Патентная документация ЕАПВ

 
Запрос :  ea000020849b*\id

больше ...
Термины запроса в документе


Полный текст патента

(57) Реферат / Формула:

1. Способ лечения заболеваний печени, включающий введение соединения общей формулы (I) в которой X1 представляет собой галоген, R1 или группу G1-R1; А представляет собой СН=СН или группу СН2-СН2; Х2 представляет собой группу G2-R2; G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы; R1 представляет собой атом водорода, незамещенную алкильную группу, арильную группу или алкильную группу, которая замещена одним или более атомами галогена, алкокси или алкилтиогруппой, циклоалкильными группами, циклоалкилтиогруппами или гетероциклическими группами; R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильной группой, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами или гетероциклическими группами; R4 и R5, одинаковые или различные, представляют собой алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами, гетероциклическими группами, где алкильная группа представляет собой насыщенный углеводородный радикал, который является линейным или разветвленным, содержащий от одного до семи атомов углерода; алкоксигруппа представляет собой алкильную группу, которая соединена с остатком соединения через атом кислорода; алкилтиогруппа представляет собой алкильную группу, которая соединена с остатком соединения через атом серы; циклоалкильная группа представляет собой алкильную группу, которая образует один цикл, содержащий от трех до четырнадцати атомов углерода; циклоалкилтиогруппа представляет собой циклоалкильную группу, которая соединена с остатком соединения через атом серы; арильная группа прдставляет собой ароматическую группу, замещенную или не замещенную, содержащую предпочтительно от шести до четырнадцати атомов углерода; гетероциклическая группа представляет собой гетероциклоалкильную или гетероарильную группу; гетероциклоалкильная группа представляет собой циклоалкильную группу, которая дополнительно содержит один или несколько гетероатомов, выбранных из азота, кислорода или серы; и гетероарильная группа представляет собой арильную группу, которая дополнительно содержит один или несколько гетероатомов, выбранных из азота, кислорода или серы.

2. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой X1 представляет собой галоген, R1 или группу G1-R1; А представляет собой группу СН=СН; Х2 представляет собой группу G2-R2; G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы; R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода, причем, в частности, алкильная или циклоалкильная группа замещена или не замещена одним или более атомами галогена; R2 представляет собой алкильную группу, замещенную -COOR3 группой, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода; R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.

3. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой X1 представляет собой R1 или группу G1-R1; А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2; G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода; R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода; R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.

4. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой X1 представляет собой атом галогена или R1 или группу G1-R1; А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2; G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, которая замещена одним или более атомами галогена; R2 представляет собой алкильную группу, замещенную или не замещенную одним или более атомами галогена и замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода; R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.

5. Способ по любому из предшествующих пунктов, где G2 представляет собой атом кислорода и R2 представляет собой алкильную группу, замещенную группой -COOR3, в которой R3 представляет собой атом водорода, или незамещенную линейную или разветвленную алкильную группу, содержащую от одного до четырех атомов углерода.

6. Способ по любому из предшествующих пунктов, где X1 представляет собой алкилтиогруппу, которая содержит алкильную группу, которая является линейной или разветвленной, содержащей от одного до семи атомов углерода, которая замещена или не замещена одним или более атомами галогена.

7. Способ по любому из предшествующих пунктов, где соединение выбирают из группы, состоящей из 1-[4-метилтиофенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, 1-[4-метилтиофенил]-3-[3,5-диметил-4-изопропилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, 1-[4-метилтиофенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, 1-[4-трифторметилфенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, 1-[4-трифторметилфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, 1-[4-трифторметилоксифенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, 1-[4-трифторметилоксифенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, 2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты и изопропилового эфира 2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты.

8. Способ по любому из предшествующих пунктов, в котором соединение вводят в комбинации с метформином, инсулином, тиазолидиндионами, глитазонами или статинами.

9. Способ лечения заболевания печени, включающий введение фармацевтической композиций, содержащей соединение общей формулы (I), как определено по любому из пп.1-8.

10. Способ по п.9, где фармацевтическая композиция составлена в форме инъецируемых суспензий, гелей, масел, пилюль, суппозиториев, порошков, гелевых капсул, капсул, аэрозолей или галеновых форм, или устройств, обеспечивающих продолжительное и/или медленное высвобождение.

11. Способ по любому из пп.1-10, где заболевание печени выбрано из группы, состоящей из фиброза печени, жирового гепатоза и неалкогольного стеатогепатита.


Евразийское 020849 (13) B1
патентное
ведомство
(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ЕВРАЗИЙСКОМУ ПАТЕНТУ
(45) Дата публикации и выдачи патента 2015.02.27
(21) Номер заявки 201290389
(22) Дата подачи заявки 2010.11.26
(51) Int. Cl.
A61K31/192 (2006.01) A61K31/216 (2006.01) A61P1/16 (2006.01)
(54) ПРИМЕНЕНИЕ 1,3-ДИФЕНИЛПРОП-2-ЕН-1-ОНОВЫХ ПРОИЗВОДНЫХ ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ ПЕЧЕНИ
(31) 09306146.3
(32) 2009.11.26
(33) EP
(43) 2013.01.30
(86) PCT/EP2010/068346
(87) WO 2011/064350 2011.06.03
(71) (73) Заявитель и патентовладелец:
ЖЕНФИТ (FR)
(72) Изобретатель:
Дартей Рафаэль, Анф Реми, Хам Дин,
Дюфур Ингрид (FR)
(74) Представитель:
Медведев В.Н. (RU)
(56) WO-A1-2007147879 WO-A1-2004005233 WO-A1-2008077618 US-A-5691373 WO-A2-0198291
(57) Настоящее изобретение относится к 1,3-дифенилпроп-2-ен-1-оновым производным и содержащим их фармацевтическим композициям для лечения заболеваний печени, в частности заболеваний, требующих снижения концентрации в плазме биохимических маркеров, таких как аминотрансферазы. 1,3-Дифенилпроп-2-ен-1-оновые производные общей формулы (I) обладают гепатопротекторными свойствами, и их можно применять в способе лечения заболеваний печени, включая патологическое разрушение, воспаление, дистрофию и/или пролиферацию клеток печени, таких как фиброз печени или жировой гепатоз.
Область техники, к которой относится настоящее изобретение
Настоящее изобретение относится к применению соединений, обладающих гепатопротекторными свойствами, для получения фармацевтических композиций и к способам для лечения заболеваний печени.
Уровень техники
Согласно терапевтическому справочнику Вашингтонского университета (31 издание; 2004; Lippin-cott Williams & Wilkins) заболевания печени можно разделить на различные группы заболеваний, в частности вирусные заболевания, заболевания печени, связанные с наркотическими веществами или алкоголем, заболевания печени, обусловленные иммунитетом, метаболические заболевания печени, смешанные заболевания, такие как неалкогольная жировая дистрофия печени, и осложнения печеночной недостаточности (такие как скоротечная печеночная недостаточность или гепатоцеллюлярная карцинома) и трансплантации печени.
В частности, неалкогольная жировая дистрофия печени (NAFLD) представляет собой обычное заболевание печени с гистологическими особенностями жирового гепатоза, вызванного алкоголем, у индивидуумов, которые потребляют небольшое количество или не употребляют алкоголь (Yen M. et al., 2007; Marchesini G. et al., 2003). NAFLD является результатом нарушенного удерживания липидов в клетках (обычно определяемого как стеатоз), осложнение, более частое в печени, поскольку данный орган является в первую очередь ответственным за метаболизм липидов. NAFLD имеет спектр гистологических форм, включая стеатоз печени и неалкогольный стеатогепатит (NASH), который характеризуется воспалением печени, стеатозом, некрозом и фиброзом в результате разрушения клеток печени. Заболевания, связанные с NAFLD, варьируются и включают диабет 2 типа, ожирение, дислипидемию, метаболический синдром, лечение гепатотоксическими лекарственными средствами, воздействие токсинов, инфекционных агентов или других экзогенных причин.
Хотя NAFLD обычно возникает в результате мягкого, непрогрессирующего течения болезни, NASH представляет собой потенциально серьезное заболевание; у вплоть до 25% пациентов может развиваться фиброз в прогрессирующей стадии, цирроз, и они могут претерпевать осложнения портальной гипертен-зии, печеночной недостаточности и гепатоклеточной карциномы, которая делает раннюю и правильную оценку обязательной (Yen M et al., 2007).
Системы визуализации печени являются пригодными для оценки также структуры печени и наличия стеатоза. Однако биопсия печени остается золотым стандартом для оценки фиброза печени, но данный способ анализа нельзя осуществлять для каждого единичного исследования из-за его инвазивности. Неинвазивную оценку биохимии и метаболизма в печени часто проводят для определения заболеваний печени, таких как NAFLD и NASH (Gressner A. et al., 2009; Vuppalanchi R. and Chalasani N., 2009). Применяя плазму, высокие концентрации ферментов, таких как аланинаминотрансфераза (ALAT), аспарта-таминотрансфераза (ASAT), щелочная фосфатаза (АР) и/или гамма-глутамилпептидаза (GGT), а также наличие других белков печеночного происхождения (включая гаптоглобин, общий билирубин, альфа-2-микроглобулин, резистин, расщепленный или интактный цитокератин-18) обычно измеряют в добавление к глюкозе в сыворотке и параметрам устойчивости к инсулину. Поскольку степень ALAT активности часто увеличивается у NASH пациентов (Angulo P. et al., 2002), данный критерий считают суррогатным маркером для оценки поражения печени. Действительно, надежные неинвазивные способы недоступны для правильного диагностирования NAFLD или NASH, и даже гистологические особенности не всегда являются достаточными для того, чтобы правильно отличить NAFLD или NASH от других заболеваний, таких как алкогольная болезнь печени (Yen M. et al., 2007, Vuppalanchi R. and Chalasani N., 2009).
Способы эффективного лечения фиброза печени, в частности NAFLD и NASH, все еще являются недостаточными. Не разработан способ лечения пациентов с NASH, и несколько возможных способов лечения проходят клинические испытания (Vuppalanchi R. and Chalasani N., 2009, Dowman J.K. et al., 2009). Данные исследования включают применение многих различных семейств химических соединений (фибраты, тиазолидиндионы, бигуаниды, статины, каннабиноиды) и мишеней для терапевтического воздействия (ядерные рецепторы, рецепторы ангиотензина, каннабиноидные рецепторы, HMG-CoA редук-таза). Недавно исследования с применением тиазолидиндионов (розиглитазона и пиоглитазона) показали, что данные лекарственные средства могут улучшать состояние печени, но лечение данными лекарственными средствами сопровождается побочными эффектами, такими как высокий риск застойной сердечной недостаточности и остеопороза, а также набором веса с физиологическими эффектами на пациента (Dowman J.K. et al., 2009; Shiri-Sverdlov R. et al., 2006; Neuschwander-Tetri et al., 2003). Клинические испытания, включающие введение каннабиноидов, повышают вероятность невропсихиатрического нарушения (Vuppanchi R. and Chalasani N., 2009). Другие существующие в настоящее время терапии стремятся к оценке NASH лекарственных средств в качестве антиоксидантов, но ни один из данных способов лечения еще не дал убедительных результатов (Nelson A. et al., 2009).
Необходимость в новых терапевтических способах для регулирования заболеваний печени, в частности заболеваний, включающих фиброз и/или стеатоз печени, остается ясной и неотложной.
Сущность настоящего изобретения
Клинические исследования неожиданно показали, что лечение пациентов 1,3-дифенилпроп-2-ен-1
оновым производным обеспечивает статистически релевантное снижение специфических для печени биохимических маркеров в плазме, демонстрируя гепатопротекторные свойства семейства соединений, которые определены посредством общей формулы (I).
Настоящее изобретение обеспечивает новыми 1,3-дифенилпроп-2-ен-1-оновыми производными общей формулы (I) (причем упомянутые производные в другом месте также называют "соединениями") или содержащими их фармацевтическими композициями для применения в способе лечения заболеваний печени, в частности заболеваний, которые приводят к увеличению концентрации в плазме биохимических маркеров, таких как аминотрансферазы. 1,3-Дифенилпроп-2-ен-1-оновые производные общей формулы (I) и содержащие их фармацевтические композиции обладают гепатопротекторными свойствами, и их можно применять в способах лечения заболеваний печени, включающих патологическое разрушение, воспаление, дистрофию и/или пролиферацию клеток печени, такие как фиброз, жировой гепатоз и неалкогольный стеатогепатит.
Дополнительные цели настоящего изобретения, включающие конкретные общие формулы соответствующих соединений, приводятся в подробном описании.
Описание чертежей
Сокращения, применяемые в фигурах и в тексте
ALAT = аланинаминотрансфераза
CCL5 = хемокиновый (С-С мотив) лиганд 5
Col1a1 = коллаген, тип I, альфа 1
Cpd 1 = соединение 1 WO 2007/147879
Cpd 29 = соединение 29 WO 2004/005233
Ctrl = контроль или пустышка
Feno = фенофибрат
HDL = липопротеин высокой плотности
LDL = липопротеин низкой плотности
NAFLD = неалкогольная жировая дистрофия печени
NASH = неалкогольный стеатогепатит
PPAR = рецептор, активируемый пролифератором пероксисом Rosi = розиглитазон
RT-PCR = полимеразная цепная реакция с обратной транскриптазой
TGFp = трансформирующий ростовой фактор бета
TNFa = фактор некроза опухоли альфа
Фиг. 1. Структура типичных соединений общей формулы (I)
Типичные соединения общей формулы (I) группируют согласно более конкретным определениям общей формулы (II) (панель А), общей формулы (IV) (панель В) и общей формулы (V) (панель С).
Фиг. 2. In vivo оценка на ob/ob мышах противовоспалительных свойств соединений общей формулы
(I)
Соединения общей формулы (I) испытывали на мышиной модели диабета II типа, ob/ob мыши. Мышам ежедневно перорально вводили соединение 29 WO 2004/005233 при двух различных дозах (10 и 30 мг/кг/день) и прототипные PPARальфа- и PPARгамма-специфические референсные соединения (фе-нофибрат при 100 мг/кг/день и розиглитазон при 10 мг/кг/день, соответственно). Через 26 дней лечения животных умерщвляли и собирали образцы плазмы и печени. Оценивали экспрессию в печени генов, о которых известно, что они вовлечены в процессы воспаления печени, и измеряли плазматические концентрации ALAT (панели А-С). Статистический анализ проводили, применяя двухвыборочный Т-критерий для независимых выборок с тремя р величинами, который определяет статистическую релевантность (*обозначает р <0,05; **обозначает р <0,01; ***обозначает р <0,001).
Фиг. 3. In vivo оценка на hApoE2 KI мышах противовоспалительных и антифиброзных свойств соединений общей формулы (I)
Соединения общей формулы (I) испытывали in vivo на мышиной модели с рационом с высоким содержанием жиров. Дислипидемических "гуманизированных" АроЕ2 активированных мышей (hApoE2 KI) держали на западной диете и обрабатывали в течение 12 недель. Соответствующие соединения, включая соединение 29 WO 2004/005233 при 0,3 мг/кг/день и фенофибрат при 100 мг/кг/день (применяемого в качестве референтного соединения), вводили в рацион. В конце протокола животных умерщвляли, отделяли печень и оценивали экспрессию в печени генов, о которых известно, что они участвуют в процессах воспаления печени и фиброзе количественной RT-PCR (панели A-D). Статистический анализ осуществляли, как показано на фиг. 1.
Фиг. 4. In vivo оценка на hApoE2 KI и на hApoE2 KI/PPAR альфа KO мышах противовоспалительных и антистеатозных свойств соединений общей формулы (I)
Соединения общей формулы (I) испытывали in vivo на моделях мышей с рационом с высоким содержанием жиров. Дислипидемических "гуманизированных" hApoE2 KI, PPAR альфа-дефицитных мышей держали на западной диете и обрабатывали в течение 6 недель. Соответствующие соединения,
включая соединение 29 WO 2004/005233 при 30 мг/кг/день и соединение 1 WO 2007/147879 при 30 мг/кг/день, принудительно вводили перорально. В конце протокола животных умерщвляли, отделяли печень и оценивали экспрессию в печени генов, о которых известно, что они участвуют в процессах воспаления печени и фиброзе количественной RT-PCR. Параллельно оценивали содержание триглицеридов в печени (панели A-D). Статистический анализ осуществляли, как показано на фиг. 1.
Подробное описание настоящего изобретения
Настоящее изобретение относится к новым терапевтическим применениям и способам введения 1,3-дифенилпроп-2-ен-1-оновых производных общей формулы (I) и содержащих их фармацевтических композиций для лечения заболевания печени. Конкретные 1,3-дифенилпроп-2-ен-1-оновые производные, которые замещены по обеим фенильным группам, можно определить согласно примерам как являющиеся пригодными для лечения заболеваний печени, поскольку данные соединения уменьшают неожиданным способом специфические маркеры воспаления печени, а также разрушения, дистрофии и/или пролиферации клеток печени у людей и в животных моделях и, таким образом, они обеспечивают гепато-протекторным эффектом.
Соединения, которые будут применять и вводить согласно настоящему изобретению и которые содержатся в композициях согласно настоящему изобретению, имеют следующую общую формулу (I):
в которой X1 представляет собой галоген, R1 или группу G1-R1; А представляет собой СН=СН или группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы;
R1 представляет собой атом водорода, незамещенную алкильную группу, арильную группу или ал-кильную группу, которая замещена одним или более атомами галогена, алкокси или алкилтиогруппу, циклоалкильные группы, циклоалкилтиогруппы или гетероциклические группы;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами или гетероциклическими группами.
R4 и R5, одинаковые или различные, представляют собой алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами, гетероциклическими группами.
В конкретном варианте осуществления соединения общей формулы (I) замещают, по меньшей мере, алкилоксигруппой или алкилтиогруппой в X1 и Х2 положениях. Более того, производные могут быть в виде замещенных 1,3-дифенилпропанонов, которые получают восстановлением соответствующих 1,3-дифенилпроп-2-ен-1-оновых производных.
В конкретном варианте осуществления X1 представляет собой группу G1-R1, более предпочтительно G1 представляет собой атом серы, и R1 представляет собой линейную или разветвленную алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами, гетероциклическими группами. Даже более предпочтительно X1 представляет собой алкилтио-группу, которая содержит алкильную группу, которая является линейной или разветвленной, содержащей от одного до семи атомов углерода, которая замещена или не замещена одним или более атомами галогена. В предпочтительном варианте осуществления X1 представляет собой метилтиогруппу.
В конкретном варианте осуществления Х2 представляет собой группу G2-R2, в которой G2 представляет собой атом кислорода, и R2 представляет собой алкильную группу, замещенную -COOR3 группой, в которой R3 представляет собой атом водорода или незамещенную линейную или разветвленную алкильную группу, содержащую от одного до семи атомов углерода, более предпочтительно от одного до четырех атомов углерода. В предпочтительном варианте осуществления и R4, и R5 представляют собой метильные группы.
Более того, R4 и R5, одинаковые или различные, являются предпочтительно незамещенными линейными разветвленными, алкильными группами, содержащими от одного до семи атомов углерода, более предпочтительно от одного до четырех атомов углерода.
В контексте настоящего изобретения термин "алкил" относится к насыщенному углеводородному радикалу, который является линейным или разветвленным, содержащим предпочтительно от одного до двадцати четырех, даже более предпочтительно от одного до семи атомов углерода, такому как метил, этил, н-пропил, изопропил, н-бутил, изобутил, трет-бутил, втор-бутил, пентил, неопентил или н-гексил.
Термин "алкилокси" относится к алкильной группе, которая соединена с остатком соединения через атом кислорода.
Термин "алкилтио" относится к алкильной группе, которая соединена с остатком соединения через атом серы (тиоэфирная связь).
Термин "циклоалкил" обозначает алкильную группу, которая образует один цикл, содержащий от трех до четырнадцати атомов углерода, более предпочтительно от трех до восьми атомов углерода, такую как циклопропил, циклобутил, циклопентил, циклогексил, циклогептил и циклооктил.
Термин "циклоалкилтио" относится к циклоалкильной группе, которая соединена с остатком соединения через атом серы (тиоэфирная связь).
Термин "арил" обозначает ароматическую группу, замещенную или не замещенную, содержащую предпочтительно от шести до четырнадцати атомов углерода, такую как фенил, а-нафтил, b-нафтил, би-фенил или антраценил.
Термин "гетероцикл" относится к гетероциклоалкильной группе или гетероарильной группе.
Термин "гетероциклоалкильная" группа относится к циклоалкилу, как показано выше, который дополнительно содержит один или несколько гетероатомов, выбранных из азота, кислорода или серы. Они обычно содержат от четырех до четырнадцати атомов углерода, такие как морфолинил, пиперидинил, тетрагидропиранил, дитиоланил.
Термин "гетероарил" относится к арильной группе, как показано выше, которая дополнительно содержит один или несколько гетероатомов, выбранные из азота, кислорода или серы. Они обычно содержат от четырех до четырнадцати атомов углерода, такие как фуранил, тиофенил, пиридинил, пиримиди-нил, хинолинил, ихохинолинил.
Под атомом галогена понимают атом брома, хлора, фтора или йода.
Различные семейства 1,3-дифенилпроп-2-ен-1-оновых производных и 1,3-дифенилпропанонов, которые замещены по обеим фенильным группам, можно найти на предшествующем уровне техники (WO 2003/037315, WO 2001/046110, JP 2006-303800, JP 04-202129). Однако ни один из данных документов не показал, что специфические гепатопротекторные эффекты связаны с соединениями, как определено общей формулой (I).
Структура, получение и некоторые активности соединений, которые охватываются общей формулой (I), описаны в ряде патентных заявок (WO 2004/005243, WO 2004/005233, WO 2005/005369, US 20070032543, WO 2005/073184, WO 2007/147879 и WO 2007/147880), которые не описывают применение данных соединений в способах лечения заболеваний печени.
Конкретные 1,3-дифенилпроп-2-ен-1-оновые производные общей формулы (I), которые можно применять в настоящем изобретении и которые могут содержаться в композициях согласно настоящему изобретению, можно выбрать из соединений, описанных в WO 2004/005243 и WO 2004/005233, в частности
1-[4-хлорфенил]-3-[3,5-димети^-4-изопропилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 15;
1 - [4-хлорфенил] -3-[3,5 -диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил] проп-2 -ен-1-она, описанного как соединение 16;
1-[4-хлорфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 17;
1-[4-метилтиофенил]-3-[3,5-димети^-4-ттрет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 27;
1-[4-метилтиофенил]-3-[3,5-димети^-4-изопропилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 28;
1-[4-метилтиофенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 29;
1-[4-гексилоксифенил] -3-[3,5 -диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1 -она, описанного как соединение 32;
1-[4-гексилоксифенил] -3-[3,5 -диметил-4-карбоксидиметилметилоксифенил] проп-2-ен-1 -она, описанного как соединение 33;
1-[4-гептилфенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 38;
1-[4-гептилфенил] -3 -[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, описанного как соединение 39;
1-[4 -бромфенил] -3-[3,5 -диметил-4 -трет-бутилоксикарбонилдиметилметилоксифенил] проп-2 -ен-1-она, описанного как соединение 40;
1-[4-бромфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-она, описанного как соединение 41.
В следующем варианте осуществления настоящего изобретения соединения, как описано в WO 2004/005243 и WO 2004/005233 (называемые в настоящем изобретении соединениями общей формулы (II)), которые можно применять и вводить и которые содержатся в композициях согласно настоящему изобретению, имеют следующую общую формулу (I):
в которой X1 представляет собой галоген, R1 или группу G1-R1; А представляет собой группу СН=СН; Х2 представляет собой группу G2-R2;
G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы;
R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода, причем, в частности, алкильная или циклоалкильная группа замещена или не замещена одним или более атомами галогена;
R2 представляет собой алкильную группу, замещенную -COOR3 группой, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода.
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
WO 2005/005369 и US 20070032543 также описывают структуру и альтернативный способ получения соединений согласно общей формуле (I), а также общей формулы (II), в частности
1-[4-трифторметилфенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-
2-ен-1-он (соединение 57 US 20070032543);
1-[4-трифторметилфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-он (соединение 58 US 20070032543);
1-[4-трифторметилоксифенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]
проп-2-ен-1-он (соединение 61 US 20070032543);
1-[4-трифторметилоксифенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-он
(соединение 62 US 20070032543).
Дополнительные примеры соединений, которые будут применять и вводить и которые могут содержаться в композициях согласно настоящему изобретению, можно выбрать из соединений, описанных в WO 2005/073184, в частности
1-(4-(пентилтиоэтилокси)фенил)-3-(4-трет-бутилоксикарбонилдиметилметилокси-3,5-диметилфе-нил)проп-2-ен-1-она, описанного как соединение 1;
1-(4-(пентилтиоэтилокси)фенил)-3-(4-карбоксидиметилметилокси-3,5-диметилфенил)проп-2-ен-1-она, описанного как соединение 2;
1 -(4-((R, S)-5-[1,2]дитиолан-3 -илпентилокси)фенил)-3 -(4-трет-бутилоксикарбонилдиметилметило-кси-3,5-диметилфенил) проп-2-ен-1-она, описанного как соединение 5;
1 -(4-((R, S)-5-[1,2]дитиолан-3 -илпентилокси)фенил)-3 -(4-карбоксидиметилметилокси-3,5-диметил-фенил)проп-2-ен-1-она, описанного как соединение 6;
1-(4-циклогексилэтилоксифенил)-3 -(4-трет-бутилоксикарбонилдиметилметилокси-3,5-диметилфе-нил)проп-2-ен-1-она, описанного как соединение 10;
1-(4-циклогексилэтилоксифенил)-3 -(4-карбоксидиметилметилокси-3,5-диметилфенил)проп-2-ен-1-она, описанного как соединение 11;
1-(4-циклогексилтиоэтилоксифенил)-3-(4-трет-бутилоксикарбонилдиметилметилокси-3,5-диметил-фенил)проп-2-ен-1-она, описанного как соединение 22;
1-(4-циклогексилтиоэтилоксифенил)-3-(4-карбоксидиметилметилокси-3,5-диметилфенил)проп-2-ен-1-она, описанного как соединение 23;
1-(4-фенилоксифенил)-3-(4-трет-бутилоксикарбонилдиметилметилокси-3,5-диметилфенил)проп-2-ен-1-она, описанного как соединение 32;
1-(4-фенилоксифенил)-3-(4-карбоксидиметилметилокси-3,5-диметилфенил)проп-2-ен-1-она, описанного как соединение 33.
в которой X1 представляет собой группу G1-R1;
А представляет собой группу СН=СН;
Х2 представляет собой группу G2-R2;
G1 и G2 представляют собой атом кислорода;
R1 представляет собой циклоалкильную, арильную или алкильную группу, которая замещена или
В следующем варианте осуществления настоящего изобретения соединения, как описано в WO 2005/073184 (называемые в настоящем изобретении соединениями общей формулы (III)), которые можно применять и вводить и которые могут содержаться в композициях согласно настоящему изобретению, имеют следующую общую формулу (I):
не замещена одним или более алкилтио, циклоалкильной, циклоалкилтиогруппами, или гетероциклоал-кильными группами, или алкилтиогруппой;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода;
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
Дополнительные примеры соединений, применяемых и вводимых согласно настоящему изобретению и которые могут содержаться в композициях согласно настоящему изобретению, можно выбрать из соединений, описанных в WO 2004/005243, WO 2004/005233, WO 2005/005369, US 20070032543 или WO 2005/073184, и восстановить до формы соответствующих замещенных 1,3-дифенилпропанонов.
Соответственно, соединения, которые можно применять и вводить согласно настоящему изобретению и которые могут содержаться в композициях согласно настоящему изобретению, можно выбрать из соединений, описанных в WO 2007/147879, в частности
2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты, описанной как соединение 1;
2-[2,6-диметил-4-[3-[4-(метокси)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты, описанной как соединение 6;
2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]этановой кислоты, описанной как соединение 7;
2-[2,6-диметил-4-[3-[4-(пропилокси)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты, описанной как соединение 8;
изопропилового эфира 2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метил-пропионовой кислоты, описанного как соединение 13.
В следующем варианте осуществления настоящего изобретения соединения, как описано в WO 2007/147879 (называемые в настоящем изобретении соединениями общей формулы (IV)), которые можно применять и вводить и которые могут содержаться в композициях согласно настоящему изобретению, имеют следующую общую формулу (I):
в которой X1 представляет собой R1 или группу G1-R1; А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группу -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода;
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
Аналогично WO 2007/147879, WO 2007/147880 описывают соединения, которые могут содержаться в композициях согласно настоящему изобретению, которые соответствуют восстановленным, замещенным 1,3-дифенилпропаноновым производным соединений, которые описываются в WO 2004/005243, WO 2004/005233, WO 2005/005369, US 20070032543 или WO 2005/073184, в частности
2-[2,6-диметил-4-[3-[4-(трифторметилокси)фенил]-3-оксопропил]фенокси]-2-метилпропионовую кислоту, описанную как соединение 1;
2-[2,6-диметил-4-[3-[4-(трифторметилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовую кислоту, описанную как соединение 2;
2-[2,6-диметил-4-[3-[4-бромфенил]-3-оксопропил]фенокси]-2-метилпропионовую кислоту, описанную как соединение 3;
2-[2,6-диметил-4-[3-[4-(трифторметил)фенил]-3-оксопропил]фенокси]-2-метилпропионовую кислоту, описанную как соединение 4;
2-[2,6-диметил-4-[3-[4-(3,3,3-трифторпропилокси)фенил]-3-оксопропил]фенокси]-2-метилпропио-новую кислоту, описанную как соединение 11;
2-(2,6-диметил-4-(3-оксо-3-(4-(2,2,2-трифторэтокси)фенил)пропил)фенокси)-2-метилпропионовую кислоту, описанную как соединение 12;
2-(2,6-диметил-4-(3-оксо-3-(4-(2,2,2-трифторэтилтио)фенил)пропил)фенокси)-2-метилпропионовую кислоту, описанную как соединение 13;
2-(2,6-диметил-4-(3-оксо-3-(4-(трифторметокси)фенил)пропил)фенокси)пропионовую кислоту, описанную как соединение 29;
4-(2,6-диметил-4-(3-оксо-3-(4-(трифторметокси)фенил)пропил)фенокси)-2,2-диметилбутановую кислоту, описанную как соединение 34;
трет-бутиловый эфир 2-(2,6-диметил-4-(3-оксо-3-(4-(трифторметокси)фенил)пропил)фенокси)-2-метилпропионовой кислоты, описанный как соединение 35;
изопропиловый эфир 2-(2,6-диметил-4-(3-оксо-3-(4-(трифторметокси)фенил)пропил)фенокси)-2-метилпропионовой кислоты, описанный как соединение 36;
2,2-дифтор-2-(2,6-диметил-4-(3-оксо-3-(4-(трифторметокси)фенил)пропил)фенокси)уксусную кислоту, описанную как соединение 37.
В следующем варианте осуществления настоящего изобретения соединения, как описано в WO 2007/147880 (называемые в настоящем изобретении соединениями согласно общей формуле (V)), которые можно применять и вводить и которые могут содержаться в композициях согласно настоящему изобретению, имеют следующую общую формулу (I):
в которой X1 представляет собой атом галогена или R1 или группу G1-R1; А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, которая замещена одним или более атомами галогена;
R2 представляет собой алкильную группу, замещенную или не замещенную одним или более атомами галогена и замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода.
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
Соединения, которые можно наиболее предпочтительно применять и вводить согласно настоящему изобретению и которые могут содержаться в композициях согласно настоящему изобретению, представляют собой соединения, определенные согласно общей формуле (II), общей формуле (IV) или общей формуле (V), в частности
1-[4-метилтиофенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1 -он (соединение 29 WO 2004/005233);
1-[4-метилтиофенил]-3-[3,5-диметил-4-изопропилоксикарбонилдиметилметилоксифенил]проп-2-ен-
1- он (соединение 28 WO 2004/005233);
1-[4-метилтиофенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-
ен-1-он (соединение 27 WO 2004/005233);
1-[4-трифторметилфенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-
2- ен-1-он (соединение 57 US 20070032543);
1-[4-трифторметилфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-он (соединение 58 US 20070032543);
1-[4-трифторметилоксифенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]
проп-2-ен-1-он (соединение 61 US 20070032543);
1- [4-трифторметилоксифенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-он
(соединение 62 US 20070032543);
2- [2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовая кислота (соединение 1 WO 2007/147879);
изопропиловый эфир 2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпро-пионовой кислоты (соединение 13 WO 2007/147879);
2-[2,6-диметил-4-[3-[4-(трифторметилокси)фенил]-3-оксопропил]фенокси]-2-метилпропионовая кислота (соединение 1 WO 2007147880);
2-[2,6-диметил-4-[3-[4-(трифторметилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовая кислота (соединение 2 WO 2007147880);
трет-бутиловый эфир 2-(2,6-диметил-4-(3-оксо-3-(4-(трифторметилокси)фенил)пропил)фенокси)-2-метилпропионовой кислоты (соединение 35 WO 2007147880).
Настоящее изобретение обеспечивает специфические применения соединений общей формулы (I) и соответствующие содержащие их фармацевтические композиции. Соединения могут быть или не быть в форме фармацевтически приемлемой соли, и их применяют в терапевтически эффективном количестве для лечения заболевания печени. Любое соединение, которое определено согласно общей формуле (II),
общей формуле (III), общей формуле (IV) или общей формуле (V), причем данные формулы включены в общую формулу (I), можно применять в настоящем изобретении для лечения заболеваний печени, в частности, в форме фармацевтических композиций, которые содержат указанное соединение.
Настоящее изобретение также относится к способу лечения заболевания печени, включающему введение нуждающемуся субъекту соединения общей формулы (I), в которой
X1 представляет собой галоген, R1 или группу G1-R1;
А представляет собой СН=СН или группу СН2-СН2;
Х2 представляет собой группу G2-R2;
G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы;
R1 представляет собой атом водорода, незамещенную алкильную группу, арильную группу или ал-кильную группу, которая замещена одним или более атомами галогена, алкокси или алкилтиогруппой, циклоалкильными группами, циклоалкилтиогруппами или гетероциклическими группами;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильной группой, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами или гетероциклическими группами;
R4 и R5, одинаковые или различные, представляют собой алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами, гетероциклическими группами.
Композиции, содержащие соединения, в которых X1, Х2, А, G1, G2, R1, R2, R3, R4 и R5 определяют согласно общей формуле (II), общей формуле (III), общей формуле (IV) или общей формуле (V), можно также применять для осуществления способа лечения заболеваний печени.
Термин "заболевание печени" включает любое заболевание, оказывающее влияние на печень, и, в частности, любое острое или хроническое заболевание печени, которое включает патологическое разрушение, воспаление, дистрофию и/или пролиферацию клеток печени. В частности, заболевание печени представляет собой фиброз печени, цирроз печени или любое другое заболевание печени, при котором концентрация в плазме некоторых маркеров гепатоцеллюлярного повреждения, изменения или некроза, увеличивается при сравнении с нормальными концентрациями в плазме. Данные биохимические маркеры, связанные с активностью и состоянием печени, можно выбрать из маркеров, описанных в литературе, в частности аланинаминотрансферазы (ALAT), аспартатаминотрансферазы (ASAT), щелочной фос-фатазы (АР), гамма-глутамилтранспептидазы (GGT), цитокератина-18 (CK-18) или резистина. В конкретном варианте осуществления заболевание печени представляет собой жировой гепатоз, при котором повышение концентрации одного или более данных маркеров связано, до некоторой степени, со стеато-зом в печени, как это может быть подтверждено биопсией печени. Неполный перечень жирового гепато-за включает NAFLD, NASH и жировой гепатоз, связанный с заболеваниями, такими как гепатит или метаболический синдром (ожирение, резистентность к инсулину, гипертриглицеридемия и подобные).
Термин "гепатозащита" или "гепатопротекторный" относится к способности соединения снижать, обращать или предотвращать повреждение печени, в частности, снижением, обращением или предотвращением патологического нарушения, воспаления, дистрофии и/или пролиферации клеток печени, таких как гепатоциты.
Термин "лечение" или "лечить" относится к терапии, предотвращению и профилактики заболевания, в частности заболевания печени. Лечение включает введение соединения или фармацевтической композиции пациенту, страдающему от описанного заболевания, для лечения, задержки или замедления развития, таким образом, улучшая состояние пациентов. Лечение можно также осуществлять на здоровых субъектах, которые подвержены риску развития заболевания печени.
В контексте настоящего изобретения термин "субъект" обозначает млекопитающее и, более в частности, человека. Субъектов, которых подвергают лечению согласно настоящему изобретению, можно подходящим образом выбрать на основе нескольких критериев, связанных с заболеванием печени, таких как предшествующее лечение лекарственными средствами, связанные патологии, генотип, воздействие факторов риска, вирусная инфекция, а также любого другого релевантного маркера, который можно оценить посредством иммунологических, биохимических, ферментативных, химических способов обнаружения или способов обнаружения нуклеиновых кислот. В конкретном варианте осуществления субъект представляет собой пациента с повышенным весом (в частности, предиабетического или диабетического пациента с повышенным весом) или пациента с ожирением, страдающего от атерогенной дислипидемии. Действительно, данные пациенты подвержены риску развития заболевания печени, в частности NAFLD или NASH. Изобретатели показали, что соединения, как определено выше, оказывают благоприятный эффект на функции печени данных пациентов.
Соединения общей формулы (I) могут содержать один или несколько асимметрических центров. Когда требуется энантиомерно чистое (или обогащенное) соединение, его можно получить или очисткой конечного продукта или хиральных промежуточных соединений, или асимметрическим синтезом, следуя стандартным способам, известным специалистам в данной области техники (например, применяя реагенты и хиральные катализаторы). Некоторые из данных соединений могут иметь различные стабильные таутомерные формы. Настоящее изобретение включает применение стереоизомеров (диастереоизомеров,
энантиомеров), чистых или в смеси, а также рацемических смесей и геометрических изомеров соединений общей формулы (I).
Соединения общей формулы (I) можно формулировать в виде "фармацевтически приемлемых" солей, являющихся практически нетоксичными или нетоксичными солями, полученными из органических или неорганических оснований или кислот соединений общей формулы (I). Данные соли можно получить на конечной стадии очистки соединения или введением соли в ранее очищенное соединение.
Фармацевтические композиции, содержащие соединение общей формулы (I), для лечения заболеваний печени могут содержать один или несколько вспомогательных веществ или сред, приемлемых в данном фармацевтическом контексте (например, соляные растворы, физиологические растворы, изотонические растворы и т.д., совместимые с фармацевтическим применением и хорошо известные специалистам в данной области техники). Данные композиции могут содержать один или более агентов или сред, выбранных из диспергирующих агентов, солюбилизаторов, стабилизаторов, консервантов и т.д. Агенты или среды, пригодные для данных рецептур (жидкие, и/или инъецируемые, и/или твердые), представляют собой, в частности, метилцеллюлозу, гидроксиметилцеллюлозу, карбоксиметилцеллюлозу, полисорбат 80, маннит, желатин, лактозу, растительные масла, аравийскую камедь, липосомы и т.д. Данные композиции можно формулировать в форме инъецируемых суспензий, гелей, масел, пилюль, суппозиториев, порошков, гелевых капсул, капсул, аэрозолей и т.д., в конечном счете, посредством галеновых форм или устройств, обеспечивающих продолжительное и/или медленное высвобождение. Для данного типа составов можно преимущественно применять агенты, такие как целлюлоза, карбонаты или крахмалы.
Соединения общей формулы (I) следует вводить в эффективном количестве соединения, применяя фармацевтическую композицию, как определено выше. В контексте настоящего изобретения термин "эффективное количество" относится к количеству соединения, достаточному для того, чтобы получить требуемый терапевтический результат.
Соединения общей формулы (I) можно вводить различными способами и в различных формах, которые обеспечивают введение упомянутых соединений в терапевтически эффективных количествах. Таким образом, например, их можно вводить системным способом, через рот, парентерально, ингаляцией или инъекцией, такой как, например, внутривенным, внутримышечным путем, подкожным путем, транс-дермальным путем, интраартериальным путем и т.д. Пероральное введение является предпочтительным путем введения фармацевтических композиций, содержащих соединение общей формулы (I), для лечения заболеваний печени.
Частота и/или доза, связанная с введением, может регулироваться специалистом в данной области техники в зависимости от пациента, патологии, формы введения и т.д. Обычно соединения общей формулы (I) можно вводить для лечения заболеваний печени при дозах, изменяющихся между 0,01 мг и 1 г на введение, предпочтительно от 1 до 100 мг на введение. Введение можно осуществлять ежедневно или даже несколько раз в день, при необходимости.
Соединения и композиции настоящего изобретения можно предпочтительно вводить в комбинации с другими терапевтическими агентами, в настоящее время имеющимися в продаже на рынке или разрабатывающимися для лечения метаболических заболеваний и/или заболеваний печени, такими как мет-формин, инсулин, тиазолидиндионы, глитазоны, статины, ингибиторы холестерина и/или другими лекарственными средствами, снижающими количество липидов.
В следующем варианте осуществления настоящее изобретение обеспечивает способы лечения заболеваний печени, включающие введение соединения общей формулы (I), в частности в форме фармацевтических композиций, содержащих данные соединения. Данные способы могут включать введение любого соединения, которое определено согласно общей формуле (II), общей формуле (III), общей формуле (IV) или общей формуле (V).
Соединения и композиции настоящего изобретения обеспечивают полезным терапевтическим инструментом для лечения заболеваний печени и, в частности, жирового гепатоза, включая NAFLD и NASH, благодаря гепатопротекторным эффектам соединений общей формулы (I). В частности, данные соединения можно выбрать из соединений, в которых X1, Х2, A, G1, G2, R1, R2, R3, R4 и R5 определяют согласно общей формуле (II), общей формуле (III), общей формуле (IV) или общей формуле (V). Дополнительная цель настоящего изобретения относится к соединению общей формулы (I), как описано выше и, в частности, общей формулы (II), (III), (IV) и (V), для применения в способе лечения заболеваний печени. В конкретном варианте осуществления конкретные заболевания печени, которые предполагается лечить, представляют собой заболевания, описанные выше, такие как фиброз печени или жировой гепа-тоз. В еще другом варианте осуществления соединения для применения в упомянутых способах представляют собой соединения, специально описанные выше.
В общем, специфические по отношению к печени свойства соединений общей формулы (I) можно оценить у конкретной популяции пациентов, представляющей заболевание печени, такое как NAFLD и/или NASH, при включении. Например, двойное анонимное, плацебо-контролируемое и рандомизированное исследование может оценивать эффективность перорального введения соединения (при дозе 80 мг/день или более) в течение 3-12 месяцев у субъектов, которым был поставлен диагноз NAFLD (только стеатоз) и/или NASH (стеатоз и фиброз) и у которых присутствуют повышенные концентрации ами
нотрансфераз. Любое статистически релевантное улучшение основных биохимических параметров (таких как снижение концентрации аминотрансфераз, GGT и/или цитокератины-18 и/или снижение концентрации резистина), объема стеатоза печени, измеренного способами получения изображений, или гистологических особенностей биопсии печени (измерение стеатоза, воспаления печени и фиброза) можно регулярно оценивать у данных пациентов в процессе исследования (на месячной или более частой основе). Дополнительные параметры, такие как общий/LDL-/HDL-холестерин, гиподинамические параметры, индекс массы тела, резистентность к инсулину, маркеры воспалительного или оксидативного стресса, инсулин и глюкоза в плазме, маркеры почечной функции в моче, визуализация печени MRI и/или гисто-морфология при биопсии печени, можно также измерять в процессе исследования и/или в конце исследования для получения профилей эффективности соединений для лечения заболеваний печени.
Все ссылки, приводимые в настоящем изобретении, вводятся полностью с помощью ссылки. Имея полностью описанное настоящее изобретение, специалистам в данной области техники ясно, что настоящее изобретение можно осуществлять на практике в пределах широкого и эквивалентного диапазона условий, параметров и подобных, не выходя за объем или сущность настоящего изобретения или любые его варианты осуществления. Несколько других преимуществ настоящего изобретения будут возникать при чтении следующих примеров; их следует рассматривать как иллюстративные данные и неограничивающие примеры.
Примеры
Пример 1. Воздействия соединений общей формулы (I) на специфические для печени биохимические показатели
Материалы и методы
1-[4-Метилтиофенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-он (соединение 29 WO 2004/005233) формулировали в виде капсул с твердой оболочкой, содержащих 5, 10 или 20 мг соединения. Соединение (80 мг) вводили перорально один раз в день в течение 28 дней. Исследование проводили в двух параллельных группах в двойных анонимных условиях: плацебо или соединение 29
WO 2004/005233.
Переносимость и безопасность введения один раз в день, а также эффективность улучшения гомео-стаза липидов и глюкозы в плазме, оценивали в двух пилотных испытаниях, применяя релевантные биохимические параметры. Данные применяли для расчета процента изменений благодаря соединению, при сравнении с плацебо после 28-дневного лечения.
Результаты и выводы
Первое пилотное, двойное анонимное, плацебо-контролируемое, рандомизированное исследование осуществляли на пациентах, страдающих от атерогенной дислипидемии и абдоминального ожирения, для оценки переносимости и безопасности введения один раз в день пероральных доз соединения 29 WO 2004/005233 (при дозе 80 мг/день), а также эффекта на триглицериды и HDL-холестерин в плазме (главная задача).
Относительно группы с плацебо терапевтическую эффективность данного соединения демонстрировали со статистически значимым 21% (р <0,01) снижением триглицеридов в плазме и 9% (р <0,01) увеличением концентрации хорошего холестерина (HDL-C). Данные метаболические эффекты были сравнимы с эффектами, опубликованными для фибратов в той же популяции пациентов. Более того, соединение показало заметное отсутствие эффекта на гомоцистеин (известный фактор сердечно-сосудистого риска). Соединение показало значительные эффекты на множество вторичных критериев оценки, включая уменьшение количества маркеров воспаления печени острой фазы, таких как фибриноген и гаптог-лобин (р <0,01). Также оценивали эффекты на биохимические параметры функционирования печени, и введение пероральных доз соединения 29 WO 2004/005233 неожиданно приводило к статистически значимому 23% снижению концентрации гамма-глютамилтранспептидазы (р <0,001) и 13% снижению концентрации аланинаминотрансферазы (р <0,01).
Второе пилотное, двойное анонимное, плацебо-контролируемое, рандомизированное исследование проводили на пациентах, страдающих от нарушенной гликемии натощак, нарушения переносимости глюкозы и абдоминального ожирения, для оценки переносимости и безопасности введения один раз в день пероральных доз соединения 29 WO 2004/005233 (при дозе 80 мг/день), а также эффекта на метаболизм глюкозы и липидов.
Относительно группы с плацебо, терапевтическую эффективность данного соединения демонстрировали со статистически значимым ослаблением нарушенной гликемии натощак (-5%, р <0,05), инсули-немии натощак (-25%, р <0,01) и индекса резистентности к инсулину, HOMA-IR (-31%, р <0,01). Параллельно, соединение 29 WO 2004/005233 снижало количество триглицеридов (-25%, р <0,001) и LDL-C в плазме при увеличении концентрации HDL-С (+9%, р <0,01). Соединение показало заметный эффект на множество вторичных критериев оценки, включая снижение уменьшения количества маркеров воспаления печени острой фазы, таких как гаптоглобин (р <0,01). Также оценивали эффекты на биохимические параметры функционирования печени, и введение пероральных доз соединения 29 WO 2004/005233 приводило к статистически значимому 15% снижению концентрации гамма-глютамилтранспептидазы
(р <0,01).
Данные результаты демонстрировали, что пероральная рецептура соединения общей формулы (I) не только хорошо переносится пациентами, но также обладает положительными эффектами на большое количество биохимических параметров, связанных с NAFLD и NASH, включая ферменты печени, чувствительность к инсулину, метаболизм липидов и маркеры воспаления в печени. В частности, соединение 29 WO 2004/005233 значительно снижало концентрации в плазме ALAT и GGT, двух распространенных специфических маркеров дисфункции печени, которые оценивали у пациентов, страдающих от NAFLD и
NASH.
Пример 2. Модели животных для исследования специфических для печени свойств соединений общей формулы (I)
Материалы и методы
Модель животных и обработка: ob/ob мыши
Мужские особи ob/ob мышей (8-недельные) приобретали у Charles River (L'Arbresle, France) и держали при 12-часовом цикле день/ночь при постоянной температуре 20±3°С. После 1-недельной акклиматизации мышей разделяли на группы по 8 животных, выбранных так, что распределение их веса тела и их гликемия натощак в течение 6 ч, определенная перед экспериментом, были равномерными. Животных держали на стандартной диете (R03, SAFE) и обрабатывали в течение 26 дней соответствующими соединениями. Соединения, включая соединение 29 WO 2004005233 (соединение 29, при 10 или 30 мг/кг/день), фенофибрат (100 мг/кг/день) и розиглитазон (10 мг/кг/день), принудительно вводили ежедневно. Контрольных животных обрабатывали только средой (карбоксиметилцеллюлоза 1%+Tween-80 0,1%). Животные имели свободный доступ к пище и воде.
Модель животных и обработка: исследование на hApoE2 активированных мышах Женские особи hApoE2 активированных (KI) трансгенных мышей (Sullivan et al., 1998) (4-недельные). Мышей держали при 12-часовом цикле день/ночь при постоянной температуре 20±3°С. После 1-недельной акклиматизации мышей разделяли на группы по 7-10 животных, выбранных так, чтобы распределение веса тела и концентрации липидов в плазме, определенные перед экспериментом, были равномерными. Животных держали на западной диете (20% насыщенный жир и 0,2% холестерин, Harlan Teklad TD88137) при отъеме и в течение 12 недель. Соответствующие соединения (соединение 29 при 0,3 мг/кг/день и фенофибрат при 100 мг/кг/день) вводили в западную диету (SAFE, Augy, France) и вводили мышам в течение 12 недель. Контрольные животные получали только западную диету. Животные имели свободный доступ к пище и воде.
Модель животных и обработка: исследования на hApoE2 KI и hApoE2 KI PPAR альфа KO мышах Женские особи hApoE2 активированных (KI) и hApoE2 KI/PPAR альфа нокаутных (KO) подобранных по возрасту трансгенных мышей (8-25-недельные для первого эксперимента и 10-14-недельные для второго эксперимента). hApoE2 KI/PPAR альфа KO мышей получали скрещиванием гомозиготных hAp-oE2 KI мышей (Sullivan P et al., 1998) и гомозиготных PPAR альфа дефицитных мышей (Lee et al., 1995). Мышей держали при 12-часовом цикле день/ночь при постоянной температуре 20±3°С. После 1-недельной акклиматизации мышей разделяли на группы по 4-6 животных, выбранных так, чтобы распределение их по возрасту, весу тела и концентрации липидов в плазме, определенной перед экспериментом, были равномерными. Животных держали на западной диете (20% насыщенный жир и 0,2% холестерин, Harlan Teklad TD88137) в течение 2 недель в первом исследовании, который включал ежедневное введение соединения 29 (при 30 мг/кг/день принудительным пероральным введением), и в течение 6 недель во втором исследовании, который включал ежедневное введение соединения 1 WO 2007147879 (соединение 1, при 30 мг/кг/день принудительным пероральным введением). Контрольных животных обрабатывали только средой (карбоксиметилцеллюлоза 1% + Tween-80 0,1%). Животные имели свободный доступ к пище и воде.
Получение биологических образцов, полученных из моделей животных
В конце исследований животных взвешивали и умерщвляли при анестезии. Кровь собирали из рет-роорбитальной вены; плазму получали центрифугированием (4000 об/мин при 4°С в течение 15 мин) и впоследствии замораживали и хранили при -20°С. Ткани и печень выделяли и быстро замораживали в жидком азоте и хранили при -80°С для последующего анализа (генная экспрессия и биохимия) или фиксировали в 4% параформальдегиде для гистологии.
Анализ плазмы
Концентрации аланинаминотрансферазы определяли в плазме, применяя RX Daytona(tm) автоматический анализатор (Randox) и подходящий набор для дозирования (Randox, cat# AL 3801). Анализ генной экспрессии
Суммарную РНК выделяли из замороженной печени, применяя NucleoSpin(r) 96 RNA набор (Macherey Nagel) согласно инструкции производителя. Обратную транскрипцию осуществляли на 1 мкг суммарной РНК действием 1 мкл MMLV-RT фермента (Invitrogen) в течение 1 ч при 37°С в суммарном объеме 30 мкл. Условиями реакции были 1X буфер (Invitrogen), 1,5 мМ DTT (Invitrogen), 0,18 мМ dNTP (Promega), 200 нг pdN6 (Amersham), 30 U ингибитора РНКазы (Promega). Затем проводили количественный ПЦР, применяя MyiQ одноцветную систему для детекции для ПЦР в режиме реального времени (Biorad). Вкратце, ПЦР реакции
проводили в 96-луночных планшетах на 5 мкл разбавленной смеси для обратной транскрипции, применяя iQ SYBR Green Supermix набор. Условиями реакции были 25 мкл объем реакции, 3 мМ MgCl2 и 0,5 мкл каждого раствора обратного и прямого праймера (10 пмол.), Tm 60°С. Пары праймеров, которые конструировали для специфической амплификации каждого гена-мишени, приведены в табл. 1.
Таблица 1
Гены
Обратный праймер (5'-3'|
Прямой праймер (5-3')
36В4
GGGAAGGTGTAATGCGTCTCCACAG (SEQ ID N0:1)
CATGCTCAACATCTCCCCCTTCTCC (SEQ ID NO:2)
TNF
alpha
AGGTACAACCCATCGGCTGG (SEQ ID N0:3)
CGTCGTAGCAAACCACCAAGTG (SEQ ID NO:4)
TGF beta
TGGTTGTAGAGGGCAAGGAC (SEQ ID N0:5)
TTGCTTCAGCTCCACAGAGA (SEQ ID NO:6)
CCL5
CACACTTGGCGGTTCCTTCG (SEQ ID N0:7)
CCCTCACCATCATCCTCACTGC (SEQ ID NO:8)
CoMal
G С CAG G AGAA CCAGCAGAG (SEQ ID N0:8)
AGGCGAACAAGGTGACAGAG (SEQ ID N0:10)
Количество испускаемой флуоресценции было прямо пропорционально количеству комплементарной ДНК, присутствующей в момент начала реакции и амплифицированной в процессе ПЦР. Относительные степени экспрессии определяли, применяя стандартную кривую для каждого транскрипта. Затем результаты нормализировали относительно сигналов, полученных с 36В4 контролем (контрольный транскрипт для генной экспрессии в печени). Затем для каждого образца рассчитывали фактор индукции, т.е. отношение между относительным сигналом, вызванным соединением согласно настоящему изобретению, и средним для величин, относящихся к контрольной группе. Чем больше данный фактор, тем более соединение способствует экспрессии гена-мишени. Конечный результат изображен в виде среднего значения величин индукции в каждой экспериментальной группе.
Гистологический анализ печени
Обрабатывали фиксированные в формалине ткани печени и парафиновые срезы 5 мкм в толщину прокрашивали гематоксилином и эозином. Гистологический анализ прокрашенных срезов печени осуществляли в слепых условиях для количественного определения стеатоза печени и внутридолькового воспаления печени. Стеатоз печени оценивали в баллах от 0 до 3 следующим образом: 0 (очень незначительно пораженная), 1 (незначительно пораженная), 2 (умеренно пораженная), 3 (сильно пораженная). Внутридольковое воспаление печени также оценивали в баллах в зависимости от числа очагов воспаления, подсчитанных в поле зрения следующим образом: 0 ( <1 очаг в поле наблюдения), 1 (1-2 очага в поле наблюдения), 2 (2-4 очага в поле наблюдения), 3 (более чем 4 очага в поле наблюдения).
Анализ липидов в печени
Приблизительно 100 мг замороженной ткани печени гомогенизировали гомогенизатором для тканей (Precellys(r)24, Bertin Technologies, France) в 150 мМ NaCl буфера, содержащего 15,4 мМ NaN3. Ли-пидные фракции в гомогенатах экстрагировали смесью хлороформ-метанол (2:1, об./об.) с последующим измерением суммарного количества холестерина (применяя Cholesterol RTU(tm) 61218 набор, Biomerieux, France) и истинных триглицеридов (TR0100 набор, Sigma-Aldrich).
Результаты и выводы
Несколько животных моделей описано в литературе как отражающие этиологию, развитие заболевания и патологию заболевания печени у человека. Однако данные модели не всегда показывают диапазон гистопатологических и патофизиологических особенностей, связанных с конкретными заболеваниями печени. Как рассматривалось недавно (Fan J. и Qiao L., 2009), это является особенно очевидным в случае NAFLD или NASH, для которых разработаны генетические (на трансгенных мышах), диетологические (на крысах или мышах) или смешанные модели.
NASH характеризуется патологическими изменениями печени, включающими диапазон от стеатоза и воспаления печени до дистрофии, фиброза и цирроза печени. Патогенез NASH остается плохо понятным. Он представляет собой компонент метаболического синдрома и, следовательно, часто связан с ги-перлипидемией. Различные модели трансгенных животных применяли для того, чтобы охарактеризовать эффекты примерных соединений общей формулы (I) и, более конкретно, общей формулы (I) и общей формулы (IV): резистентные к инсулину, лептин-дефицитные ob/ob мыши и дислипидемические hApoE2 активированные мыши (последние с или без дополнительных геномных модификаций, выражающихся в инактивации PPAR альфа гена).
Лептин-дефицитные ob/ob мыши с ожирением являются дислипидемическими, резистентными к инсулину, и у них развивается повреждение печени и стеатоз. Стеатоз печени является относительно бессимптомным, но индивидуумы с данным заболеванием подвержены большему риску развития NASH. Данный первый протокол разрабатывали для анализа эффектов соединения 29 и референтных соединений, фенофибрата и розиглитазона, на ранние стадии NASH, т.е. воспаление печени со стеатозом ob/ob мышей. У ob/ob мышей 26-дневная обработка розиглитазоном вызывала увеличение экспрессии в печени TNF альфа в ob/ob мышах, тогда как существенного изменения в экспрессии данного цитокина не наблюдалось у животных, обработанных фенофибратом. Напротив, введение соединения 29 ингибировало экспрессию данного цитокина зависящим от дозы способом (фиг. 2А). Следуя той же обработке, степень экспрессии в печени TGF бета была эквивалентной во всех контрольных и референтных группах (кон
троль, фенофибрат и розиглитазон). Снова, введение соединения 29 ингибировало экспрессию данного фактора роста зависящим от дозы способом, эффект, который является более статистически релевантным, когда соединение 29 вводили при 30 мг/кг/день (фиг. 2В).
ALAT в плазме измеряли как суррогатный маркер для оценки повреждения печени у данных ob/ob мышей после 26-дневной обработки различными соединениями. Концентрацию ALAT в плазме сравнивали или с контрольной группой, или с группой, обработанной фенофибратом, группа мышей, которую обрабатывали розиглитазоном, показывала заметное увеличение плазматических концентраций ALAT. Напротив, введение соединения 29 при 30 мг/кг/день вызывало статистически значимое снижение концентрации в плазме ALAT (фиг. 2С).
Другую in vivo модель применяли для того, чтобы исследовать эффекты соединения 29 и референтного соединения фенофибрата на физиологические параметры, обычно считающиеся релевантными для оценки NASH. В "гуманизированных" АроЕ2 активированных мышах (именуемых hApoE2 KI) человеческий АроЕ2 аллель заменял мышиный арое ген, так что данные мыши экспрессировали человеческий АроЕ2 (hApoE2) под контролем эндогенных промоторных последовательностей при физиологических концентрациях. Однако hApoE2 имеет заметно сниженное сродство к LDL рецептору, приводя к тому, что профиль липопротеина в плазме напоминает человеческую гиперлипопротеинемию III типа (Sullivan et al., 1998). Аналогично людям, hApoE2 KI мыши являются чувствительными к гиполипидемическим лекарственным средствам, таким как фибраты (лиганды для PPARy). Показано, что данный класс лекарственных средств обращает развитие стеатогепатита у мышей (Shiri-Sverdlov R. et al., 2006) и, таким образом, данная модель позволяет оценить специфические для печени противовоспалительные и противо-фиброзные эффекты соединений общей формулы (I). В частности, повышенные TNFa концентрации связаны с воспалением, некрозом и фиброзом печени, обычными для NASH (Larter et al., 2008). TGFp представляет собой пептид, обнаруживаемый во многих типах клеток, который регулирует заживление ран и апоптоз. Изоформа, найденная в гепатоцитах, TGFp1, обнаружена во многих моделях фиброза печени, и ее концентрация увеличивается при хроническом активном гепатите и фиброзных заболеваниях печени, связанных с употреблением алкоголя (Nan et al., 2009).
Различных hApoE2 KI мышей обрабатывали в течение 12 недель, при этом их держали на западной диете. В данной модели соединение 29 ингибировало экспрессию в печени гена, который соответствует воспалению печени (TNFa, CCL5, TGFp; фиг. 3А, 3В, 3С, соответственно) с эффективностью, аналогичной (если не превосходящей) фенофибрату, который вводили при большей дозе.
Однако группа мышей, обработанная соединением 29, показала статистически значимое снижение экспрессии генов, подобных генам для специфических коллагеновых цепей, которые вовлечены в фиброз печени (Basaranoglu et al., 2010), в частности, Col1a1 (фиг. 3D). Данный эффект на гены коллагена не наблюдали в группе мышей, обработанной фенофибратом. Данные результаты демонстрируют, что соединение 29 обладает противовоспалительными и противофиброзными свойствами в in vivo модели NASH.
Примерные соединения общей формулы (I) испытывали in vivo в модели мышей с рационом с высоким содержанием жиров. hApoE2 KI и hApoE2 KI/PPAR альфа KO ("гуманизированные" АроЕ2 активированные мыши, лишенные mPPAR альфа гена) держали на западной диете и ежедневно обрабатывали соединением 29 при 30 мг/кг/день в течение 2 недель. В конце протокола стеатоз печени и интралобу-лярное воспаление оценивали для контрольных и обработанных мышей посредством гистологического анализа и специального счета.
Данное исследование показало, что обработка соединением 29 ингибирует развитие и стеатоза, и воспаления печени, которые вызываются диетой у hApoE2 KI мышей и, даже более быстро, у hApoE2 KI/PPAR альфа KO мышей, для которых очевидно ускорение развития заболевания печени из-за недостатка PPAR альфа (табл. 2 и 3).
Таблица 2
Стеатоз
hApoE2 KI
hApoE2 К1/РРАКальфа КО
печени
Среда
Соединение
Среда
Соединение
(баллы)
29 (30
29 (30
мг/кг/день)
мг/кг/день)
17%
83%
50%
17%
33%
33%
33%
33%
50%
33%
17%
Таблица 3
Воспаление
hApoE2 KI
ЬАроЕ2 К1/РРАКальфа КО
печени
Среда
Соединение
Среда
Соединение
(баллы)
29 (30
29 (30
мг/кг/день)
мг/кг/день)
50%
100%
17%
67%
50%
33%
17%
33%
17%
17%
В другом исследовании специфические для печени противовоспалительные и противофиброзные свойства соединения 29 и соединения 1 WO 2007/147879 (соединение 1) оценивали на hApoE2 KI/PPAR aльфa KO мышах, которых держали на западной диете и ежедневно обрабатывали отобранными соединениями в течение 6 недель.
И соединение 29, и соединение 1 ингибировали экспрессию в печени TNFa, TGFp и коллагена у hApoE2 KI/PPAR альфа KO мышей (фиг. 4А, 4В и 4С, соответственно), подтверждая специфические для печени (в основном PPAR альфа-независимые) противовоспалительные и противофиброзные свойства данных соединений в релевантной in vivo модели NASH. Анализ липидов в печени дополнительно показал, что и соединение 29, и соединение 1 предотвращают накопление триглицеридов в печени hApoE2 KI/PPAR альфа KO мышей (фиг. 4D).
Взятые вместе, данные результаты указывают на специфические для печени противовоспалительные и противофиброзные свойства соединения 29 WO 2004/005233 (включенного в общую формулу I и II) и соединения 1 WO 2007/147879 (включенного в общую формулу (I) и (IV)) in vivo.
Дополнительной моделью для испытания соединений общей формулы (I) были диетические животные модели NASH, такие как метионин- и холин-дефицитная (MCD) модель, которая основана на диете, содержащей большое количество сахарозы и жира, но не содержащая два компонента, метионин и холин, которые являются важными факторами для метаболизма в печени. У мышей или крыс, которых держали на данной диете, быстро развивалось воспаление печени, которое далее развивалось до стеатоза, некротического воспаления, фиброза и оксидативного стресса. Данный подход применяли для того, чтобы показать потенциальные терапевтические эффекты на стеатоз, фиброз, оксидативный стресс и/или воспаление печени, которые связаны с введением соединений, таких как розиглитазон (Tahan V. et al. 2007), ингибитор рап-каспазы VX-166 (Witek R. et al., 2009), зеаксантин (Chamberlain S. et al., 2009), телмисартан (Kudo H. et al., 2009) или Wy-14643 (Ip E. et al., 2004).
Соединения общей формулы (I) можно испытывать в MCD модели, разработанной на крысах линии Sprague Dawley (8-недельные) или C57BI6 мышах, которых держали на метионин- и холин-дефицитной диете в течение 4-12 недель. Затем соответствующие соединения, включая соединения, которые выбраны в качестве отрицательного или положительного контроля, вводили ежедневно при различных дозах группам из десяти или более животных принудительным введением в течение последующих 4-12 недель. Несколько типов измерений проводили до, в течение или в конце обработки, с или без умерщвления животных. Биохимические величины (активности аспартатаминотрансферазы и аланинаминотрансферазы, общий билирубин, щелочная фосфатаза, LDL/HDL-холестерин, гиалуронат в сыворотке, триглицериды печени и плазматические триглицериды) и гистоморфометрический анализ (для определения площади печени с фиброзом и/или стеатозом) представляют собой более соответствующие показатели. Можно также оценивать количества воспалительных маркеров (таких как интерлейкины-1a, -1b, -2, -4, -6, -10, интерферон-гамма или TNF альфа) и/или степень экспрессии соответствующих генов (такие как рецепторы коллаген I или специфические для печени хемокиновые рецепторы).
Альтернативно, модели животных, основанные на вызванном химически фиброзе печени, можно применять для исследования противофиброзного эффекта соединений общей формулы (I). Например, введение тиоацетамида (ТАА) или тетрахлорида углерода (CO4) вызывает увеличение активных форм кислорода (ROS), способствуя перекисному окислению липидов, пролиферации звездчатых клеток печени и гипервыработке коллагена, приводя в результате к хроническому повреждению печени и фиброзу у крыс. Данный подход применяли для того, чтобы показать положительный эффект на фиброз печени, оксидативный стресс и/или воспаление с помощью соединений, таких как куркумин (Fu Y. et al., 2008) или пиоглитазон (Yuan G. et al., 2004).
Соединения общей формулы (I) можно испытывать в CCl4 модели, которая разработана на крысах линии Sprague Dawley (8-недельные), которым внутрибрюшинно давали повышающиеся дозы CCl4, разбавленные вазелиновым маслом (50%), каждые пять дней в течение 4-12 недель. Фенобарбитал можно также вводить, начиная с 10 дня после первой дозы CO4 для того, чтобы потенцировать модель. Затем соответствующие соединения, включая соединения, которые выбирают в качестве положительного или отрицательного контроля, вводили ежедневно при различных концентрациях (находящихся между 0,01 и 100 мг/кг/день) группам из десяти или более крыс принудительным введением в течение следующих 4-12 недель. Как в MCD модели, несколько типов измерений проводили перед, в течение или в конце обра
ботки, с или без умерщвления крыс, для оценки эффективности обработки на основе биохимических величин и гистоморфометрического анализа, вместе с гемодинамическими индексами и количествами маркеров воспаления и/или степенью экспрессии соответствующих генов.
Модели животных, описанные выше, позволяют сравнивать специфические для печени активности соединений общей формулы (I) между собой и с соединениями, уже известными в качестве обладающих специфическими для печени (и, в частности, NAFLD-/NASH-специфическими) терапевтическими свойствами. В частности, данные, показанные в данном примере, предполагают превосходство соединений общей формулы (I) при сравнении с референтными соединениями.
Пример 3. In vitro/ex vivo модели для испытания специфических для печени свойств соединений общей формулы (I)
Некоторые in vitro/ex vivo модели разработаны для скринирования соединений, которые могут обладать положительным эффектом на фиброз печени, оксидативный стресс и/или воспаление печени. Действительно, ключевым событием при фиброзе печени является активация звездчатых клеток печени (HSC). После повреждения гепатоцитов данный тип клеток становится активированным и начинает про-лиферировать (Sato M. et al., 2003). Активированные HSC (например, крысиные или человеческие HSC, выделенные из печени или крысиной HSC-T6 линии клеток) могут активироваться и продуцировать избыточные количества соединений внеклеточного матрикса и ингибиторов разрушения матрикса. Данный подход применяли для того, чтобы показать положительный эффект соединений, таких как куркумин (Xu et al., 2003), тиазолидиндионов (Miyahara Т. et al., 2000) или 17бета-эстрадиола (Liu Q. et al., 2004).
In vitro/ex vivo модели, описанные выше, позволяют сравнивать специфические для печени активности соединений общей формулы (I) между собой и с соединениями, известными в качестве обладающих специфическими для печени (и, в частности NAFLD-/NASH-специфическими) терапевтическими свойствами.
Литература
Angulo P. et al., 2002. Best Pract. Res. Clin. Gastroenterol.; 16: 797-810.
Basasaranoglu, M. et al., 2010. World J. Gastroenterol.; 16: 2223-6.
Chamberlain S. et al., 2009. Dig. Dis. Sci.; 54: 1460-4. Dowman J.K. et al., 2010, Q. J. Med; 103: 71-83. Fan J. and Qiao L., 2009. Hepatobil. Pancrat. Dis. Int.; 8: 233-240.
Fu Y. et al., 2008. Mol. Pharmacol.; 73: 399-409. Gressner A. et al., 2009. World J. Gastroenterol.; 15: 2433-2440.
Ip E. et al., 2004. Hepatology; 39: 1286-96. Kudo H. et al., 2009. Liver Int.; 29: 988-96. Larter C. et al., 2008. J. Gastroenterol. Hepatol.; 23: 1635-48.
Lee S. et al., 1995. Mol. Cell Biol.; 15: 3012-22. Liu Q. et al., 2004. World J. Gastroenterol.; 10: 1315-20. Marchesini G. et al., 2003. Hepatology; 37: 917-923. Miyahara T. et al., 2000. J. Biol. Chem.; 275: 35715-22. Nan Y et al., 2009. Scand J. Gastroenterol., 44, 1121-31. Nelson A. et al., 2009. J. Clin. Gastroenterol.,* 43: 990994.
Neuschwander-Tetri et al., 2003. Hepatology; 38: 10081017 .
Sato M. et al., 2003. Cell Struct. Funct.; 28: 105-12. Shiri-Sverdlov R. et al., 2006. J. Hepatol.; 44: 732-41. Sullivan P. et al., J. Clin. Invest; 102: 130-5. Tahan V. et al., 2007. Dig. Dis. Sci.; 52: 3465-3472. Vuppalanchi R. and Chalasani N., 2009. Hepatology; 49: 306-317.
Witek R. et al., 2009. Hepatology; 50:1421-30. Xu et al., 2003. Am. J. Physiol. Gastrointest Liver Physiol.; 285: G20-G30.
Yen M. et al., 2007. Am. J. Clin. Pathol.; 128: 837-847. Yuan G. et al., 2004. World J, Gastroenterol.; 10: 1047-51.
в которой X1 представляет собой галоген, R1 или группу G1-R1; А представляет собой СН=СН или группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы;
R1 представляет собой атом водорода, незамещенную алкильную группу, арильную группу или ал-кильную группу, которая замещена одним или более атомами галогена, алкокси или алкилтиогруппой, циклоалкильными группами, циклоалкилтиогруппами или гетероциклическими группами;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильной группой, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами или гетероциклическими группами;
R4 и R5, одинаковые или различные, представляют собой алкильную группу, которая замещена или не замещена одним или более атомами галогена, циклоалкильными группами, гетероциклическими группами, где
алкильная группа представляет собой насыщенный углеводородный радикал, который является линейным или разветвленным, содержащий от одного до семи атомов углерода;
алкоксигруппа представляет собой алкильную группу, которая соединена с остатком соединения через атом кислорода;
алкилтиогруппа представляет собой алкильную группу, которая соединена с остатком соединения через атом серы;
циклоалкильная группа представляет собой алкильную группу, которая образует один цикл, содержащий от трех до четырнадцати атомов углерода;
циклоалкилтиогруппа представляет собой циклоалкильную группу, которая соединена с остатком соединения через атом серы;
арильная группа прдставляет собой ароматическую группу, замещенную или не замещенную, содержащую предпочтительно от шести до четырнадцати атомов углерода;
гетероциклическая группа представляет собой гетероциклоалкильную или гетероарильную группу;
гетероциклоалкильная группа представляет собой циклоалкильную группу, которая дополнительно содержит один или несколько гетероатомов, выбранных из азота, кислорода или серы; и
гетероарильная группа представляет собой арильную группу, которая дополнительно содержит один или несколько гетероатомов, выбранных из азота, кислорода или серы.
2. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой X1 представляет собой галоген, R1 или группу G1-R1;
А представляет собой группу СН=СН; Х2 представляет собой группу G2-R2;
G1 и G2, одинаковые или различные, представляют собой атом кислорода или серы;
R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода, причем, в частности, алкильная или циклоалкильная группа замещена или не замещена одним или более атомами галогена;
R2 представляет собой алкильную группу, замещенную -COOR3 группой, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода;
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
3. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой X1 представляет собой R1 или группу G1-R1;
А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, содержащую от одного до семи атомов углерода;
R2 представляет собой алкильную группу, замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода;
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
4. Способ по п.1, где вводимое соединение является соединением общей формулы (I), в которой
X1 представляет собой атом галогена или R1 или группу G1-R1; А представляет собой группу СН2-СН2; Х2 представляет собой группу G2-R2;
G1 представляет собой атом кислорода или серы, и G2 представляет собой атом кислорода; R1 представляет собой алкильную или циклоалкильную группу, которая замещена одним или более атомами галогена;
R2 представляет собой алкильную группу, замещенную или не замещенную одним или более атомами галогена и замещенную, по меньшей мере, группой -COOR3, в которой R3 представляет собой атом водорода, или алкильную группу, содержащую от одного до четырех атомов углерода;
R4 и R5 представляют собой алкильную группу, содержащую от одного до четырех атомов углерода.
5. Способ по любому из предшествующих пунктов, где G2 представляет собой атом кислорода и R2 представляет собой алкильную группу, замещенную группой -COOR3, в которой R3 представляет собой атом водорода, или незамещенную линейную или разветвленную алкильную группу, содержащую от одного до четырех атомов углерода.
6. Способ по любому из предшествующих пунктов, где X1 представляет собой алкилтиогруппу, которая содержит алкильную группу, которая является линейной или разветвленной, содержащей от одного до семи атомов углерода, которая замещена или не замещена одним или более атомами галогена.
7. Способ по любому из предшествующих пунктов, где соединение выбирают из группы, состоящей
1-[4-метилтиофенил] -3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1 -она, 1-[4-метилтиофенил]-3-[3,5-диметил-4-изопропилоксикарбонилдиметилметилоксифенил]проп-2-ен-
1- она,
1-[4-метилтиофенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она,
1-[4-трифторметилфенил]-3-[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-
2- ен-1-она,
1-[4-трифторметилфенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она, 1-[4-трифторметилоксифенил] -3 -[3,5-диметил-4-трет-бутилоксикарбонилдиметилметилоксифенил]проп-2-ен-1-она,
1- [4-трифторметилоксифенил]-3-[3,5-диметил-4-карбоксидиметилметилоксифенил]проп-2-ен-1-она,
2- [2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-метилпропионовой кислоты и изопропилового эфира 2-[2,6-диметил-4-[3-[4-(метилтио)фенил]-3-оксопропил]фенокси]-2-
метилпропионовой кислоты.
8. Способ по любому из предшествующих пунктов, в котором соединение вводят в комбинации с метформином, инсулином, тиазолидиндионами, глитазонами или статинами.
9. Способ лечения заболевания печени, включающий введение фармацевтической композиций, содержащей соединение общей формулы (I), как определено по любому из пп.1-8.
10. Способ по п.9, где фармацевтическая композиция составлена в форме инъецируемых суспензий, гелей, масел, пилюль, суппозиториев, порошков, гелевых капсул, капсул, аэрозолей или галеновых форм, или устройств, обеспечивающих продолжительное и/или медленное высвобождение.
11. Способ по любому из пп.1-10, где заболевание печени выбрано из группы, состоящей из фиброза печени, жирового гепатоза и неалкогольного стеатогепатита.
10.
10.
<213> Синтетический
<220>
<223> TGFb обратный праймер <400> 5
tggttgtaga gggcaaggac 20
<210> 6
<211> 20
<212> ДНК
<213> Синтетический
<220>
<223> TGFb прямой праймер
<400> 6
ttgcttcagc tccacagaga 20
<210> 7
<211> 20
<212> ДНК
<213> Синтетический
<220>
<223> CCL5 обратный праймер
<400> 7
cacacttggc ggttccttcg 20
<210> 8
<211> 22
<212> ДНК
<213> Синтетический
<220>
<223> CCL5 прямой праймер <400> 8
ccctcaccat catcctcact gc 22
<210> 9
<211> 19
<212> ДНК
<213> Синтетический
<220>
<223> Collal обратный праймер
<400> 9
gccaggagaa ccagcagag 19
<210> 10
<211> 20
<212> ДНК
<213> Синтетический
<220>
<223> Collal прямой праймер <400> 10
aggcgaacaa ggtgacagag 20
Евразийская патентная организация, ЕАПВ Россия, 109012, Москва, Малый Черкасский пер., 2
020849
- 1 -
(19)
020849
- 1 -
(19)
020849
- 1 -
(19)
020849
- 1 -
(19)
020849
- 4 -
(19)
020849
- 18 -
020849
- 20 -