиольных группы вводили на твердый носитель типа пропандиол и прививали ДНК-последовательность SEQ ID NO: 7. В заключение, альфа-тимидин фосфорамидит, содержащий ферроценовую группу, вводили в положение 5' модифицированного олигонуклеотида. Следующее за этим снятие защиты проводят в две стадии. Сначала среду обрабатывают 10% раствором пиперидина в ацетонитриле в течение 10 минут для того, чтобы удалить цианоэтильную группу бета-удалением, и полученный акрилонитрил удаляют из среды промыванием с ацетонитрилом. Затем обработка концентрированным гидроксидом аммония обеспечивает удаление ацильных защитных групп на нуклеиновых основаниях и на тиольных функциональных группах и обеспечивает гидролиз сукцинильного звена (твердый носитель). Данный протокол дает возможность избежать присоединения по Михаэлю между незащищенными тиольными функциональными группами и акрилонитрилом. После упаривания неподдержанный модифицированный олигонуклеотид очищают ВЭЖХ хроматографией с обратной фазой на колонке С18.
Тетратиол (олигонуклеотид, модифицированный 4 тиольными соединениями)
аТ о о
НО ко P-O-CCAAGC ACG ATG Т-О-Р-О. О П
о но Y " р " \^ ир° / ь х
HS HS
Дитиол (олигонуклеотид, модифицированный 2 тиольными соединениями)
О О О-р-О- CCA AGC ACG ATG Т О р О
О но
°,.0° о °"
Монотиол (олигонуклеотид, модифицированный 1 тиольным соединением)
-О-Р-О. HOQ
Прививка и исследование устойчивости модифицированных олигонуклеотидов (тетратиола, дитиола и монотиола)
Для этого исследования использовали биологический многоканальный потенциостат VMP3 (Biologic Science Instruments, Pont de Claix). Результаты записывали, используя программное обеспечение EC-Lab из Biologic Science Instruments.
Электрохимическая ячейка состоит из золотого электрода с областью поверхности 0,28 см2, платинового противоэлектрода и Ag/AgCl электрода сравнения.
Стадия 1: Восстановление тиольных групп
4 нмоль ODN-тиола (олигонуклеотиды, модифицированные одним или более тиольным соединением) восстанавливают в растворе
Трис(2-карбоксиэтил)фосфина гидрохлорида (ТКЭФ гидрохлорид, TCEP,HCL, Sigma-Aldrich) (160 мМ) , т.е. при концентрации ТСЕР,НС1 в растворе 20 мМ, при 20°С, в течение 2 ч под аргоном.
ODN очищают двумя успешными
разбавлениями/центрифугированиями с раствором ТСЕР, НС1 2 0 мМ, дегазированном на фильтрах amicon YM3000 (Millipore) в течение 15 мин при 14000 оцс (оцс = Относительная Центробежная Сила). После разбавления в 450 мкл дегазированного 100 мМ фосфатного буфера среду опять центрифугируют на фильтрах amicon YM3000 в течение 3 0 мин при 14 000 оцс.
Получают раствор для прививки, содержащий 4 нмоль ODN, 90 мМ фосфата натрия, 2 мМ ТСЕР,НС1.
Стадия 2: Активация золотого электрода
Рабочий золотой электрод очищают сначала промыванием в ацетоне в течение 10 минут с ультразвуком. После высушивания поверхность погружают в раствор "пиранья" (0,7 мл H2SO4, 0,3 мл Н2Ог) в течение 1 минуты для того, чтобы удалить с поверхности любые органические остатки.
В заключение, основная активация электрода состоит из очистки золота на поверхности посредством выделения водорода на электроде при гидролизе воды в 0,5 М соды при отрицательных потенциалах (-1,4 В vs Ag/AgCl) для нескольких циклов.
Стадия 3: Прививка зонда
После промывания раствор для прививки, содержащий тиольные олигонуклеотиды, приводят в соприкосновение с активированным золотым электродом в течение трех дней в инертной атмосфере.
После промывания электрохимическую ячейку заполняют электролитом для анализа (10 мМ двухосновный фосфат натрия, 10 мМ моноосновный фосфат калия, 250 мМ перхлорат натрия, рН 6,5).
Поверхность пассивируют 1 мМ раствором меркаптопропанола в течение 3 0 минут и после промывания в ячейку на 2 ч помещают электролит для анализа для того, чтобы стабилизировать привитый слой.
Стадия 4: Анализ устойчивости соединений, привитых к поверхности
Анализы проводят посредством циклической вольтамперометрии (CV) при 50 мВ/с, между -0,1 В и 0,45 В. Исследования устойчивости привитого слоя проводят после стабилизации электрохимического сигнала в течение 2 ч при повторении циклов каждые 3 0 минут.
Ячейку заполняют дистиллированной водой, дегазированной при 60°С или 8 0°С в течение 1 или 5 минут и после промывания ячейку заполняют 1,5 мл электролита для анализа фосфатом (20 мМ) перхлоратом (250 мМ). После стабилизации в течение 30 минут проводят CV.
Процесс повторяют так часто, как требуется.
Результаты
Проводили сравнение степени прививки 3 олигонуклеотидов, модифицированных тиольными соединениями (тетратиол, дитиол и монотиол). Степень прививки определяли интегрированием пика окисления ферроцена. Фактически, перенесенный электронный заряд напрямую относится к количеству ферроценов, находящихся на поверхности электрода, и, следовательно, к числу зондов, привитых на золото.
Результаты, данные ниже, соответствуют среднему значению степеней прививки 3 различных прививок для каждого зонда.
молекулы/см2
монотиол
5,21Е+12
дитиол
5,81Е+12
тетратиол
1,40Е+12
Гистограмма результатов показана на фигуре 5.
Степени прививки для монотиола и дитиола довольно похожи. Наблюдают более низкую степень прививки тетратиола, возможно, обусловленную более существенными стерическими затруднениями в соответствии с количеством тиольных звеньев. Тем не менее, несмотря на данные различия, степень прививки тетратиола является значительной и хорошо воспроизводимой.
Тест на устойчивость 3 олигонуклеотидов, модифицированных тиольными соединениями, относительно температуры проводили в дегазированной дистиллированной воде. Процесс изменения
электрохимического отклика контролируют циклической
вольтамперометрией. Уменьшение интенсивности окисления ферроцена, выраженное в процентах, рассчитывают относительно сигнала, полученного после стабилизации.
Эти уменьшения в качестве функции времени представлены на фигурах б и 7.
Тетратиольная молекула очень устойчива применительно к успешным процедурам обработки в воде при 60°С (фигура б) . Фактически, после 5 раз данной обработки по одной минуте остается 97% от стартового сигнала в отличие от монотиола (70% от стартового сигнала) и дитиола (62% от стартового сигнала).
При 8 0°С потеря сигнала является более существенной (фигура 7) . После 5 успешных обработок по одной минуте 83% от стартового сигнала снова поддаются количественному определению для тетратиола. Таким образом, устойчивость тетратиола является значительно более высокой, чем монотиола (45% остаточного сигнала) или дитиола (18% остаточного сигнала).
Это исследование демонстрирует значительное возрастание устойчивости тиольной прививки на золото при использовании олигонуклеотида, модифицированного 4 тиольными соединениями (тетратиол) по сравнению с прививкой монотиола или дитиола. Недостаток устойчивости последнего из упомянутых, дитиола, может быть связан с возможной конкуренцией между прививкой на золото и закрытием цикла для повторного формирования внутримолекулярного дисульфидного мостика. Из этого следует, что содержание 4 тиолов на привитом звене является предпочтительным для того, чтобы обеспечить хорошую устойчивость относительно температуры.
Пример 3. Применение к детекции вируса гепатита С
Образцы мишеней для исследования
1) Природные мишени: "ВГС (+)" ампликоны
Образцы плазмы от доноров крови, давших положительный тест на наличие ВГС, в общенациональных масштабах анализируют посредством секвенирования. Определяют вирусный генотип или подтип ВГС, инфицирующий каждого донора.
"ВГС ( + )" ампликоны из 401 п.о. получают из NS5b участка вируса ВГС посредством ОТ-ПЦР (ПЦР с обратной транскриптазой) из каждого образца плазмы, описанного выше. РНК экстрагируют из 200 мкл человеческой плазмы при использовании набора High Pure Viral Nucleic Acid (Roche) по рекомендациям производителя. РНК элюируют 50 мкл стерильной воды (DNase/RNase free) . Для стадии обратной транскрипции (АТ), 11 мкл РНК денатурируют при 72°С в течение 10 минут и обратно транскрибируют в присутствии 4 мкл 5Х First Strand Buffer (Invitrogen), 2 мкл 10X Hexanucleotide Mix (Roche), 2 мкл 10 мМ dNTP mix (Invitrogen) и 200U Superscript(r) II Reverse Transcriptase (Invitrogen). Условия обратной транскрипции следующие: 10 мин при 2 3°С, 4 5 мин при 37°С и 10 мин при 95°С.
Пять микролитров кДНК затем амплифицируют посредством ПЦР
(полимеразно-цепной реакции), используя праймеры:
"биотинилированный ВГС-смысловой (HCVsense)"
(последовательности [Btn] - TGG GGA ТСС CGT ATG ATA ССС GCT GCT TTG А (или [Btn]-SEQ ID NO: 8)) и
"ВГС-антисмысловой (HCVantisense)" (последовательности GGC GGA ATT CCT GGT CAT AGC CTC CGT GAA (SEQ ID NO: 9)) (см. Tamalet C. et al. 2003, Journal of Medical Virology 71: 391398) .
Реакцию амплификации проводят в 50 мкл реакционной смеси, включающей: IX PCR Buffer без MgCl2 (Invitrogen), 0,2 мкМ каждого праймера, 1,5 мМ MgCl2 (Invitrogen), 0,2 мМ dNTP mix (Invitrogen) и 1,3U Taq Polymerase (Invitrogen). Условия ПЦР следующие: 5 мин при 95°С, 40 циклов (денатурация: 40 с, 95°С; гибридизация: 40 с, 5б°С; элонгация: 50 с, 72°С) , и конечная элонгация 10 мин при 72°С.
Полученные ВГС ампликоны анализируют электрофорезом в агарозном геле, аликвоты отбирают и хранят при -20°С перед использованием.
Данные ампликоны, исходные вирусные генотипы которых известны, хранят в виде библиотеки.
Пример ампликона длиной 4 01 п.о., полученного из вирусного
штамма la/lb со ссылкой # PTR6719, имеет последовательность: 5'-
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCAACGGTCACTGAGAATGACAT
CCGTGTTGAGGAGTCAATTTACCAATGTTGTGACCTAGCCCCCGAAGCCAGACAG
GCCATAAGGTCGCTCACAGAGCGGCTTTACATCGGGGGTCCCCTGACTAATTCAA
AAGGGCAGAACTGCGGCTATCGCCGGTGCCGCGCGAGCGGTGTGCTGACGACCA
GCTGCGGTAATACCCTCACATGTTACTTGAAGGCCTCTGCGGCCTGTCGAGCTGC
AAAGCTCCAGGACTGCACAATGCTCGTGTGCGGAGACGACCTTGTCGTTATCTGT
GAAAGCGCGGGAACCCARGAGGATGCGGCGAGCCTACGAGTCTTCACGGAGGCT
ATGACCAGGAATTCCGCC - 3' (SEQ ID N0 : 12).
Пример ампликона длиной 4 01 п.о., полученного из вирусного штамма 2 со ссылкой # PTR7761, имеет последовательность:
5'-
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCAACTGTCACTGAGAGAGACAT
CAGAACCGAGGAGTCCATATACCAGGCCTGCTCCCTAACCGAGGAGGCTCGCACC
GCCATACACTCGCTGACTGAGAGGCTATACGTGGGAGGGCCCATGCTCAATAGCA
AAGGCCAGACCTGCGGGTACAGGCGTTGCCGCGCCAGCGGGGTGCTCACCACTA
GCATGGGAAACACCATTACGTGCTATGTGAAAGCTCTAGCGGCATGCAAGGCCGC
AGGGATAGTAGCGCCCACGATGCTGGTATGCGGCGACGACCTGGTCGTCATCTCA
GAAAGCCAGGGGACTGAGGAGGACGAGCGGAACCTGAGAGTCTTCACGGAGGCT
ATGACCAGGAATTCCGCC-3' (SEQ Ш N0 : 31).
Пример ампликона длиной 4 01 п.о., полученного из вирусного штамма За со ссылкой # PTR9058, имеет последовательность:
5'-
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCGACTGTCACTGAACAGGATAT
CAGGGTGGAAGAGGAGATATACCAATGCTGTAATCTTGAACCGGAGGCCAGGAA
GGTGATCTCCTCCCTCACGGAGCGGCTTTACTGCGGGGGTCCTATGTTCAACAGC
AAAGGGGCCCAGTGTGGTTATCGCCGTTGCCGTGCTAGTGGAGTTCTACCTACCA
GCTTCGGCAATACAATCACTTGCTACATCAAGGCCACAGCGGCTGCAAGGGCCGC
AGGCCTCCGGAACCCGGACTTTCTTGTCTGCGGAGACGATCTAGTCGTGGTGGCT
GAGAGTGACGGCGTCGACGAGGATGGGGCGGCCCTGAGAGCCTTCACGGAGGCT
ATGACCAGGAATTCCGCC-3' (SEQ ID NO : 14).
Пример ампликона длиной 4 01 п.о., полученного из вирусного штамма 4a/4d со ссылкой # PTR4162, имеет последовательность:
5'-
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCCACTGTAACCGAAAGAGACAT
CAGGGTCGAGGAGGAGGTCTATCAGTGTTGTGACCTAGAGCCCGAAGCCCGCAA
GGTAATATCCGCCCTCACAGAGAGACTCTACGTGGGCGGTCCCATGTACAACAGC
AGGGGAGACCTTTGCGGAACTCGACGGTGCCGTGCAAGCGGCGTATTCACCACCA
GCTTTGGGAACACACTGACGTGCTATCTTAAGGCCAGCGCGGCCATCAGGGCTGC
AGGCCTAAAGGACTGCACCATGCTGGTCTGTGGCGACGACTTAGTCGTTATCGCT
GAAAGCGATGGCGTGGAGGAGGACAACCGTGCGCTCAGAGCCTTCACGGAGGCT
ATGACCAGGAATTCCGCC-3' (SEQ ID NO : 32).
Чтобы дополнить данные длинные ампликоны, были разработаны другие праймеры для того, чтобы произвести более короткие ампликоны, исходя из каждого из образцов плазмы, описанных выше. Чтобы произвести "короткие" ампликоны, следуют аналогичному общему протоколу и изменяют только используемые праймеры. Используемые праймеры выбирают в соответствии с генотипом и/или подтипом ВГС, инфицировавшим пациентов.
Специфические ампликоны вирусов ВГС подтипа 1а/lb размером 191 нуклеотид амплифицируют со следующими праймерами:
- биотинилированный смысловой праймер "1а/1Ь смысловой", последовательности 5'-[Btn]-TGA-CRA-CYA-GCT-GYG-GTA-AYA-CCC-T-3' (или [Btn]-SEQ ID NO: 10) и
- антисмысловой праймер "HCVantisense" SEQ ID NO: 9 (см. выше).
Пример короткого ампликона длиной 191 нуклеотид, полученного из вирусного штамма la/lb со ссылкой # PTR6719, имеет последовательность:
5'-
TGACGACCAGCTGCGGTAATACCCTCACATGTTACTTGAAGGCCTCTGCGGCCTG TCGAGCTGCAAAGCTCCAGGACTGCACAATGCTCGTGTGCGGAGACGACCTTGTC GTTATCTGTGAAAGCGCGGGAACCCARGAGGATGCGGCGAGCCTACGAGTCTTCA CGGAGGCTATGACCAGGAATTCCGCC -3' (SEQ IDNO : 13).
Специфические ампликоны вирусов ВГС подтипа 2 размером 108 нуклеотидов амплифицируют со следующими праймерами:
биотинилированный смысловой праймер "биотинилированный ВГС 2 смысловой" последовательности 5'-[Btn]-ATG-YTG-GTR-TGC-
GGC-GAC-GAC-3' (или [Btn]-SEQ ID NO: 29) и
- антисмысловой праймер "HCVantisense" SEQ ID NO: 9 (см. выше).
Пример короткого ампликона длиной 108 нуклеотидов, полученного из вирусного штамма 2 со ссылкой # PTR77 61, имеет последовательность:
5'-
ATGCTGGTATGCGGCGACGACCTGGTCGTCATCTCAGAAAGCCAGGGGACTGAG GAGGACGAGCGGAACCTGAGAGTCTTCACGGAGGCTATGACCAGGAATTCCGCC -3' (SEQ ID NO : 33).
Специфические ампликоны вирусов ВГС подтипа За размером 143 нуклеотида амплифицируют со следующими праймерами:
- биотинилированный смысловой праймер "ВГС смысловой" SEQ ID NO: 8 (см. выше) и
- антисмысловой праймер "За rev" последовательности: 5'-GCA-GTA-AAG-CCG-YTC-CGT-GAG-3' (SEQ ID N0: 11).
Пример короткого ампликона длиной 143 нуклеотида, полученного из вирусного штамма 2 со ссылкой # PTR9058, имеет последовательность:
5'-
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCGACTGTCACTGAACAGGATAT CAGGGTGGAAGAGGAGATATACCAATGCTGTAATCTTGAACCGGAGGCCAGGAA GGTGATCTCCTCCCTCACGGAGCGGCTTTACTGC-3' (SEQ ID NO :15).
Специфические ампликоны вирусов ВГС подтипа 4a/4d размером 175 нуклеотидов амплифицируют со следующими праймерами:
- биотинилированный смысловой праймер "ВГС смысловой" SEQ ID NO: 8 (см. выше) и
антисмысловой праймер "ВГС антисмысловой 4 rev" последовательности: 5'-AGG-TCT-CCC-YTG-CTG-TTG-TRC-AT-3' (SEQ ID NO: 30).
Пример короткого ампликона длиной 175 нуклеотидов, полученного из вирусного штамма 4a/4d со ссылкой # PTR4162, имеет последовательность:
TGGGGATCCCGTATGATACCCGCTGCTTTGACTCCACTGTAACCGAAAGAGACAT CAGGGTCGAGGAGGAGGTCTATCAGTGTTGTGACCTAGAGCCCGAAGCCCGCAA GGTAATATCCGCCCTCACAGAGAGACTCTACGTGGGCGGTCCCATGTACAACAGC AGGGGAGACCT -3' (SEQ ID NO : 34).
Как и ранее, полученные "короткие" ВГС ампликоны со 191, 108, 175 и 143 нуклеотидами анализируют электрофорезом в агарозном геле, аликвоты отбирают и хранят при -20°С перед использованием.
Данные ампликоны, исходные вирусные генотипы которых известны, хранят в виде библиотеки.
2) Синтетические мишени: 15-мерные или 105-мерные олигонуклеотиды
Синтезировали 15-мерные или 105-мерные синтетические олигонуклеотиды, биотинилированные по концу 5'.
15-мерные синтетические олигонуклеотиды строго
комплементарны выбранным ВГС зондам (см. ниже) и имеют следующие последовательности:
- 15-мерные синтетические олигонуклеотиды, специфические к подтипу la/lb, имеют последовательность: 5' [Btn]- GCT CCR GGA ACT GCA С -3' (или [Btn]-SEQ ID NO: 2);
- 15-мерные синтетические олигонуклеотиды, специфические к подтипу За, имеют последовательность: [Btn]-СТТ GAA CCG GAG GCC -3' (или [Btn]-SEQ ID NO: 5) и
- 15-мерные синтетические олигонуклеотиды, специфические к подтипу 4a/4d, имеют последовательность: 5' [Btn]-СТА YGT GGG CGG YCC -3' (или [Btn]-SEQ ID NO: 39).
Более длинные олигонуклеотиды, включающие комплементарные последовательности ВГС зондов, представленных ниже, заключенные по каждому концу последовательностями из 45 нуклеотидов или 105 нуклеотидов в целом, и биотинилированные по концу 5', были также синтезированы для разработки тестов по гибридизации зонд/мишень.
Использованные 105-мерные синтетические олигонуклеотиды имеют следующие последовательности:
- 105-мерные синтетические олигонуклеотиды специфические к подтипу la/lb имеют последовательность: 5' [Btn]- ССТ САС TTG СТА CAT САА GGC CCA GGC AG С CTG TCG AG С CGC AGG - GCT CCR GGA ACT GCA С - CAT GCT CGT GTG TGG CGA CGA CTT AGT CGT TAT CTG TGA AAG TGC-3' (или [Btn]-SEQ ID NO: 3); и
- 105-мерные синтетические олигонуклеотиды специфические к подтипу За имеют последовательность:
5' [Btn]- GAA CAG GAC АТС AGG GTG GAA GAG GAG ATA ТАС САА TGC TGT ААС - CTT GAA CCG GAG GCC - AGG AAA GTG АТС ТСС ТСС СТС ACG GAG CGG CTT ТАС TGC GGG GGC -3' (или [Btn]-SEQ ID NO: 6).
Дизайн олигонуклеотидных зондов для распознавания ВГС последователвностей
Участок NS5b, кодирующий РНК-полимеразу ВГС, был сделан мишенью для разработки олигонуклеотидных зондов изобретения.
Геномные последовательности ВГС, амплифицированные на участке NS5b (типичный банк из 800 образцов), определяли и анализировали при использовании программы по выравниванию последовательностей clustalW2 и программы по филогенезу Меда5 для того, чтобы определить наиболее консервированные зоны для каждого генотипа и/или подтипа ВГС. Были выбраны отдельные участки, обеспечивающие общее распознавание вирусных последовательностей генотипа и, если требуется, отдельно взятого подтипа. Как следствие, определили и выбрали высоко консервированный участок, обеспечивающий специфическую детекцию всех ВГС вирусов вирусного генотипа 1а/lb. Аналогичным образом определили и выбрали участок, обеспечивающий специфическую детекцию ВГС вирусов вирусных генотипов 2, 2а/2с, 2Ь, За и 4a/4d. Далее разработали комплементарные каждому выбранному участку 15-мерные олигонуклеотиды и синтезировали мульти-тиольные олигонуклеотиды, основанные на последовательностях, выбранных для специфического распознавания подтипов la/lb, 2, 2а/2с, 2Ь, За и 4a/4d.
Олигонуклеотидная последовательность, сохраненная для создания зонда la/lb: 5'-GTG-CAG-TCC-YGG-AGC (SEQ ID NO: 1) . Данный зонд является специфическим к штаммам подтипов 1а или lb.
Олигонуклеотидная последовательность, сохраненная для создания зонда 2: 5'-TGG-CTY-TCT-GAG-ATG (SEQ ID N0: 27). Данный зонд является специфическим к штаммам подтипа 2.
Олигонуклеотидная последовательность, сохраненная для создания зонда 2а/2с: 5'-GGA-CTC-CTC-RGT-TCT (SEQ ID N0: 35) . Данный зонд является специфическим к штаммам подтипов 2а или 2с.
Олигонуклеотидная последовательность, сохраненная для создания зонда 2Ь: 5'-TAT-GGA-TTC-TTC-TGT (SEQ ID N0: 36) . Данный зонд является специфическим к штаммам подтипа 2Ь.
Олигонуклеотидная последовательность, сохраненная для создания зонда За: 5'-GGC-CTC-CGG-TTC-AAG (SEQ ID N0: 4). Данный зонд является специфическим к штаммам подтипа За.
Олигонуклеотидная последовательность, сохраненная для создания зонда 4a/4d: 5'-GGR-CCG-CCC-ACR-TAG (SEQ ID NO: 28) . Данный зонд является специфическим к штаммам подтипов 4а или 4d.
Анализ гибридизаций зонд/мишень посредством ELOSA (enzyme-linked oligosorbent assay)
Прививку любого типа тиольного зонда (альфа-аномерные или бета-аномерные олигонуклеотиды, линейные или типа стебель-петля ("улитки") и т.п.) можно проводить по следующему оптимизированному протоколу. Малеимид-активированные ячейки микропланшета (Pierce) промывают буфером WB1 (0,1М Na2HP04, 0,15М NaCl, 0,05% Tween 20 (масс./об.), рН 7,2). Функционализацию ячеек проводят со 100 нМ мульти-тиольных зондов (как описано выше) в ВВ буфере (0,1М Na2HP04, 0,15М NaCl, 10 мМ ЭДТА, рН 7,2) в течение 2 часов при комнатной температуре (КТ). Затем ячейки промывают три раза WB1, насыщенным 10 мкг-мл-1 раствором цистеина-HCl в ВВ (Pierce) в течение 1 часа при КТ и затем снова промывают три раза WB1.
Тесты по гибридизации проводят с короткими 15-мерными или 105-мерными синтетическими мишенями или с настоящими ВГС ампликонами: длинными (4 01 н.п.) или более короткими (191 н.п. или 143 н.п.). Синтетические мишени и ампликоны разбавляют в 150 мкл гибридизационного буфера (ГБ: 0,9М NaCl, 60 мМ NaH2P04,
б мМ ЭДТА, рН 7,4, Denhardt 5Х) до перенесения в ячейки. Дополнительную стадию денатурации в течение 10 мин при 95°С проводят на ампликонах до перемещения в микроячейки. Гибридизацию проводят в течение ночи при 37°С. Ячейки промывают буфером WB2 (0,75М NaCl, 50 мМ NaH2P04, 5 мМ ЭДТА, рН 7,4, додецилсульфат натрия 0,1%) три раза в течение 2 мин при КТ и
один раз в течение 30 мин при 50°С.
Стадию детекции проводят после выдерживания ячеек в течение 3 0 мин при КТ в присутствии 100 мкл/ячейку Стрептавидина-Европия (Perkin Elmer), разбавленного в 100 мкл буфера для анализа ("Assay Buffer", Perkin Elmer). В заключение, ячейки промывают шесть раз буфером WB3 (WB1X, Perkin Elmer) , и 2 00 мкл буфера для усиления сигнала ("Enhancement Buffer", Perkin Elmer) добавляют в каждую ячейку на 5 мин при КТ. Измеряют флуоресценцию с разрешением во времени на множественно меченом счетчике Victor3(tm) 1420 ("multilabel counter", Perkin Elmer) по протоколу производителя (возбуждение при 34 0 нм и эмиссия при 615 нм).
Результаты 1: Тесты по гибридизации на бета-аномерных линейных зондах, содержащих 4 тиольных функциональных группы
Бета-аномерные линейные зонды За, содержащие 4 тиольных функциональных группы, прививают при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше. Результаты, полученные с зондами За, представлены на фигурах 8 и 9.
ELOSA тесты проводят, изменяя природу и концентрацию используемой мишени (короткие 15-мерные и 105-мерные синтетические мишени, короткие ампликоны из 143 н.п. или 191 н.п., длинные ампликоны из 4 01 н.п.) для того, чтобы подтвердить специфичность удерживаемых зондов.
Результаты, представленные на фигуре 8, соответствуют ELOSA тесту, который проводят с длинными ампликонами, специфичными к ВГС генотипу За, при разбавлениях 1/10, 1/100 и 1/1000, и неспецифичными длинными ампликонами (соответствующие ВГС la/lb генотипу) при разбавлениях 1/10, 1/100 и 1/1000.
Положительный контроль гибридизации проводят с синтетической мишенью (15-мерной), специфической к генотипу За при концентрациях 1000 пМ или 5 пМ. Отрицательные контроли гибридизации проводят с синтетической мишенью (15-мерной), которая является неспецифической (по отношению к последовательности-мишени la/lb), при концентрации 1000 пМ или только с ГБ (гибридизационным буфером), не включающим мишень.
Для того чтобы рассматривать зонд За в качестве "специфического" к подтипу За, требуется, чтобы результаты, полученные для мишеней "За", превышали фоновый шум, полученный с отрицательными контролями, так, чтобы гибридизацию зонд/мишень можно было определить количественно.
Результаты, представленные на фигуре 9, соответствуют ELOSA тесту, который проводят со следующими мишенями:
- 15-мерная или 105-мерная специфическая За синтетическая мишень при концентрации 10 пМ, 100 пМ или 1000 пМ,
15-мерная или 105-мерная неспецифическая la/lb синтетическая мишень (отрицательный контроль) при концентрации 10 пМ, 100 пМ или 1000 пМ,
- За специфический длинный ампликон при разбавлении 1/100,
- 1а/lb неспецифический длинный ампликон при разбавлении 1/100,
За специфический короткий ампликон (143 н.п.) при разбавлении 1/100 и 1/1000,
- только ГБ, не включающий мишень.
Результаты, представленные на фигурах 8 и 9, демонстрируют, что зонд "За" по настоящему изобретению в состоянии гибридизироваться не только с За-специфическими синтетическими мишенями, 15-мерными (мишень, имеющая концентрацию 5 пМ) или 105-мерными (мишень, имеющая концентрацию 10 пМ) , но и длинными ампликонами из 401 н.п. или короткими ампликонами из 143 н.п., полученными из плазм с генотипом За и, следовательно, специфическими к генотипу За (при разбавлении 1/1000) . Данные результаты также демонстрируют, что мишени la/lb, неспецифические к зонду За, не гибридизируются на детектируемом уровне с последним, независимо
от их формы (15-мерная или 105-мерная синтетическая мишень, короткий ампликон из 191 н.п. или длинный ампликон из 401 н.п.) или их концентрации (1000 пМ для синтетических мишеней при разбавлении 1/10 для ампликонов).
Результаты, представленные на фигуре 10, соответствуют ELOSA тесту, который проводят с 1а/lb линейными зондами (см. выше), бета-аномерными, включающими 4 тиольных функциональных группы, которые прививают при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше.
Результаты на фигуре 10 получают из следующих мишеней:
15-мерная или 105-мерная специфическая la/lb синтетическая мишень при концентрации 10 пМ, 100 пМ или 1000 пМ,
15-мерная или 105-мерная неспецифическая За синтетическая мишень (отрицательный контроль) при концентрации 10 пМ, 100 пМ или 1000 пМ,
- длинный ампликон, специфический к 1а/lb генотипу ВГС, при разбавлении 1/100,
За неспецифический длинный ампликон при разбавлении
1/100,
la/lb специфический короткий ампликон (191 н.п.) при разбавлении 1/100 и 1/1000,
За неспецифический короткий ампликон (143 н.п.) при разбавлении 1/100 и 1/1000,
- только ГБ, не включающий мишень.
Результаты, представленные на фигуре 10, демонстрируют, что зонд 1а/lb по настоящему изобретению в состоянии гибридизироваться не только с 15-мерными или 105-мерными синтетическими мишенями, специфическими к 1а/lb (мишень, имеющая концентрацию 10 пМ) , но и короткими ампликонами из 191 н.п., полученными из плазм с генотипом la/lb (при 1/1000ном разбавлении), и длинными ампликонами из 401 н.п., специфическими к генотипу la/lb (при 1/100ом разбавлении) .
Данные результаты также демонстрируют, что мишени За, неспецифические к зонду 1а/lb, не гибридизируются на детектируемом уровне с последним, независимо от их формы (15
мерная или 105-мерная синтетическая мишень, короткий ампликон из 143 н.п. или длинный ампликон из 4 01 н.п.) или их концентрации (1000 пМ для синтетических мишеней при 1/10ОМ разбавлении для ампликонов).
Результаты, представленные на фигуре 17, соответствуют ELOSA тесту, который проводят с бета-аномерным линейным 1а/lb зондом, включающим 4 тиольных функциональных группы, которые прививают при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше.
Результаты на фигуре 17 получают из следующих мишеней:
- 15-мерная la/lb специфическая синтетическая мишень при концентрации 10 пМ или 1000 пМ,
15-мерная 2а/2с, 2Ь, За или 4a/4d неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 10 пМ или 1000 пМ,
- длинный ампликон, специфический к 1а/lb ВГС генотипу, при разбавлении 1/100,
- 2а/2Ь/2с, За или 4a/4d неспецифический длинный ампликон при разбавлении 1/100,
- только ГБ, не включающий мишень.
Результаты, представленные на фигуре 18, соответствуют ELOSA тесту, который проводят со смесью двух бета-аномерных линейных зондов (2а/2с SEQ ID NO: 35 и 2b SEQ ID NO: 36), включающих 4 тиольных функциональных группы, каждый из которых прививают при плотности 50 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше.
Результаты на фигуре 18 получают из следующих мишеней:
- 15-мерные 2а/2с и 2Ь специфические синтетические мишени при концентрации 10 пМ или 1000 пМ,
15-мерная la/lb, За или 4a/4d неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 10 пМ или 1000 пМ,
- длинный ампликон, специфический к 2а/2Ь/2с ВГС генотипу, при разбавлении 1/100,
- la/lb, За или 4a/4d неспецифический длинный ампликон при разбавлении 1/100,
-
- только ГБ, не включающий мишень.
Результаты, представленные на фигуре 19, соответствуют ELOSA тесту, который проводят с бета-аномерным линейным За зондом, включающим 4 тиольных функциональных группы, которые прививают при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше.
Результаты на фигуре 19 получают из следующих мишеней:
15-мерная За специфическая синтетическая мишень при концентрации 10 пМ или 1000 пМ,
15-мерная la/lb, 2a/2b/2c или 4a/4d неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 10 пМ или 1000 пМ,
- длинный ампликон, специфический к За ВГС генотипу, при разбавлении 1/100,
la/lb, 2a/2b/2c или 4a/4d неспецифический длинный ампликон при разбавлении 1/100,
- только ГБ, не включающий мишень.
Результаты, представленные на фигуре 20, соответствуют ELOSA тесту, который проводят с бета-аномерным линейным 4a/4d зондом, включающим 4 тиольных функциональных группы, которые прививают при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше.
Результаты на фигуре 2 0 получают из следующих мишеней:
- 15-мерная 4a/4d специфическая синтетическая мишень при концентрации 10 пМ или 1000 пМ,
15-мерная la/lb, 2a/2b/2c или За неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 10 пМ или 1000 пМ,
- длинный ампликон, специфический к 4a/4d ВГС генотипу, при разбавлении 1/100,
- 1а/lb, 2a/2b/2c или За неспецифический длинный ампликон при разбавлении 1/100,
- только ГБ, не включающий мишень.
Для тестов, которые проводят с использованием ампликонов, результаты 3 проведенных независимых тестов, исходя из вирусных штаммов разного происхождения, но одинакового подтипа,
представлены на фигурах от 17 до 20.
Результаты, представленные на фигурах от 17 до 20, демонстрируют, что каждый из зондов la/lb, 2а/2с, 2Ь, За или 4a/4d по настоящему изобретению в состоянии гибридизироваться не только с 15-мерными синтетическими мишенями, специфическими к этому зонду (мишень, имеющая концентрацию 10 пМ) , но и специфическими ампликонами того же генотипа (при 1/100 разбавлении). Данные результаты также демонстрируют, что неспецифические мишени не гибридизируются на детектируемом уровне.
Результаты 2: Исследование эффекта количества тиольных функциональных групп
ELOSA тесты также проводят, изменяя количество тиольных функциональных групп и концентрации мишеней (15-мерная или 105-мерная короткая синтетическая мишень, короткие ампликоны из 143 н.п. или 191 н.п., длинные ампликоны из 4 01 н.п.).
Результаты, представленные на фигуре 11, соответствуют ELOSA тесту, который проводят с линейными 1а/lb зондами (см. выше), бета-аномерными, содержащими 1, 2, 4, б или 8 тиольных функциональных групп, которые привиты при плотности 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше. Результаты на фигуре 11 получают из следующих мишеней:
15-мерная или 105-мерная la/lb специфическая синтетическая мишень при концентрации 10 пМ, 100 пМ или 1000 пМ,
15-мерная или 105-мерная За неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 10 пМ, 100 пМ или 1000 пМ,
- только ГБ, не включающий мишень.
Каждое условие гибридизации зонд/мишень тестируют в трех экземплярах на микропланшете. Тесты воспроизводят 3 раза, полностью от стадии прививки зондов до детекции гибридизации (на 3 различных микропланшетах). Следовательно, результаты, представленные в патентной заявке, соответствуют среднему значению 9 измерений.
Результаты, полученные на фигуре 11, демонстрируют, что гибридизацию 15-мерной la/lb специфической синтетической мишени с 1а/lb зондом можно детектировать, исходя из 10 пМ мишени, если присутствует тиол. В свою очередь, для детекции 105-мерной 1а/lb специфической синтетической мишени требуется концентрация мишени 100 пМ, когда зонд содержит 2 тиольные функциональные группы, или 10 пМ, когда зонд содержит 4, б или 8 тиольных функциональных групп. Гибридизацию на детектируемом уровне не обнаруживают в присутствии мишеней За, неспецифических к зонду la/lb, независимо от их размера (15-мерная или 105-мерная) или их концентрации (максимальная тестированная концентрация: 1000 пМ) . Таким образом, результаты демонстрируют, что добавление тиольных функциональных групп к привитому олигонуклеотидному зонду улучшает параметры детекции исследуемых мишеней. Наличие 4 тиольных функциональных групп в используемом зонде обеспечивает детекцию всех синтетических мишеней (15-мерных или 105-мерных) при концентрации 10 пМ.
Результаты 3: Исследование эффекта плотности прививки
Результаты, представленные на фигурах 12, 13 и 14, соответствуют ELOSA тестам, которые проводят с бета-аномерными линейными la/lb зондами (см. выше), содержащими 1, 2 или 4 тиольных функциональных группы, которые привиты при плотностях 1, 10, 25, 50 или 100 нМ на носитель, покрытый малеимидными группами, по протоколу, описанному выше. Фигура 12 иллюстрирует результаты, полученные для монотиольного зонда, т.е. зонда, включающего одно тиольное соединение по изобретению. Фигура 13 иллюстрирует результаты, полученные для дитиольного зонда, т.е. зонда, включающего два тиольных соединения по изобретению, и фигура 14 иллюстрирует результаты, полученные для тетратиольного зонда, т.е. зонда, включающего четыре тиольных соединения по изобретению.
В каждом случае тесты по гибридизации проводили со следующими мишенями:
15-мерная или 105-мерная la/lb специфическая синтетическая мишень при концентрации 1000 пМ, 100 пМ или 10 пМ,
15-мерная или 105-мерная За неспецифическая синтетическая мишень (отрицательный контроль) при концентрации 1000 пМ, 100 пМ или 10 пМ,
- только ГБ, не включающий мишень.
Результаты, представленные на фигурах 12, 13 и 14, подтверждают специфичность гибридизации 1а/lb зондов с 1а/lb мишенями, в том смысле, что детекцию гибридизации не наблюдают в присутствии За мишеней, независимо от концентрации последних.
Данные результаты подтверждают, что (1) наличие одного тиола в используемом зонде не обеспечивает детекцию мишеней, имеющих размер 105 н.п., (2) исходя из двух тиольных функциональных групп, становится возможным детектировать гибридизацию между зондом и мишенью из 105 н.п. (в частности, исходя из 100 пМ мишени), (3) лучшие результаты получают с тетратиольным зондом.
С другой стороны, оказывается, что плотность прививки монотиольного зонда не имеет большого влияния на гибридизацию сигналов, какими бы ни были мишени (15-мерные или 105-мерные), тогда как гибридизация является дозозависимой от плотности прививки в случае дитиольных и тетратиольных зондов. Лучшие сигналы гибридизации зонд/мишень (15-мерные или 105-мерные) получают с тетратиольным зондом, привитым при 100 нМ.
Анализ гибридизаций зонд/мишень на электроде с золотой поверхностью
Тест по гибридизации проводили посредством прививки последовательности специфического la/lb зонда на электрод с золотой поверхностью.
Тетратиольный зонд, несущий нуклеотид из
последовательности SEQ ID NO: 1, прививали на рабочий электрод с золотой поверхностью ячейки. Гибридизацию 105-мерных 1а/lb специфических мишеней (из SEQ ID NO: 1) анализировали для 3 различных концентраций мишеней: 1 пМ, 10 пМ и 100 пМ. Отрицательный контроль проводили со 105-мерной За специфической мишенью из SEQ ID NO: б (отрицательный контроль).
Реакцию гибридизации контролировали дифференциальной
импульсной вольтамперометрией. Полученные результаты
представлены на фигуре 15.
Значения на оси у соответствуют нормированным значениям изменения силы тока.
Полученные результаты демонстрируют, что тесты по гибридизации посредством электрохимии являются чувствительными и специфическими при концентрации мишеней 1 пМ. Изменения сигнала также оказываются более значительными при 1 пМ, чем когда тест проводят при 100 пМ. При более высокой концентрации мишени эффект неспецифической адсорбции мишеней на поверхности электрода снижает эффективность реакции распознавания. Электрохимический способ не обеспечивает количественного контроля реакции гибридизации. Тем не менее, он обеспечивает специфический да/нет отклик с очень высокой чувствительностью.
Пример 4. Применение к детекции флавивирусов, таких как вирус денге и вирус Западного Нила.
Известные последовательности вируса денге (серотипы 1, 2, 3 и 4) и вируса Западного Нила выбирали из базы данных GenBank и анализировали. Таблица 1 перечисляет номера доступа GenBank для последовательностей вируса денге и вируса Западного Нила, использованных для проведения выравнивания:
GQ252678,
GU131951,
EU482566,
GQ868574,
GQ868617,
FJ882577,
GU131868,
FJ024465,
НМ181974,
НМ181973,
GQ199870,
AY770511,
GU370053,
GQ199888,
GU131939,
Денге 3 (34 штамма)
GU131937, GU131905,
GU131934, GU189648,
НМ631854, EU660409,
DQ109373,
DQ109368,
DQ109310,
AY676351,
AY676350,
FJ744740,
FJ744730,
DQ109400,
DQ109348,
GQ868593,
АВ2148 80,
AY744677,
EF629370
AY618992,
AY618990,
AY858049,
AY618993,
GQ398256,
AF289029,
EU854301,
EU073983,
GU289913,
Денге 4 (20 штаммов)
AF326573,
FJ882597,
GQ199885,
GQ199884,
GQ199882,
GQ868582,
GQ868584,
AY7 62 0 85,
AY618989,
AY618988,
EF457906
GQ851607,
GQ851606,
AY369441,
AY490240,
AY274504,
GQ851602,
Западного Нила (15 штаммов)
GQ851603,
DQ256376,
DQ318019,
EF429199,
EF429200,
JN858070,
AY277251,
FJ159131,
FJ159129
Дизайн олигонуклеотидных зондов для распознавания последователвностей Денге или Западного Нила
Выравнивание и сравнение последовательностей,
осуществленные с использованием программ clustalW2 и Меда5, обеспечили определение 4 участков, из которых:
- 2 участка являются консервированными среди всех штаммов вирусов денге и Западного Нила, также как и среди остальных флавивирусов, таких как вирус японского энцефалита, вирус клещевого энцефалита, вирус желтой лихорадки и вирус усуту (неограниченный список),
- 1 участок является консервированным среди вирусов денге,
1 участок является консервированным среди вирусов Западного Нила.
Данные участки использовали для разработки зондов по настоящему изобретению с целью обеспечения общей детекции флавивирусов или специфической детекции вирусов денге, денге подтипа 4, или вируса Западного Нила в биологическом образце.
Таким образом, зонды от 1 до 3, представленные в таблице 2 ниже, позволяют детектировать флавивирусы в общем (включая флавивирусы денге и Западного Нила). Зонд 4 является специфическим к вирусам денге, независимо от серотипа. Зонд 5 является специфическим к серотипу 4 вирусов денге. Зонд б является специфическим к вирусам Западного Нила.
Дизайн мишеней для тестирования специфичности распознавания зондов от 1 до 6
Ампликоны, каждый включающий в себя б идентифицированных участков, получают обычной ПЦР, исходя из последовательностей, указанных в Таблице 1, используя праймеры и протокол, ранее описанные Scaramozzino et al. (Scaramozzino N. et al. Comparison of Flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-
PCR assay for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. 2001. Journal of Clinical Microbiology 39: 1922-1927).
Таким образом, первичную амплификацию посредством ПЦР проводят с:
- MAMD смысловым праймером: [Btn]-5'-AAC-ATG-ATG-GGR-AAR-AGR-GAR-AA-3' (или [Btn]- SEQ ID NO: 20) и
- cFD2 антисмысловым праймером (SEQ ID NO: 21) : 5'-GTG-TCC-CAG-CCG-GCG-GTG-TCA-TCA-GC-3'.
Данная амплификация приводит к получению первичного ампликона из 2 63 п.о.
Когда вирусная нагрузка очень мала, проводят вторичную ПЦР, используя продукты амплификации, полученные из первой ПЦР, в качестве матрицы. Данная "полувложенная" ПЦР предпочтительно обеспечивает значительное увеличение чувствительности.
Пример ампликона из 2 63 п.о., полученного после амплификации, исходя из штамма вируса денге со ссылочным номером FJ882517, имеет последовательность:
5'-
AACATGATGGGGAAGAGAGAGAAAAAACTAGGAGAGTTCGGAAAGGCAA
AAGGAAGTCGTGCAATATGGTACATGTGGCTGGGAGCACGCTTTCTAGAG
TTCGAAGCTCTTGGTTTCATGAACGAAGATCACTGGTTCAGCAGAGAGAA
TTCACTCAGCGGAGTGGAAGGAGAAGGACTCCACAAACTTGGATATATAC
TCAGAGACATATCAAAGATTCCAGGGGGAAACATGTATGCAGATGACACA
GCCGGATGGGACAC-3' (SEQ ID NO :23).
Пример ампликона из 2 63 п.о., полученного после амплификации, исходя из штамма вируса Западного Нила со ссылочным номером EF429200/H442, имеет последовательность:
5'-
AACATGATGGGAAAGAGAGAGAAGAAGCCTGGAGAGTTCGGCAAGGCTA
AAGGCAGCAGAGCCATCTGGTTCATGTGGCTGGGGGCTCGTTTCCTGGAG
TTTGAAGCTCTCGGATTCCTCAATGAAGACCACTGGCTGGGTAGGAAGAA
CTCAGGAGGAGGAGTTGAAGGCTTAGGACTGCAGAAGCTTGGGTACATCT TGAAGGAAGTTGGGACAAAGCCTGGAGGAAAGATTTACGCCGATGATACC GCAGGCTGGGACAC-3' (SEQ ID NO :25).
Затем, если требуется, проводят вторичную амплификацию
посредством ПЦР по протоколу, опубликованному Scaramozzino et al., используя первичные ампликоны выше в качестве матрицы со:
- FS7 7 8 смысловым праймером: [Btn] 5'- AAR-GGH-AGY-MCD-GCH-ATH-TGG-T- 3' (или [Btn]- SEQ ID NO: 22)и
- cFD2 антисмысловым праймером (SEQ ID NO: 21) : 5'-GTG-TCC-CAG-CCG-GCG-GTG-TCA-TCA-GC -3'.
Данная амплификация приводит к получению первичного ампликона из 215 п.о.
Пример ампликона из 215 п.о., полученного после амплификации, исходя из штамма вируса денге со ссылочным номером FJ882517, имеет последовательность:
5'-
AAAGGAAGTCGTGCAATATGGTACATGTGGCTGGGAGCACGCTTTCTAGA GTTCGAAGCTCTTGGTTTCATGAACGAAGATCACTGGTTCAGCAGAGAGA ATTCACTCAGCGGAGTGGAAGGAGAAGGACTCCACAAACTTGGATATATA CTCAGAGACATATCAAAGATTCCAGGGGGAAACATGTATGCAGATGACAC AGCCGGATGGGACAC-3' (SEQ ID NO : 24).
Пример ампликона из 215 п.о., полученного после амплификации, исходя из штамма вируса Западного Нила со ссылочным номером EF429200/H442, имеет последовательность:
5'-
AAAGGCAGCAGAGCCATCTGGTTCATGTGGCTGGGGGCTCGTTTCCTGGA GTTTGAAGCTCTCGGATTCCTCAATGAAGACCACTGGCTGGGTAGGAAGA ACTCAGGAGGAGGAGTTGAAGGCTTAGGACTGCAGAAGCTTGGGTACATC TTGAAGGAAGTTGGGACAAAGCCTGGAGGAAAGATTTACGCCGATGATAC CGCAGGCTGGGACAC-3' (SEQ ID NO :26).
Согласно другому варианту осуществления ампликоны получают из вирусных РНК флавивирусов или денге, или Западного Нила, посредством асимметрической ОТ-ПЦР. Вирусные РНК экстрагируют из вируса денге (1-4) или вируса Западного Нила (американского NY или африканского Af происхождения), полученных in vitro. Ампликоны из 2 63 п.о. получают из вирусного участка NS5 флавивирусов посредством ПЦР с обратной транскриптазой, исходя из каждого из образцов РНК, описанных выше. Для того чтобы провести стадию обратной транскрипции (АТ), 5 мкл РНК денатурируют при 72°С в течение 10 минут и обратно
транскрибируют в присутствии 4 мкл 5Х First Strand Buffer (Invitrogen), 2 мкл 10X Hexanucleotide Mix (Roche), 2 мкл 10 мМ dNTP mix (Invitrogen) и 200U Superscript(r) II Reverse Transcriptase (Invitrogen) в общем объеме 20 мкл. Условия обратной транскрипции следующие: 10 мин при 2 5°С, 60 мин при 42°С и 10 мин при 95°С. Пять микролитров кДНК затем амплифицируют посредством ПЦР (полимеразно-цепной реакции), используя праймеры:
биотинилированный "MAMD" смысловой флавивирус (последовательности [Btn]- AAC ATG ATG GGR AAR AGR GAR АА (или [Btn]-SEQ ID NO: 20)) и
- "cFD2" антисмысловой флавивирус (последовательности GTG ТСС CAG CCG GCG GTG ТСА ТСА GC (SEQ ID NO: 21)) (см. Scaramozzino N. et al. 2001, Journal of Clinical Microbiology 39: 1922-1927).
Асимметрическую реакцию амплификации проводят в 50 мкл реакционной смеси, включающей: IX PCR Buffer без МдС12 (Invitrogen), 0,2 мкМ MAMD, 0,02 мкМ cFD2, 1,5 мМ МдС12 (Invitrogen), 0,2 мМ dNTP mix (Invitrogen) и 1,5U Taq Polymerase (Invitrogen). Условия ПЦР следующие: 5 мин при 95°С, 40 циклов (денатурация: 40 сек, 94°С; гибридизация: 40 сек, 53°С; элонгация: 50 сек, 72°С) , и конечная элонгация 10 мин при 72°С. Полученные ВГС ампликоны анализируют электрофорезом в агарозном геле; аликвоты отбирают и хранят при -2 0°С перед использованием. Данные ампликоны, исходные вирусные генотипы которых известны, хранят в виде библиотеки.
Синтезировали 15-мерные синтетические олигонуклеотиды,
биотинилированные по концу 5'. Данные олигонуклеотиды строго
комплементарны выбранным выше зондам, т.е. общему зонду 3 для
детекции флавирусов, общему зонду для детекции вируса Западного
Нила и зонду, специфическому к серотипу 4 вируса денге. Данные
синтетические олигонуклеотиды имеют следующие
последовательности:
- 14-мерные синтетические олигонуклеотиды, специфические к флавивирусам, имеют последовательность: 5' [Btn]- TGG TWC ATG
-
TGG CT-3' (или [Btn]-SEQ ID NO: 43);
- 15-мерные синтетические олигонуклеотиды, специфические к вирусу Западного Нила, имеют последовательность: 5' [Btn]- AGA AYT CAG GAG GMG -3' (или [Btn]-SEQ ID NO: 42) и
- 15-мерные синтетические олигонуклеотиды специфические к серотипу 4 вируса денге, имеют последовательность: 5' [Btn]-ТСА TGG AGT GGA GTG -3' (или [Btn]-SEQ ID NO: 44).
Тесты по гибридизации проводят с зондом 3, распознающим флавивирусы в общем (см. фигуру 21), зондом 5, специфически распознающим серотип 4 денге (см. фигуру 22), и зондом б, специфически распознающим вирус Западного Нила (см. фигуру 23). Зонды, имеющие 4 тиольных функциональных группы, прививают при плотности 2 00 нМ на носитель, покрытый малеимидными группами по протоколу, описанному выше. ELOSA тесты проводят с использованием ампликонов, полученных из серотипов 1, 2, 3 или
4 вируса денге, вируса Западного Нила американского (NY) или африканского (Af) происхождения или вируса гепатита С (длинный За ампликон) при разбавлении 1/10 для зонда 3 и 1/50 для зондов
5 и б для того, чтобы подвердить специфичность удерживаемых зондов. На схемах на фигурах 21, 22 и 23, значение "образцы/фоновый шум" получают вычислением отношения числа отсчетов, измеренных для каждого образца, к числу отсчетов, измеренных для контроля (ГБ), относящихся только к гибридизационному буферу, не включающему мишень. Используемые в данных тестах ампликоны вируса денге и вируса Западного Нила получали по способу асимметрической ОТ-ПЦР, описанному выше.
Результаты, представленные на фигурах 21, 22 и 23, демонстрируют, что общий зонд флавивирусов, специфический зонд 4 вируса денге и общий зонд вирусов Западного Нила значительно гибридизируются только с ампликонами, соответствующими изучаемым вирусам.
СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ
<110> Etablissement Fran?ais du Sang (EFS)
Centre National de la Recherche Scientifique (CNRS) universit? de Montpellier 1 universit? Claude Bernard Lyon 1
<120> модифицированные олигонуклеотиды, включающие тиольные функциональные группы, и их применение для детекции нуклеиновых кислот
<130> 33740 EFN
<160> 44
<170> BiSSAP 1.0
<210> 1 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /то1_г.уре="днк"
/note="30Hfl вгс la/lb"
/organi5т="искусственные последовательности" <400> 1
gtgcagtccy ggagc 15
<210> 2 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /то1_г.уре="днк"
/note="MnmeHb вгс la/lb 15-мерная"
/organi5т="искусственные последовательности" <400> 2
gctccrggac tgcac 15
<210> 3 <211> 105 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..105
<223> /то1_г.уре="днк"
/note="MnmeHb вгс la/lb 105-мерная"
/organi5т="искусственные последовательности"
<400> 3
cctcacttgc tacatcaagg cccaggcagc ctgtcgagcc gcagggctcc gggactgcac 60 catgctcgtg tgtggcgacg acttagtcgt tatctgtgaa agtgc 105
<210> 4 <211> 15 <212> ДНК
<213> искусственные последовательности
<220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30HA вгс 3a"
/organi5т="искусственные последовательности" <400> 4
ggcctccggt tcaag 15
<210> 5 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/пог.е="мишень вгс За 15-мерная"
/organi5т="искусственные последовательности"
<400> 5
cttgaaccgg aggcc 15
<210> 6 <211> 105 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..105
<223> /то1_г.уре="днк"
/пог.е="мишень вгс За 105-мерная"
/organi5т="искусственные последовательности"
<400> 6
gaacaggaca tcagggtgga agaggagata taccaatgct gtaaccttga accggaggcc 60 aggaaagtga tctcctccct cacggagcgg ctttactgcg ggggc 105
<210> 7 <211> 13 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..13
<223> /mol_type="flHK"
/note="TecT по прививке нуклеиновой кислоты"
/organi5т="искусственные последовательности"
<400> 7
ccaagcacga tgt 13
<210> 8 <211> 31 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..31
<223> /mol_type="flHK"
/пог.е="праймер вгс смысловой биотинилированный" /organi5т="искусственные последовательности"
<400> 8
tggggatccc gtatgatacc cgctgctttg a 31
<210> 9 <211> 30 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..30
<223> /mol_type="flHK"
/note="пpaймep вгс антисмысловой"
/organi5т="искусственные последовательности"
<400> 9
ggcggaattc ctggtcatag cctccgtgaa 30
<210> 10 <211> 25 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..25
<223> /mol_type="flHK"
/note="пpaймep вгс la/lb смысловой биотинилорованный"
/organi5т="искусственные последовательности"
<400> 10
tgacracyag ctgyggtaay accct 25
<210> 11 <211> 21 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..21
<223> /mol_type="flHK"
/note="пpaймep вгс антисмысловой За rev"
/organi5т="искусственные последовательности"
<400> 11
gcagtaaagc cgytccgtga g 21
<210> 12 <211> 401 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..401
<223> /mol_type="flHK"
/note="Aмпликoн ВГС длинный 401 н.п. la/lb #PTR6719"
/organism="Bnpyc гепатита С"
<400> 12 tggggatccc
gtatgatacc
cgctgctttg
actcaacggt
cactgagaat
gacatccgtg
ttgaggagtc
aatttaccaa
tgttgtgacc
tagcccccga
agccagacag
gccataaggt
120
cgctcacaga
gcggctttac
atcgggggtc
ccctgactaa
ttcaaaaggg
cagaactgcg
180
gctatcgccg
gtgccgcgcg
agcggtgtgc
tgacgaccag
ctgcggtaat
accctcacat
240
gttacttgaa
ggcctctgcg
gcctgtcgag
ctgcaaagct
ccaggactgc
acaatgctcg
300
tgtgcggaga
cgaccttgtc
gttatctgtg
aaagcgcggg
aacccargag
gatgcggcga
360
gcctacgagt
cttcacggag
gctatgacca
ggaattccgc
401
<210> 13 <211> 191 <211> 401 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..191
<223> /mol_type="flHK"
/г^е="Ампликон вгс короткий 191 н.п. la/lb #PTR6719"
/organism="Bnpyc гепатита С"
<400> 13
tgacgaccag ctgcggtaat accctcacat gttacttgaa ggcctctgcg gcctgtcgag 60
ctgcaaagct ccaggactgc acaatgctcg tgtgcggaga cgaccttgtc gttatctgtg 120
aaagcgcggg aacccargag gatgcggcga gcctacgagt cttcacggag gctatgacca 180
ggaattccgc с 191
<210> 14 <211> 401 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..401
<223> /mol_type="flHK"
/note="Aiv^HKOH ВГС длинный 401 н.п. За #PTR9058"
/organism="Bnpyc гепатита С"
<400> 14
tggggatccc gtatgatacc cgctgctttg actcgactgt cactgaacag gatatcaggg 60
tggaagagga gatataccaa tgctgtaatc ttgaaccgga ggccaggaag gtgatctcct 120
ccctcacgga gcggctttac tgcgggggtc ctatgttcaa cagcaaaggg gcccagtgtg 180
gttatcgccg ttgccgtgct agtggagttc tacctaccag cttcggcaat acaatcactt 240
gctacatcaa ggccacagcg gctgcaaggg ccgcaggcct ccggaacccg gactttcttg 300
tctgcggaga cgatctagtc gtggtggctg agagtgacgg cgtcgacgag gatggggcgg 360
ccctgagagc cttcacggag gctatgacca ggaattccgc с 401
<210> 15 <211> 143 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..143
<223> /mol_type="flHK"
/note="Aмпликoн вгс короткий 143 н.п. За #PTR9058"
/organism="Bnpyc гепатита С"
<400> 15
tggggatccc gtatgatacc cgctgctttg actcgactgt cactgaacag gatatcaggg 60
tggaagagga gatataccaa tgctgtaatc ttgaaccgga ggccaggaag gtgatctcct 120
ccctcacgga gcggctttac tgc 143
<210> 16 <211> 14 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..14
<223> /mol_type="flHK"
/note="30Hfl общий 1 флавивирус"
/organi5т="искусственные последовательности"
<400> 16
gctcccarcc acat 14
<210> 17 <211> 14 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..14
<223> /mol_type="flHK"
/note="30Hfl общий 2 флавивирус"
/organi5т="искусственные последовательности"
<400> 17
aaccatctrt cttc 14
<210> 18 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl специфический 3 денге"
/organi5т="искусственные последовательности" <400> 18
cttcyccttc yactc 15
<210> 19 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl специфический 4 Западный Нил"
/organi5т="искусственные последовательности"
<400> 19
ckcctcctga rttct 15
<210> 20 <211> 23 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..23
<223> /то1_г.уре="днк"
/note="пpaймep смысловой флавивирус MAMD"
/organi5т="искусственные последовательности"
<400> 20
aacatgatgg graaragrga raa 23
<210> 21 <211> 26 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..26
<223> /то1_г.уре="днк"
/note="пpaймep антисмысловой флавивирус CFD2"
/organi5т="искусственные последовательности"
<400> 21
gtgtcccagc cggcggtgtc atcagc 26
<210> 22 <211> 22 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..22
<223> /то1_г.уре="днк"
/note="пpaймep смысловой флавивирус FS778"
/organi5т="искусственные последовательности"
<400> 22
aargghagym cdgchathtg gt 22
<210> 23 <211> 263 <212> ДНК
<213> денге вирус 1
<220>
<221> источник
<222> 1..263
<223> /mol_type="flHK"
/note="Aмпликoн Денге 1 263 н.п. FJ882517"
/organism="fleHre вирус 1"
<400> 24 aaaggaagtc
gtgcaatatg
gtacatgtgg
ctgggagcac
gctttctaga
gttcgaagct
cttggtttca
tgaacgaaga
tcactggttc
agcagagaga
attcactcag
cggagtggaa
120
ggagaaggac
tccacaaact
tggatatata
ctcagagaca
tatcaaagat
tccaggggga
180
aacatgtatg
cagatgacac
agccggatgg
gacac
215
<210> 25 <211> 263 <212> ДНК
<213> Вирус Западного Нила <220>
<221> источник
<222> 1..263
<223> /mol_type="flHK"
/пог.е="Ампликон B3H 263 н.п. EF429200H442" /organism="Bnpyc Западного Нила"
<400> 25 aacatgatgg
gaaagagaga
gaagaagcct
ggagagttcg
gcaaggctaa
aggcagcaga
gccatctggt
tcatgtggct
gggggctcgt
ttcctggagt
ttgaagctct
cggattcctc
120
aatgaagacc
actggctggg
taggaagaac
tcaggaggag
gagttgaagg
cttaggactg
180
cagaagcttg
ggtacatctt
gaaggaagtt
gggacaaagc
ctggaggaaa
gatttacgcc
240
gatgataccg
caggctggga
cac
263
<210> 26 <211> 215
Страница
<212> ДНК
<213> Вирус Западного Нила <220>
<221> источник
<222> 1..215
<223> /то1_г.уре="днк"
/пог.е="Ампликон ВЗН 215 н.п. EF429200H442" /organism="Bnpyc Западного Нила"
<400> 26 aaaggcagca
gagccatctg
gttcatgtgg
ctgggggctc
gtttcctgga
gtttgaagct
ctcggattcc
tcaatgaaga
ccactggctg
ggtaggaaga
actcaggagg
aggagttgaa
120
ggcttaggac
tgcagaagct
tgggtacatc
ttgaaggaag
ttgggacaaa
gcctggagga
180
aagatttacg
ccgatgatac
cgcaggctgg
gacac
215
<210> 27 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/пог.е="Зонд ВГС 2"
/organi5т="искусственные последовательности" <400> 27
tggctytctg agatg 15
<210> 28 <211> 15 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl вгс 4a/4d"
/organism="Bnpyc гепатита С"
<400> 28
ggrccgccca crtag 15
<210> 29 <211> 21 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..21
<223> /mol_type="flHK"
/пог.е="праймер ВГС2 смысловой биотинилированный"
/organi5т="искусственные последовательности"
<400> 29
atgytggtrt gcggcgacga с 21
<210> 30 <211> 23 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..23
<223> /mol_type="flHK"
/note="npaPiMep вгс антисмысловой 4 rev"
/organi5т="искусственные последовательности"
<400> 30
aggtctcccy tgctgttgtr cat 23
<210> 31 <211> 401 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..401
<223> /mol_type="flHK"
/note="Aмпликoн ВГС длинный 2 401 н.п. #PTR7761"
/organism="Bnpyc гепатита С"
<400> 31 tggggatccc
gtatgatacc
cgctgctttg
actcaactgt
cactgagaga
gacatcagaa
ccgaggagtc
catataccag
gcctgctccc
taaccgagga
ggctcgcacc
gccatacact
120
cgctgactga
gaggctatac
gtgggagggc
ccatgctcaa
tagcaaaggc
cagacctgcg
180
ggtacaggcg
ttgccgcgcc
agcggggtgc
tcaccactag
catgggaaac
accattacgt
240
gctatgtgaa
agctctagcg
gcatgcaagg
ccgcagggat
agtagcgccc
acgatgctgg
300
tatgcggcga
cgacctggtc
gtcatctcag
aaagccaggg
gactgaggag
gacgagcgga
360
acctgagagt
cttcacggag
gctatgacca
ggaattccgc
401
<210> 32 <211> 401 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..401
<223> /mol_type="flHK"
/note="Aмпликoн ВГС длинный 4a/4d 401 н.п. #PTR4162"
/organism="Bnpyc гепатита С"
<400> 32 tggggatccc
gtatgatacc
cgctgctttg
actccactgt
aaccgaaaga
gacatcaggg
tcgaggagga
ggtctatcag
tgttgtgacc
tagagcccga
agcccgcaag
gtaatatccg
120
ccctcacaga
gagactctac
gtgggcggtc
ccatgtacaa
cagcagggga
gacctttgcg
180
gaactcgacg
gtgccgtgca
agcggcgtat
tcaccaccag
ctttgggaac
acactgacgt
240
gctatcttaa
ggccagcgcg
gccatcaggg
ctgcaggcct
aaaggactgc
accatgctgg
300
tctgtggcga
cgacttagtc
gttatcgctg
aaagcgatgg Страница
cgtggaggag 9
gacaaccgtg
360
cgctcagagc cttcacggag gctatgacca ggaattccgc с
401
<210> 33 <211> 108 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..108
<223> /mol_type="flHK"
/г^е="Ампликон ВГС короткий 108 н.п. 2 #PTR7761"
/organism="Bnpyc гепатита С"
<400> 33
atgctggtat gcggcgacga cctggtcgtc atctcagaaa gccaggggac tgaggaggac 60 gagcggaacc tgagagtctt cacggaggct atgaccagga attccgcc 108
<210> 34 <211> 175 <212> ДНК
<213> Вирус гепатита С <220>
<221> источник
<222> 1..175
<223> /mol_type="flHK"
/note="Aмпликoн ВГС короткий 4a/4d 175 н.п. #PTR4162"
/organism="Bnpyc гепатита С"
<400> 34
tggggatccc gtatgatacc cgctgctttg actccactgt aaccgaaaga gacatcaggg 60
tcgaggagga ggtctatcag tgttgtgacc tagagcccga agcccgcaag gtaatatccg 120
ccctcacaga gagactctac gtgggcggtc ccatgtacaa cagcagggga gacct 175
<210> 35 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl вгс 2a/2c"
/organi5т="искусственные последовательности" <400> 35
ggactcctcr gttct 15
<210> 36 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl ВГС 2b"
SEQL.tXt
/organi5т="искусственные последовательности" <400> 36 tatggattct tctgt
<210> 37 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/пог.е="мишень вгс 2a/2c 15-мерная биотинилированная /organi5т="искусственные последовательности"
<400> 37
agaacygagg agtcc
<210> 38 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /то1_г.уре="днк"
/пог.е="мишень вгс 2b 15-мерная биотинилированная" /organi5т="искусственные последовательности"
<400> 38
acagaagaat ccata
<210> 39 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /то1_г.уре="днк"
/пог.е="мишень вгс 4a/4d 15-мерная биотинилированная /organi5т="искусственные последовательности"
<400> 39
ctaygtgggc ggycc
<210> 40 <211> 14 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..14
<223> /то1_г.уре="днк"
/пог.е="Зонд общий 3 флавивирус"
/organi5т="искусственные последовательности"
<400> 40 agccacatgw асса
<210> 41 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="30Hfl специфический денге 4"
/organi5т="искусственные последовательности"
<400> 41
cactccactc catga 15
<210> 42 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /mol_type="flHK"
/note="MnmeHb взн 15-мерная биотинилированная"
/organi5т="искусственные последовательности" <400> 42
agaaytcagg aggmg 15
<210> 43 <211> 13 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..13
<223> /то1_г.уре="днк"
/note="MnmeHb общая 3 флавивирус 15-мерная биотинилированная"
/organi5т="искусственные последовательности" <400> 43
tggwcatgtg get 13
<210> 44 <211> 15 <212> ДНК
<213> искусственные последовательности <220>
<221> источник
<222> 1..15
<223> /то1_г.уре="днк"
/note="MnmeHb специфическая денге 4 15-мерная биотинилированная"
/organi5т="искусственные последовательности"
<400> 44
tcatggagtg gagtg 15
ФОРМУЛА ИЗОБРЕТЕНИЯ
1. Модифицированный олигонуклеотид, соответствующий формуле (XIlb):
(ХПЬ) N1-N2-.. .-Nn_i-Nn-(I'b)y-(Mi-.. .-Mm_i-Mm)p-(Fb)y'
или формуле (XIIlb):
(ХШЬ) flc')-fl'b)y-i-Ni-N2-.. ..N^-Nn-a'bV-CMi-Mz-.. .-M.n.i-M^p-a'b)/-
в которых
Ni, Nn обозначают, независимо друг от друга, нуклеотид, Mi, Mm обозначают, независимо друг от друга, нуклеотид, (I'b) обозначает соединение формулы:
.О-Р-
Y О
x-w
-о \ /
(1с') обозначает соединение формулы: Y
X-W
-о \ /
п обозначает целое число от 4 до 100, m обозначает целое число от 4 до 100, у обозначает целое число от 2 до 12, р обозначает 0 или 1,
у' обозначает целое число от 0 до 12, если р равно 1, и у' равно 0, если р равно 0,
у' ' обозначает целое число от 0 до 12, если р равно 1, и, если р равно 0, то у' равно 0,
сумма целых чисел (у+у') или (у+у'+у'') не больше 12,
X выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
Y выбирают из линейных или разветвленных С1-С12 алкильных
групп, С1-С12 аминоалкильных групп, С1-С12 алкоксильных групп,
СЗ-С12 циклоалкильных групп, кислородсодержащих или
азотсодержащих СЗ-С12 циклогетероалкильных групп,
Z выбирают из С1-С12 алкоксильных групп,
кислородсодержащих или азотсодержащих СЗ-С12
циклогетероалкильных групп, С1-С12 NCO-алкильных групп, С1-С12 CON-алкильных групп,
W выбирают из С1-С12 алкантриильных групп, С6-С18 арилтриильных групп и С6-С18 аралкантриильных групп,
R обозначает Н или выбирают из С1-С12 ацильных, С1-С12 S-
алкильных, С6-С12 S-арильных, S-2-пиридиновой,
кислородсодержащих или азотсодержащих С1-С12 S-гетероалкильных, СЗ-С12 S-циклоалкильных, кислородсодержащих или азотсодержащих СЗ-С12 S-циклогетероалкильных групп, и
R1 выбирают из 2-цианоэтильной или R' iR' 2R' 3SiCH2CH2 групп, в которых R'i, R'2 и R'3 могут быть одинаковыми или разными и обозначают группу, выбранную из линейных или разветвленных алкилов, включающих от 1 до 12 углеродных атомов, и С6-С12 арилов.
2. Модифицированный олигонуклеотид по п.1, соответствующий формуле:
RS.
¦О-Х'
в которой п, у, Ni,..., Nn-i, X, Y, Z, W и R имеют такое же толкование, как в формуле 1,
и Вп обозначает основание n-ного нуклеотида.
3. Модифицированный олигонуклеотид по п.1, соответствующий формуле:
RS.
HO-Y" ^X-O-
-P-O-Y'
I _ О
x-o-
N2 0-P=0
О.0
-p-o
I _ о
J y-1
в которой n, у, N2,..., Nn, X, Y, Z, W и R имеют такое же толкование, как описано в п. 1, и Вп обозначает основание 1-ого нуклеотида.
4. Модифицированный олигонуклеотид по одному из пп. 1-3, в
которых нуклеотидная последовательность (Ni-N2-...-Nn_i-Nn) и, если
требуется, нуклеотидная последовательность (Mi-M2-...-Mm_i-Mm)
являются специфическими к вирусу, бактерии или гену,
определяющему заболевание или участвующему в заболевании.
5. Модифицированный олигонуклеотид по п.4, в котором
нуклеотидную последовательность (Ni-N2-...-Nn-i-Nn) и, если
требуется, нуклеотидную последовательность (Mi-M2-...-Mm-i-Mm)
выбирают из:
- последовательностей SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 35 или SEQ ID NO: 36, специфических к вирусу гепатита С (ВГС),
- последовательностей SEQ ID N0: 16, SEQ ID NO: 17 или SEQ ID NO: 40, специфических к флавивирусам,
- последовательностей SEQ ID NO: 18 или SEQ ID NO: 41, специфических к вирусам денге, или
- последовательности SEQ ID N0: 19, специфической к вирусу Западного Нила (ВЗН).
6. Модифицированный олигонуклеотид по одному из пп. 1-5, в
которых нуклеотидная последовательность (Ni-N2-...-Nn_i-Nn) и, если требуется, нуклеотидная последовательность (Mi-M2-...-Mm-i-Mm) имеют структуры альфа-аномера, бета-аномера, линейную или типа "улитка".
7. Субстрат, привитый по меньшей мере одним
модифицированным олигонуклеотидом по пп. 1-6, содержащий по
меньшей мере одну зону приема, покрытую веществом,
выдерживающим прививку упомянутого модифицированного
олигонуклеотида.
8. Привитый субстрат по п.7, в котором
- упомянутая зона приема покрыта тонким слоем золота или платины, и упомянутый субстрат обозначает собой металл, предпочтительно, медь или титан, или
- упомянутая зона приема содержит на своей поверхности по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно, малеимидные или акриламидные функциональные группы, и упомянутый субстрат обозначает собой пластик, предпочтительно, полистирол.
9. Привитый субстрат по пп. 7 или 8, в которых привитый субстрат неплоский и находится предпочтительно в форме микрочастиц или наночастиц.
10. Способ детекции по меньшей мере одной нуклеиновой
кислоты-мишени в биологическом образце, включающий стадию:
детекции упомянутой нуклеиновой кислоты-мишени по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида по пп. 1-6.
11. Способ детекции по п. 10, включающий стадии:
получения по меньшей мере одной исходной нуклеиновой
кислоты из упомянутого биологического образца,
- получения ампликона амплификацией упомянутой нуклеиновой кислоты-мишени из исходной нуклеиновой кислоты, и
- детекции гибридизации упомянутого ампликона по меньшей мере одним детектирующим зондом, образованным из модифицированного нуклеотида по пп. 1-6.
12. Способ по п. 11 для определения генотипа и/или подтипа
вируса, присутствующего в биологическом образце, в котором:
ампликон формируют амплификацией последовательности нуклеиновой кислоты-мишени, соответствующей геномному участку вируса, несущего информацию, относящуюся к вирусному генотипу и/или подтипу, и
- детекцию проводят по меньшей мере одним детектирующим зондом, специфическим к вирусному генотипу и/или подтипу.
13. Способ по п.12, в котором стадию получения ампликона проводят амплификацией нуклеотидной последовательности-мишени, соответствующей участку генома вируса, несущего информацию, относящуюся к вирусному генотипу и/или подтипу, со смесью нуклеотидных праймеров, предпочтительно выбранных из пар праймеров:
- SEQ ID N0: 8 и SEQ ID N0: 9, когда ампликон получают, исходя из любого вирусного генотипа ВГС;
- SEQ ID N0: 10 и SEQ ID N0: 9, когда ампликон получают, исходя из ВГС генотипа la/lb;
- SEQ ID N0: 29 и SEQ ID N0: 9, когда ампликон получают, исходя из ВГС генотипа 2;
- SEQ ID N0: 8 и SEQ ID N0: 11, когда ампликон получают, исходя из ВГС генотипа За;
- SEQ ID N0: 8 и SEQ ID N0: 30, когда ампликон получают, исходя из ВГС генотипа 4а/4Ь;
- SEQ ID N0: 20 и SEQ ID N0: 21, и/или SEQ ID N0: 22 и SEQ ID N0: 21, когда ампликон получают из флавивируса.
14. Набор для детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце, содержащий:
- по меньшей мере один модифицированный олигонуклеотид по пп. 1-6 и по меньшей мере один субстрат, содержащий по меньшей мере одну зону приема, покрытую веществом, выдерживающим прививку упомянутого модифицированного олигонуклеотида, упомянутая зона предпочтительно покрыта золотом с платиной или содержит на поверхности по меньшей мере одну углерод-углеродную двойную связь или углерод-углеродную тройную связь, или галогенацетамидные группы, предпочтительно, малеимидные или акриламидные функциональные группы, или
-
- по меньшей мере один привитый субстрат по пп. 7-9.
15. Олигонуклеотид, имеющий нуклеотидную
последовательность, выбранную из последовательностей SEQ ID N0:
1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 16,
SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35, SEQ
ID NO: 36, SEQ ID NO: 40 и SEQ ID NO: 41.
16. Применение модифицированного олигонуклеотида по одному из пп. 1-6, олигонуклеотида по п. 15 или привитого субстрата по одному из пп. 7-9 для детекции по меньшей мере одной нуклеиновой кислоты-мишени в биологическом образце.
17. Применение по п. 16 для диагностики, генотипирования или секвенирования вирусных штаммов, предпочтительно вирусов гепатита или арбовирусов, предпочтительно Flaviviridae, Togaviridae или Bunhyaviridae.
18. Применение по п.17 для диагностики, генотипирования или секвенирования ВГС, ВГВ, вирусов денге или вируса Западного Нила.
По доверенности
X-W
D-CI
D-0
X-W
G-Z"-G'
X-W / \
D-0
(III)
(V)
(IV)
RSK+
X-W
D-0 z / S
0-P(OR1)N(R2):
/OR,)
CI-P
N-R2
x-w'
D-0
(II)
(la)
Г-н
J-0
H -P'
OQ'
X-W
D-0
(lb)
\ R
О I
X-W / \ D-0 z
S \
(Ic)
о I
X-W
DO' \
О О
X-W
О О
О I
0R1 x-w'
,0-Р-о
О О
XX м
(1с)
(1с.1)
X-W
(XIV) 1
D-0
I2/H2O
О О
о о
н-о
1 X-W
(XIVм) 1
D-0
,0-Р-о X-W s4
D-0
X-W
О I
0R1 x-w'
,0-Р-о Y О
/ \
(XIV)2
О О
OR I
ЛА^
|2/н2о
1 X-W
,0-Р- о
' II о
D-0
x-w
о о
А Л. А
(к-2) la
О О
(Ik)
x-w
,о-р-
он I
X-W
< \
OR. I 1
Y О
х-W
А Л. А
о I
x-w'
- \
(XIV)k
X-W
о о
Л Л
(1с)
X-W
о о
(1с1)
о I
x-w
З-Р-п" \
О о
(XV)1
D-0
о о
AAA
О О
О II
,0-Р-о
x-w ,0-Р- о Nz
(XV)2
x-w
о II
,О-Р-О
Y Н
x-w / \ Н-0 z
x-w
(XV")1
(к-2)lb
о II
,0-Р-
У н
x-w
О I
x-w'
- \
О о
А Л. А
(XV)k
I2/H2O
о II
,о-Р-
У о
x-w
S о I
x-w'
- \
о о
AAA
(XV)k
(Ik)
x-w
,0-P-
OH I
x-w
R2/ -p_o OR,
[J-^-Nj-Nn-l
(Xlla.1)
-P-о
i-N*-Nn-r
(Xlla.2) OR,
.S-R
O-PfOR^NfR^
X-W / \ DO Y^Q //
X-W
(Xlla.6)
P -OR,
Nl_N2"'Nn-1 P-О
OR,
(Xlla.5)
n-1
l2/H20
.S-R
x-w
DO W О
¦°"X' Y-O-fS.
R.,0
(Xlla.4)
0=P-OR,
¦ П-1
R.,0
0=Р-OR,
(ХМа.З) Nn-1
N2 I
H-HO-X V-
o о
(XI Ic)
о=р-о
4 п-1
ФИГ. 5
степень прививки модифицированного олигонуклеотида на золотую поверхность
Фиг. 6
ФИГ. 7
ФИГ. 8
ВГС ампликоны (+)
Синтетические Контроль (-)
о I-
т о
100000
о о
10000 -
1000
100
111
Фиг. П
ФИГ. 15
1 а/1 b ВГС тест по гибридизации
ZT ¦
к ¦
t =
m о
го m
^ '5
го о
i i
1- о
S .0
° 5.
го р
I s со
0,20
0,15
0,10
0,05
0,00
-0,05
100 пМ
10 пМ
1 пМ
Отриц. полож.
105-мерный
/ s-
Фиг. 16b
gpt-SH
265 нм
ДОИ ЛлЛАллл/ . r
ФИГ. 17
mil
-0L89
lAlu 0001-
-6 юг
60291
IAILJ 0IU Ш (r)
lAlu 0001- *~
о о о
о о
о о
8 8
О т
о о
О т-
-ошэ -6 юг
|/\|UOi.
l/\|u000t IA|U ' .
lAlu OOOt
1 s
^ 3 s
- 2
да i со о
CD T
IAIU i. I/MU 0001-IA|u ' .
CD I-
CM I
I Q.
-° 2 Ю
да "
IAIU ji.Oi ~
О О
о о о
8 §
о о
т со
-ош
-6 юг |
60291-
IAIU
IAIUOO0I-
см s о
I
J3 I 5 Ю
lAJUQOOI. -
О о о о о о
о 8
о о о
IAJU 0001- I
Q.
IAJU 01.
IAJU 0001-
о о
о 8
о о
ФИГ. 21
Общий зонд 3 флавифирусов
> 3 > s
M О I О
со со
Ю О 90 80 70 60 50 4С 30 2 0 10
отрезная линия
Денге 1 Денге Денге Денге : ЗН af ЗН пу ВГЦ ГБ
ФИГ. 22
Зонд 4 денге
100 90
g 8!)
2 70
I f> 0
Ь'*
~2 " отрезная
j линия О "50 СО Q.
^ 3"
?0 10
Денге 1 Денге 2 Денге 3 Денге 4 ЗН af ЗН пу ВГЦ ГБ
Зонд вируса Западного Нила
МО 90 80 70
M 60
О г,о отрезная
линия
2 4С) ZT
СО 30 Q. Ю
О Л)
Денге 1 Денге ? Денге Денге 4 ЗН af ЗН пу ВГЦ ГБ
5'-
SEQL.tXt
SEQL.tXt
Страница 1
Страница 1
SEQL.tXt
SEQL.tXt
Страница 6
Страница 11
Страница 11
SEQL.tXt
SEQL.tXt
Страница 12
Страница 12
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
1/24
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
2/24
ФИГ. 2А
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
3/24
ФИГ. 2В
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
4/24
6/24
6/24
7/24
7/24
8/24
8/24
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
10/24 ФИГ. 9
9/24
aoiahoio оиэиь
12/24
13/24
aoiahoio оиэиь
15/24 ФИГ. 14
15/24 ФИГ. 14
aoiahoio оиэиь
aoiahoio оиэиь
16/24
17/24 ФИГ. 16а
16/24
17/24 ФИГ. 16а
18/24
17/24 ФИГ. 16а
18/24
17/24 ФИГ. 16а
18/24
17/24 ФИГ. 16а
19/24
19/24
aoiahoio оиэиь
aoiahoio оиэиь
19/24
19/24
aoiahoio оиэиь
aoiahoio оиэиь
19/24
19/24
aoiahoio оиэиь
aoiahoio оиэиь
19/24
19/24
aoiahoio оиэиь
aoiahoio оиэиь
19/24
19/24
aoiahoio оиэиь
aoiahoio оиэиь
20/24 ФИГ. 18
20/24 ФИГ. 18
aoiahoio оиэиь
aoiahoio оиэиь
20/24 ФИГ. 18
20/24 ФИГ. 18
aoiahoio оиэиь
aoiahoio оиэиь
20/24 ФИГ. 18
20/24 ФИГ. 18
aoiahoio оиэиь
aoiahoio оиэиь
21/24
21/24
aoiahoio оиэиь
aoiahoio оиэиь
21/24
21/24
aoiahoio оиэиь
aoiahoio оиэиь
21/24
21/24
aoiahoio оиэиь
aoiahoio оиэиь
21/24
21/24
aoiahoio оиэиь
aoiahoio оиэиь
21/24
21/24
aoiahoio оиэиь
aoiahoio оиэиь
22/24 ФИГ. 20
22/24 ФИГ. 20
aoiahoio оиэиь
aoiahoio оиэиь
22/24 ФИГ. 20
22/24 ФИГ. 20
aoiahoio оиэиь
aoiahoio оиэиь
23/24
23/24
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23
24/24 ФИГ. 23