Патентная документация ЕАПВ

 
Запрос :  ea000020818b*\id

больше ...
Термины запроса в документе


Полный текст патента

(57) Реферат / Формула:

1. Модифицированный полипептид фактора VII (FVII), включающий модификации в полипептиде FVII, где модификации осуществляют в положениях, соответствующих положениям 286 и 298 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих положениях в полипептиде FVII, модификация в положении 286 представляет собой замену аминокислоты на аргинин (Arg, R); модификация в положении 298 представляет собой замену аминокислоты на глютамин (Gln, Q) и модифицированный полипептид FVII обладает повышенной коагулянтной активностью по сравнению с полипептидом FVII, немодифицированным в положениях 286 и 298.

2. Модифицированный полипептид FVII по п.1, где модификация в положении 286 представляет собой замену Gln (Q) на Arg (R).

3. Модифицированный полипептид FVII по п.1, где модификация в положении 298 представляет собой замену Met (M) на глютамин (Gln, Q).

4. Модифицированный полипептид FVII по п.1, содержащий модификации Q286R и M298Q.

5. Модифицированный полипептид FVII по любому из пп.1-4, где немодифицированный полипептид FVII содержит последовательность аминокислот, приведенную в любой из SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353, или представляет собой ее аллельный или видовой вариант, или вариант, обладающий по меньшей мере 60% идентичностью с последовательностью FVII из любой последовательности SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353, или представляет собой активный фрагмент полипептида FVII, который включает последовательность аминокислот, приведенную в любой из последовательностей SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353.

6. Модифицированный полипептид FVII по любому из пп.1-5, содержащий одну или несколько дополнительных модификаций в другом положении в полипептиде FVII.

7. Модифицированный полипептид FVII по п.6, где дополнительная модификация представляет собой замену аминокислоты в положении, соответствующем положению, выбранному из 51, 52, 54, 60, 66, 68, 109, 119, 122, 124, 130, 132, 158, 161, 175, 196, 197, 199, 202, 216, 222, 237, 239, 257, 286, 287, 290, 292, 294, 296, 305, 314, 318, 321, 337, 341, 366, 373, 374, 394, 395 и 396.

8. Модифицированный полипептид FVII по п.6, в котором дополнительная модификация аминокислоты выбрана из

9. Модифицированный полипептид FVII по любому из пп.6-8, включающий модификации, выбранные из

10. Модифицированный полипептид FVII по любому из пп.6-11, включающий модификации, выбранные из

11. Модифицированный двухцепочечный активированный полипептид фактора VII (FVIIa), включающий аминокислотные замены, соответствующие положениям 128, 129, 286 и 289 в SEQ ID NO: 3, где аминокислота в положении 128 заменена на аспарагин (N), аминокислота в положении 129 заменена на аланин (А), аминокислота в положении 286 заменена на аргинин (R) и аминокислота в положении 298 заменена на глутамин (Q), модифицированный полипептид FVIIa включает аминокислотную последовательность, по крайней мере на 85 или 90% идентичную последовательности полипептида, приведенной в SEQ ID NO:3; и модифицированный полипептид FVIIa обладает прокоагулянтной активностью.

12. Модифицированный полипептид фактора VII (FVII), состоящий из аминокислотной последовательности, приведенной в SEQ ID NO: 280.

13. Модифицированный двухцепочечный активированный полипептид фактора VII (FVIIa), состоящий из аминокислотной последовательности, приведенной в SEQ ID NO: 280, расщепленной между аргинином в положении 152 и изолейцином в положении 153.

14. Модифицированный полипептид FVIIa по п.11, где полипептид включает аминокислотную последовательность, по крайней мере на 95% идентичную последовательности полипептида, приведенной в SEQ ID NO:3.

15. Активированный модифицированный полипептид фактора VII (FVIIa) по п.11, в котором аминокислотная последовательность легкой цепи модифицированного FVIIa по крайней мере на 95% идентична аминокислотной последовательности на участке 1-152 последовательности, приведенной в SEQ ID NO:280, и включает аминокислотные замены в положениях 128 и 129.

16. Активированный модифицированный полипептид фактора VII (FVIIa) по п.11, в котором аминокислотная последовательность тяжелой цепи модифицированного FVIIa по крайней мере на 95% идентична аминокислотной последовательности на участке 153-406 последовательности, приведенной в SEQ ID NO:280, и включает аминокислотные замены в положениях 286 и 298.

17. Модифицированный полипептид фактора VII (FVII), в котором полипептид FVII включает только 1, 2, 3, 4, 5, 6 или 7 замен аминокислот в полипептиде FVII дикого типа, имеющем аминокислотную последовательность, приведенную в SEQ ID NO: 3 или в его аллельном или видовом варианте, или в полипептиде с последовательностью, приведенной в SEQ ID NO: 3, содержащем гетерологичный Gla домен вместо Gla домена последовательности SEQ ID NO: 3; одна замена аминокислоты находится в положении, соответствующем положению 286 в полипептиде FVII с аминокислотной последовательностью, приведенной в SEQ ID NO: 3, или в соответствующем положении в полипептиде FVII, и замена в положении 286 представляет собой замену на аргинин (Arg, R), что приводит к модифицированному полипептиду FVII, обладающему повышенной коагулянтной активностью по сравнению с полипептидом FVII, немодифицированным в положении 286.

18. Модифицированный полипептид FVII по любому из пп.1-17, где немодифицированный полипептид FVII содержит последовательность аминокислот, приведенную в любой из SEQ ID NO: 1-3 или 18-74, или представляет собой его аллельный или видовой вариант, или представляет собой активный фрагмент полипептида FVII, включающий последовательность аминокислот, приведенную в любой из последовательностей SEQ ID NO: 1-3 или 18-74.

19. Модифицированный полипептид FVII по п.18, где модифицированный полипептид FVII представляет собой активный фрагмент, включающий замену аминокислоты в положении, соответствующем положению 286 в полипептиде FVII.

20. Модифицированный полипептид FVII по любому из пп.17-19, в котором замена аминокислоты, в дополнение к замене 286R, находится в положении, соответствующем положению, выбранному из 51, 52, 54, 60, 66, 68, 109, 119, 122, 124, 130, 132, 158, 161, 175, 196, 197, 199, 202, 216, 222, 237, 239, 257, 286, 287, 290, 292, 294, 296, 298, 305, 314, 318, 321, 337, 341, 366, 373, 374, 394, 395 и 396.

21. Модифицированный полипептид FVII по любому из пп.17-20, включающий замену аминокислот, выбранную из

22. Модифицированный полипептид FVII по п.21, включающий замены аминокислот, выбранные из

23. Модифицированный полипептид FVII по любому из пп.1-10, включающий замены аминокислот, выбранные из

24. Модифицированный полипептид FVII по любому из пп.1-23, включающий аминокислотную последовательность, приведенную в любой из SEQ ID NOS: 118, 131-141-155, 157, 274-282, 285-288, 290, 292-297, 299, 301-306, 308, 310-314, 316-318, 321-326, 328, 334-342, 355-358, 360 или 364-371.

25. Модифицированный полипептид FVII, включающий модификацию в полипептиде FVII, где модификация введена в положение, соответствующее положению, выбранному из 54, 66, 121, 122, 129 и 132 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII.

26. Модифицированный полипептид FVII по п.25, в котором модификация выбрана из P54S, Q66N, L121S, A122N, Р129А и E132S.

27. Модифицированный полипептид FVII, включающий модификацию в полипептиде FVII, где модификация соответствует модификации, выбранной из T239S, T239Q, T239V, T239L, Т239Н, T239I, Р321К, Р321Е, P321Y, P321S, Q366D, Q366N, Q366V, Q366I, Q366L, Q366M, H373D, Н373Е, H373S, H373F, Н373А, K161S, K161V, H216S, H216K, H216R, S222A, S222K, S222V, S222D, S222N, S222E и H247S в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII.

28. Модифицированный полипептид FVII, включающий две или более модификаций в полипептиде FVII, его аллельном или видовом варианте или его активном фрагменте, в котором две или более модификаций аминокислот выбраны из модификаций, соответствующих Н216А, Н257А, E394N, Р395А, R396S, K109N, A292N, A175S, Н257А и замене Gla из FIX.

29. Модифицированный полипептид FVII по любому из пп.1-28, который является активным или активированным.

30. Модифицированный полипептид FVII по любому из пп.1-29, включающий гетерологичный домен Gla или его часть, достаточную для осуществления связывания фосфолипидов.

31. Модифицированный полипептид FVII по п.30, в котором гетерологичный домен Gla выбран из домена Gla фактора IX (FIX), фактора X (FX), протромбина, белка С, белка S, остеокальцина, белка Gla матрикса, Growth-arrest-specific белка 6 (Gas6) и белка Z.

32. Модифицированный полипептид FVII по п.30 или 31, в котором гетерологичный домен Gla имеет последовательность аминокислот, приведенную в любой из SEQ ID NO: 83-91, 93 и 94, или ее часть, достаточную для осуществления связывания фосфолипидов.

33. Модифицированный полипептид FVII по любому из пп.30-32, в котором весь нативный домен Gla FVII или его непрерывную часть удаляли и заменяли гетерологичным доменом Gla, или его частью, достаточной для осуществления связывания фосфолипидов.

34. Модифицированный полипептид FVII по п.33, в котором нативный домен Gla FVII включает аминокислоты 1-45 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или соответствующие остатки в полипептиде FVII.

35. Модифицированный полипептид FVII по пп.30-34, в котором гетерологичный домен Gla содержит модификации по сравнению с гетерологичным доменом Gla дикого типа.

36. Модифицированный полипептид FVII по п.32, в котором гетерологичный домен Gla представляет собой домен Gla FIX и модификация представляет собой замену аминокислоты в положении, соответствующем положению, выбранному из 19, 40, 43 и 44 домена Gla FIX, приведенного в SEQ ID NO: 83.

37. Модифицированный полипептид FVII по п.33, в котором модификация выбрана из M19K, E40L, K43I и Q44S.

38. Модифицированный полипептид FVII по любому из пп.35-37, в котором гетерологичный домен Gla содержит дополнительные модификации.

39. Модифицированный полипептид FVII по п.38, в котором гетерологичный домен Gla представляет собой домен Gla FIX и дополнительная модификация представляет собой замену аминокислоты в положении, соответствующем положению 19, 40, 43 и 44 домена Gla FIX, приведенного в SEQ ID NO: 83.

40. Модифицированный полипептид FVII по п.38 или 39, в котором дополнительная модификация выбрана из M19K, E40L, K43I и Q44S.

41. Модифицированный полипептид FVII по любому из пп.35-37, в котором модификация представляет собой M19K/E40L/K43I/Q44S.

42. Модифицированный полипептид FVII по любому из пп.30-41, включающий модификации, выбранные из

43. Модифицированный полипептид FVII по пп.1-42, включающий одну или более дополнительных модификаций аминокислоты (аминокислот), которые повышают устойчивость к антитромбину-III, увеличивают связывание и/или аффинность к фосфолипидам, повышают аффинность к тканевому фактору, увеличивают собственную активность, увеличивают ТФ-зависимую активность, увеличивают коагулянтную активность, изменяют конформацию полипептида для изменения зимогенности, увеличивают каталитическую или коагулянтную активность, сдвигая равновесие между высокоактивной и менее активной конформацией FVIIa в пользу высокоактивных конформаций, повышают устойчивость к протеазам, уменьшают гликозилирование, увеличивают гликозилирование, снижают иммуногенность, повышают устойчивость и/или способствуют химическому связыванию групп.

44. Модифицированный полипептид FVII по пп.1-43, включающий одну или более дополнительных модификаций аминокислоты (аминокислот), выбранных из

45. Модифицированный полипептид FVII по пп.1-44, где немодифицированный полипептид FVII имеет последовательность аминокислот, приведенную в SEQ ID NO: 3, или представляет собой аллельный или видовой вариант полипептида, приведенного в SEQ ID NO: 3.

46. Модифицированный полипептид FVII по любому из пп.1-45, который представляет собой зрелый полипептид.

47. Модифицированный полипептид FVII по любому из пп.1-46, который представляет собой одноцепочечный полипептид или двухцепочечный полипептид.

48. Модифицированный полипептид FVII по любому из пп.1-47, который включает пост-трансляционные модификации.

49. Модифицированный полипептид FVII по п.48, в котором пост-трансляционные модификации включают гликозилирование.

50. Модифицированный полипептид FVII по любому из пп.1-49, который является двухцепочечным активированным полипептидом FVIIa.

51. Молекула нуклеиновой кислоты, включающая последовательность нуклеотидов, кодирующую модифицированный полипептид FVII по любому из пп.1-50.

52. Вектор, содержащий молекулу нуклеиновой кислоты по п.51.

53. Клетка, включающая вектор по п.52.

54. Фармацевтическая композиция, включающая терапевтически эффективную концентрацию или количество модифицированного полипептида FVII по любому из пп.1-50 в фармацевтически приемлемом носителе.

55. Фармацевтическая композиция, включающая молекулу нуклеиновой кислоты по п.51 в фармацевтически приемлемом носителе.

56. Фармацевтическая композиция, включающая вектор по п.52 в фармацевтически приемлемом носителе.

57. Фармацевтическая композиция, включающая клетку по п.53 в фармацевтически приемлемом носителе.

58. Фармацевтическая композиция по любому из пп.54-57, разработанная для введения одной дозой.

59. Фармацевтическая композиция по любому из пп.54-58, разработанная для введения способом, выбранным из перорального, назального, легочного, буккального, трансдермального, подкожного, интрадуоденального, энтерального, парентерального, внутривенного или внутримышечного способов введения.

60. Фармацевтическая композиция по любому из пп.54-59, являющаяся лиофилизированной.

61. Способ лечения субъекта, включающий введение субъекту фармацевтической композиции по любому из пп.54-60, где субъект страдает от заболевания или состояния, которое поддается лечению введением FVII или прокоагулянта, и заболевание или состояние, подвергающееся лечению, выбрано из нарушений свертывания крови, гематологических нарушений, геморрагических нарушений, гемофилий, дефицита фактора VII, нарушений, связанных с кровотечениями, хирургического кровотечения или кровотечения в результате травмы.

62. Применение модифицированного полипептида FVII по любому из пп.1-50, для лечения заболевания или состояния, выбранного из нарушений свертывания крови, гематологических нарушений, геморрагических нарушений, гемофилий, дефицита фактора VII, нарушений, связанных с кровотечениями, хирургического кровотечения или кровотечения в результате травмы.

63. Применение по п.62, где заболевание или состояние является гемофилией, причем гемофилия представляет собой гемофилию А, или гемофилию В, или гемофилию С.


(19)
Евразийское
патентное
ведомство
020818
(13) B1
(12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ЕВРАЗИЙСКОМУ ПАТЕНТУ
(45) Дата публикации и выдачи патента 2015.02.27
(21) Номер заявки 201001628
(22) Дата подачи заявки 2009.04.10
(51) Int. Cl. C12N 9/64 (2006.01)
(54) МОДИФИЦИРОВАННЫЕ ПОЛИПЕПТИДЫ ФАКТОРА VII И ИХ ПРИМЕНЕНИЕ
(31) 61/124,021
(32) 2008.04.11
(33) US
(43) 2011.06.30
(86) PCT/US2009/002248
(87) WO 2009/126307 2009.10.15
(71) (73) Заявитель и патентовладелец:
КАТАЛИСТ БИОСАЙЕНСИЗ, ИНК. (US)
(72) Изобретатель:
Мэдисон Эдвин Л., Тсэнос Кристофер
(US)
(74) Представитель:
Стояченко И.Л. (RU) (56) BJELKE ET AL.: "A loop of
coagulation factor Vila influencing macromolecular substrate specificity" FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 581, no. 1, 23 December
2006 (2006-12-23), pages 71-76, XP005815646 ISSN: 0014-5793 abstract; figure 1 page 73
WO-A-2007031559
DICKINSON C.D. ET AL.: "Identification of surface residues mediating tissue factor binding and catalytic function of the serine protease factor VIIa" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 93, 1 December 1996 (1996-12-01), pages 14379-14384,
XP002267001 ISSN: 0027-8424 abstract; figure 1 WO-A-2008090215 US-A1-2007117756
PERSSON E. ET AL.: "RATIONAL DESIGN
OF COAGULATION FACTOR VLLA VARIANTS WITH SUBSTANTIALLY INCREASED INTRINSIC ACTIVITY" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 98, no. 24, 20
November 2001 (2001-11-20), pages 13583-13588, XP002909203 ISSN: 0027-8424 the whole document ALLEN GEOFFREY A. ET AL.: "A variant of recombinant factor VIIa with enhanced procoagulant and antifibrinolytic activities in an in vitro model of
hemophilia" ARTERIOSCLEROSIS THROMBOSIS AND VASCULAR BIOLOGY, vol. 27, no. 3, March
2007 (2007-03), pages 683-689, XP002538665 ISSN:
1079-5642 the whole document
WO-A-2007022512 WO-A-0158935
Родственные заявки
Преимущество приоритета принадлежит предварительной заявке на патент США № 61/124021 Edwin Madison и Christopher Thanos "Модифицированные полипептиды фактора VII и их применение", поданной 11 апреля 2008 г.
Эта заявка близка соответствующей заявке США 12/384915 Edwin Madison и Christopher Thanos "Модифицированные полипептиды фактора VII и их применение", поданной 10 апреля 2009 г., которая также претендует на приоритет предварительной заявки США 61/124021.
Где это возможно, содержание указанных выше заявок включено в настоящий документ в качестве ссылки в полном объеме. Где это возможно, содержание заявки США № 12/082662 Edwin Madison, Christopher Thanos, Sandra Waugh Ruggles и Shaun Coughlin "Модифицированные полипептиды фактора VII и их применение", поданной 11 апреля 2008 г., и соответствующей международной заявки № PCT/US 2008/04795 Edwin Madison, Christopher Thanos, Sandra Waugh Ruggles и Shaun Coughlin "Модифицированные полипептиды фактора VII и их применение", поданной 11 апреля 2008 г., также включено в настоящий документ в качестве ссылки в полном объеме. Перечень последовательностей включен в настоящий документ в качестве ссылки на компакт-диске.
Электронная версия Перечня последовательностей на компакт-диске (CD-R) прилагается к настоящему документу в четырех экземплярах (названных копия 1, копия 2, копия 3 и CRF), содержание которых включено в настоящий документ в качестве ссылки в полном объеме. Машиночитаемые файлы на каждом из вышеупомянутых компакт-дисков, созданные 10 апреля 2009 г., являются идентичными, обладают размером 1200 килобайт и названы 4919SEQ.PC1.TXT.
Область техники
В настоящем изобретении предусмотрены модифицированные белки для лечебных целей. В частности предусмотрены модифицированные полипептиды фактора VII, которые включают фактор VIIa и другие формы фактора VII, и их применение.
Уровень техники
Гемостаз представляет собой комплекс физиологических процессов, приводящий к прекращению кровотечения. Тромбоциты, белки плазмы и кровеносные сосуды с эндотелиальными клетками являются тремя составляющими этого процесса, каждое из них играет важную роль в событиях, которые непосредственно следуют за повреждением тканей и при нормальных обстоятельствах приводят к быстрому образованию сгустка. Центральное место в каскаде свертывания занимает ряд протеолитических актов, в которых некоторые белки плазмы (или факторы свертывания крови) последовательно активируются в "каскаде" другими ранее активированными факторами свертывания, что приводит к быстрому образованию тромбина. Большие количества образованного в этом каскаде тромбина затем расщепляют фибриноген до фибриновых пептидов, которые необходимы для образования сгустка.
Факторы свертывания циркулируют в крови в виде неактивных одноцепочечных зимогенов и активируются путем расщепления по одной или нескольким позициям с образованием двухцепочечной активированной формы белка. Фактор VII (FVII), витамин K-зависимый белок плазмы, первоначально циркулирует в крови как зимоген. Зимоген FVII активируется протеолитическим расщеплением по одному сайту, Arg152-Ile153, с образованием протеазы, состоящей из двух цепей, связанных простой дисуль-фидной связью (FVIIa). FVIIa связывает свой кофактор, тканевый фактор (ТФ), с образованием комплекса, в составе которого FVIIa может эффективно активировать фактор X (FX) в FXa, тем самым начиная серию событий, которые приводят к образованию фибрина и гемостазу.
Несмотря на то, что в большинстве случаев достигается нормальный гемостаз, дефекты в процессе могут привести к кровоточивости, при которой увеличивается необходимое для формирования сгустка время. Такие нарушения могут быть врожденными или приобретенными. Например, гемофилия А и гемофилия В являются наследственными заболеваниями, характеризующимися недостатком фактора VIII (FVIII) и фактора IX (FIX) соответственно. Заместительная терапия является традиционным способом лечения гемофилии А и гемофилии В и включает внутривенное введение фактора VIII или FIX, которые представляют собой полученные из человеческой плазмы или рекомбинантные белки. Во многих случаях, однако, пациенты вырабатывают антитела (также известные как ингибиторы) против вводимых белков, которые уменьшают или сводят на нет эффективность лечения. Рекомбинантный FVIIa (Novoseven(r) (фактор свертывания VIIa (рекомбинантный))) был одобрен для лечения пациентов с гемофилией А или В, у которых присутствуют ингибиторы фактора VIII или FIX, а также для использования для остановки кровотечений или предотвращения кровотечения, связанного с травмой и/или хирургическим вмешательством. Рекомбинантный FVIIa также был одобрен для лечения пациентов с врожденным дефицитом FVII и все чаще используется не по прямому назначению, например для лечения кровотечений, связанных с другими врожденными или приобретенными нарушениями свертываемости крови, травмами и операциями у пациентов, не больных гемофилией.
Применение рекомбинантного FVIIa для ускорения образования сгустка подчеркивает его растущее значение в качестве терапевтического средства. Лечение FVIIa в значительной мере не удовлетворяет медицинские потребности. Например, на основании данных клинических испытаний для помощи пациенту с гемофилией при остром кровотечении в среднем необходимы 3 дозы FVIIa в течение 6 ч или
большего периода времени. Для снижения этих потребностей необходимы более эффективные варианты FVIIa. Таким образом, одной из целей настоящего изобретения является обеспечение модифицированных полипептидов FVII с улучшенными лечебными свойствами.
Сущность изобретения
В настоящем документе представлены модифицированные полипептиды фактора VII (FVII). В частности, здесь представлены модифицированные полипептиды фактора VII, проявляющие прокоагу-лянтную активность. Полипептиды фактора VII обладают модификациями первичной последовательности по сравнению с немодифицированными полипептидами FVII и могут включать аминокислотные вставки, удаления и замены. Предусмотренные в настоящем документе модифицированные полипептиды FVII включают полипептиды FVII, которые обладают повышенной устойчивостью к ингибиторам, таким как антитромбин III (AT-III) и ингибитор пути тканевого фактора (TFPI), полипептиды FVII, которые обладают повышенной устойчивостью к ингибиторному эффекту Zn, полипептиды FVII, которые обладают увеличенной каталитической активностью в присутствии и/или в отсутствие ТФ, полипептиды FVII, которые обладают улучшенными фармакокинетическими свойствами, такими как увеличенный период полураспада, полипептиды FVII, которые обладают повышенной способностью связывать тромбоциты и/или аффинностью к поверхности тромбоцитов, полипептиды FVII с повышенной способностью связывать сывороточный альбумин и/или аффинностью к сывороточному альбумину, и полипептиды FVII с повышенной способностью связывать интегрин тромбоцитов aIIbp3 и/или аффинностью к ин-тегрину тромбоцитов aIIbp3. Модифицированные полипептиды FVII могут содержать любую комбинацию предусмотренных в настоящем документе модификаций, при которой один или более видов активности или свойств полипептида изменены по сравнению с немодифицированным полипептидом FVII. Обычно модифицированный полипептид FVII сохраняет прокоагулянтную активность. Также в настоящем документе предусмотрены молекулы нуклеиновой кислоты, векторы и клетки, которые кодиру-ют/экспрессируют модифицированные полипептиды FVII. В данной заявке представлены также фармацевтические композиции, изделия, наборы и методы лечения. Полипептиды FVII включают аллельные и видовые варианты полипептидов и другие варианты, которые имеют модификации, затрагивающие другие виды активности и/или свойства. Также предусмотрены активные фрагменты полипептидов FVII, которые включают предусмотренные модификации. Примеры полипептидов FVII представляют собой полипептиды, которые включают последовательность аминокислот, приведенную в SEQ ID NO: 3, а также их варианты, обладающие 60, 65, 70, 75, 80, 85, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или большей идентичностью последовательности с ними.
В настоящем документе предусмотрены модифицированные полипептиды FVII (FVII), содержащие модификацию полипептида FVII в позиции Q286 полипептида FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках полипептида FVII. Модификация может представлять собой замену аминокислоты, вставку аминокислоты (аминокислот), удаление аминокислоты (аминокислот) или их комбинацию. Если модификация представляет собой замену аминокислоты, аминокислота может быть заменена на основную аминокислоту (например, Arg (R), Lys (K) и His (Н)) или аминокислоту, выбранную из Arg (R), Lys (K) His (Н), Tyr (Y), GIy (G), Phe (F), Met (M), Ile (I), Leu (L), Val (V), Pro (P), Glu (E), Trp (W), Asp (D) и Cys (С). Примеры таких аминокислотных замен включают Q286R, Q286K, Q286H, Q286Y, Q286G, Q286F, Q286M, Q286I, Q286L, Q286V, Q286P, Q286E,
Q286W, Q286D и Q286C. Такие изменения могут быть введены в немодифицированный полипептид FVII, содержащий последовательность, приведенную в SEQ ID NO: 1-3, или в его аллельный или видовой вариант, или вариант, обладающий, по крайней мере, 60% идентичностью последовательности с FVII SEQ ID NO: 1-3, или изменения могут быть введены в активный фрагмент полипептида FVII, включающий последовательность аминокислот, приведенную в SEQ ID NO: 1-3, или в его аллельный или видовой вариант, или вариант, обладающий по крайней мере 60% идентичностью последовательности с FVII SEQ ID NO: 1-3. Например, модифицированный полипептид FVII может представлять собой активный фрагмент, который включает замену в положении, соответствующем положению Q286 в полипептиде FVII.
В некоторых примерах предусмотренные в настоящем документе модифицированные полипептиды FVII содержат аминокислотную замену в положении, соответствующем положению 286 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или содержат аминокислотную замену в соответствующем остатке в полипептиде FVII, где модификация представляет собой замену в положении 286 на основную аминокислоту, что приводит к модифицированному полипептиду FVII, который проявляет увеличенную коагулянтную активность по сравнению с полипептидом FVII, который не обладает модификацией в положении 286. Основные аминокислоты могут быть выбраны из Arg (R), Lys (K) и His (H). Например, предусмотренный в настоящем документе модифицированный полипептид FVII может содержать замену Gln (Q) на Arg (R) в позиции 286.
В некоторых примерах модифицированные полипептиды FVII включают только одну модификацию в положении 286. В других примерах модифицированные полипептиды FVII также содержат одну или несколько дополнительных модификаций в другом положении в полипептиде FVII. Дополнительная модификация может представлять собой замену аминокислоты, вставку или удаление. Например, допол
нительная модификация может представлять собой замену аминокислоты в положении, выбранном из
А51, S52, Р54, S60, Q66, Y68, К109, S119, А122, G124, Т130, Е132, V158, К161, А175, D196, К197, К199, R202, Н216, S222, G237, Т239, Н257, Q286, L287, R290 А292, А294, Е296, М298, L305, S314, G318, Р321, К337, К341, Q366, Н373, F374, Е394, Р395 и R396. Примеры таких модификаций включают D196K, D196R, D196A, D196Y, D196F, D196W, D196L, D196I, K197Y, К197А, К197Е, K197D, K197L, К197М, K197I, K197V, K197F, K197W, К199А, K199D, К199Е, G237W, G237T, G237I, G237V, Т239А, R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, К341Е, K341R, K341Q, K341N, К341М, K341D, С237Т238вставкаА, G237T238BCTaBKaS, 0237Т238вставкаУ, G237T238BCTaBKaAS, G237Т23 8вставка8 А, 0196К197вставкаК, D196K197BCTaBKaR, 0196К197вставкаУ, 0196К197вставка\У, 0196К197вставкаА, D196К197вставкаМ, К197И98вставкаЕ, К197П98вставкаУ, К197И98вставкаА, К197П98вставка8, T239S, T239N, T239Q, T239V, T239L, Т239Н, T239I, L287T, M298Q, Р321К, Р321Е, P321Y, P321S, Q366D, Q366E, Q366N, Q366T, Q366S, Q366V, Q366I,
Q366L, Q366M, H373D, Н373Е, H373S, H373L, H373I, H373F, Н373А, K161S, К161А, K161V, H216S, Н216А, Н216К, H216R, S222A, S222K, S222V, S222N, S222E, S222D, Н257А, H257S, замена Gla из FIX, {замена Gla из FIX/E40L}, {замена Gla из FIX/K43I}, {замена Gla из FIX/Q44S}, {замена Gla из FIX/MI9K }, {замена Gla из FIX/MI9K7 E40L/K43I/Q44S}, замена Gla из FX, замена Gla из белка С, замена Gla из белка S, замена Gla из тромбина, S52A, S60A, E394N, Р395А, R396S, R202S, A292N, A294S, G318N, A175S, K109N, A122N, G124S, A51N, T130N, E132S, S52N, P54S, S119N, L121S, T128N, Р129А, Q66N, Y68S,
S103S11 lyfl^eHHe/BCTaBKaQRLMEDICLPRWGCLWEDDF, HI 15S126yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, Т128Р134yAaneHHe/BCTaBKaQRLMEDICLPRWGCLWEDDF, SI 03 SI 11 удаление/BCTaBKaIEDICLPRWGCLWE, H115S126yдaлeниe/вcтaвкaIEDICLPRWGCLWE, T128P134yflaneHHe/BCTaBKaIEDICLPRWGCLWE, SI 03 SI 1 lyflaneHHe/BCTaBKaDICLPRWGCLWED, H115S126yfl^eHHe/BCTaBKaDICLPRWGCLWED,
T12 8P13 4удал ение/BCTaBKaDIC LPRWGCL WED, P406BCTaBKaIEDICLPRWGCLW,
P406BCTaBKaGGGSIEDICLPRWGCLW, P406BCTaBKaDICLPRWGCLWED,
P406BCTaBKaGGGSDICLPRWGCLWED , SI03SI 1 ^aneHne/BCTaBKaSFGRGDIRNV,
H115S126yдaлeниe/вcтaвкaSFGRGDIRNV, Tl27P134ynЈmeHHe/BCTaBKaSFGRGDIRNV,
P406BcTaBKaCSFGRGDIRNVC, P406BCTaBKaGGGSCSFGRGDIRNVC, V158T, V158D,
L287T, E296V, M298K и M298Q.
Примеры предусмотренных в данной заявке модифицированных полипептидов FVII включают полипептиды, содержащие модификации
Q286R/M298Q, (}286Шзамена Gla из FIX, Q286R/H257A, Q286R7S222A, Q286R/S222A/H257A, Q286R/S222A/3aMeHa Gla из FIX, Q286R/H257A/3aMeHa Gla из FIX, Q286R7S222A/H257A/ замена Gla из FIX, Q286R/M298Q/K341Q, Q286R/M298Q/K199E, Q286R/M298Q/3aMeHa Gla из FIX, Q286R/Q366V, Q286R/A292N/A294S/Q366V, A175S/Q286R/Q366V, S222A/Q286R/Q366V, H257S/Q286R, H257S/Q286R/Q366V, S222A/H257A/Q286R/Q366V, Q286R/H373A, S222A/H257A/Q286R/M158Q, Q286R/K341D, Q286R/Q366D, Q286R/Q366N, Q286R/M298Q/Q366D, Q286R/M298Q/Q366N, Q286R/H373F, Q286R/M298Q/H373F, {замена Gla из FIX/E40L}/Q286R/M298Q, {замена Gla из FIX/K43I}/Q286R/M298Q, {замена Gla из FIX/Q44S}/Q286R/M298Q, {замена Gla из FIX/MI9K}/Q286R/M298Q, {замена Gla из
FIX/M19K/E40L/K43I/Q44S}/Q286R/M298Q,T128N/P129A/Q286R, T128N/P129A/Q286R/M298Q,T128N/P129A/Q286R/H373F,
V158D/Q286R/E296V/M298Q, замена Gla из FIX/T128N/P129A/S222A/Q286R, замена Gla из FIX/T128N/P129A/Q286R/M298Q, T128N/P129A/S222A/H257A/Q286R/M298Q, T128N/P129A/Q286R/M298Q/H373F, S52A/S60A/Q286R, замена Gla из FIX/S52A/S60A/S222A/Q286R, S52A/S60A/Q286R/M298Q, замена Gla из FIX/S52A/S60A/Q286R/M298Q, S52A/S60A/S222A/H257A/Q286R/M298Q, S52A/S60A/Q286R/H373F/, S52A/S60A/Q286R/M298Q/H373F, T239V/Q286R, замена Gla из FIX/S222A/T239V/Q286R, T239V/Q286R/M298Q,
S222A/T239V/H257A/Q286R/M298Q, замена Gla из FIX/T239V/Q286R/M298Q , T239V/Q286R/H373F, T239V/Q286R/M298Q/H373F, T239I/Q286R, замена Gla из FIX/S222A/T239I/Q286R, T239I/Q286R/M298Q,
S222A/T239I/H257A/Q286R/M298Q, замена Gla из FIX/T239I/Q286R/M298Q, T239I/Q286R/H373F, T239I/Q286R/M298Q/H373F, замена Gla из FIX/S222A/Q286R/H373F, замена Gla из FIX/S222A/Q286R/M298Q, замена Gla из FIX/S222A/Q286R/M298Q/H373F, VI58D/Q286R/E296V/M298Q/H373F, H257A/Q286R/M298Q, H257S/Q286R/M298Q, замена Gla из FIX/S222A/H257S/Q286R/, S222A/H257S/Q286R/M298Q, H257S/Q286R/M298Q/H373F, S222A/Q286R/M298Q/H373F, S222A/Q286R/M298Q, T128N/P129A/A175S/Q286R, A122N/G124S/A175S/Q286R, замена Gla из FIX/T128N/P129A/A175S/S222A/Q286R, замена Gla из FIX/A122N/G124S/A175S/S222A/Q286R, T128N/P129A/A175S/Q286R/M298Q, A122N/G124S/A175S/Q286R/M298Q, T128H/P129A/A175S/S222A/H257A/Q286R/M298Q, Al 22N/G124S/A175 S/S222А/Н257A/Q286R/M298Q, T128N/P129A/A175S/Q286R/M298Q/H373F, A122N/G124S/A175S/Q286R/M298Q/H373F, {замена Gla из FIX/K43I}/T128N/P129A/Q286R/M298Q,
T128N/P129A/Q286R/M298Q/Q366N, {замена Gla из FIX/K43I}/Q286R/M298Q/Q366N,
{замена Gla из FIX/K43I}/T128N/F129A/Q286R/M298Q/Q366N,
VI58D/Q286R/E296V/M298Q, T128N/P129A/Q286R/M298Q/Q366N/H373F,
T239V/Q286R/M298Q/Q366N,T239I/Q286R/M298Q/Q366N,
Т128N/P129 А/Т239V/Q286R/M298Q,
T128N/P129A/S222A/T239V/H257A/Q286R/M298Q,
T128H/P129A/T239V/Q286R/M298Q/H373F,T128H/P129A/T239I/Q286R/M298QHflH Т128N/P129A/T239I/Q286R/M298Q/H373F. В заявке предусмотрены модифицированные полипептиды FVII, содержащие две или более моди
фикаций в полипептиде FVII, их аллельные или видовые варианты или их активные фрагменты. По меньшей мере одна из модификаций в таких полипептидах находится в положении, соответствующем положению Q286 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII, предусмотренном в настоящем документе, при условии, что модификация в положении Q286, отдельно или в сочетании с любой другой модификацией, не приводит к введению нового сайта гликозилирования по сравнению с немодифицированным полипептидом FVII. Такие модификации могут представлять собой замены аминокислот, вставки или удаления. Например, модификация в положении Q286 может представлять собой замену на аминокислоту, выбранную из Arg (R), Lys (K) His (Н), Tyr (Y), Gly (G), Phe (F), Met (M), Ile (I), Leu (L), Val (V), Pro (P), Glu (E), Trp(W), Asp (D) и Cys (С). В некоторых примерах, модификация представляет собой Q286R. Одна или несколько других модификаций может быть выбрана из модификаций
D196K, D196R, D196A, D196Y,
D196F, D196W, D196L, D196I, K197Y, К197А, К197Е, K197D, K197L, К197М, K197I,
K197V, K197F, K197W, К199А, K199D , К199Е, G237W, G237T, G237I, G237V, Т239А,
R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, К341Е, K341R, K341Q,
K341N, К341М, K341D, С237Т238вставкаА, G237T238BCTaBKaS, С237Т238вставкаУ,
G237T238BCTaBKaAS, G237T238BCTaBKaSA , В196К197вставкаК, D196К197BcraBKaR,
D196K197BCTaBKaY, D196K197BCTaBKaW, 0196К197вставкаА, 0196К197вставкаМ,
К197И98вставкаЕ, K197I198BCTaBKaY, К1971198вставкаА, К197П98вставка8, T239S,
T239N, T239Q, T239V, T239L, Т239Н, T239I, L287T, Р321К, Р321Е, P321Y, P321S,
Q366D, Q366E, Q366N , Q366T, Q366S, Q366V, Q366I, Q366L, Q366M, H373D, Н373Е,
H373S, H373F, Н373А, K161S, К161А, K161V, H216S, Н216А, Н216К, H216R, S222A,
S222K, S222V, S222N, S222E, S222D, Н257А , H257S, замена Gla из FDC, {замена Gla
из FDC/E40L}, {замена Gla из FIX/K43I}, {замена Gla из FIX/Q44S}, {замена Gla из
FIX/M19K}, {замена Gla из FDC/M19K/E40L/K43I/Q44S}, замена Gla из FX, замена Gla
из белка С, замена Gla из белка S, замена Gla из тромбина, S52A, S60A, E394N, Р395А,
R396S, R202S, A292N, A294S, G318N, A175S, K109N, A122N, G124S, A51N, T130N ,
E132S, S52N, P54S, S119N, L121S, T128N, Р129А, Q66N, Y68S,
S103S11 lyдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF,
HI 15S126yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, Tl 28Р134yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, S103 S111 удаление/BCTaBKaIEDICLPRWGCL WE, Н115S126yдaлeниe/вcтaвкaIEDICLPRWGCLWE, T128P134yflЈmeHHe/BCTaBKaIEDICLPRWGCLWE, S103S11 lyflaneHHe/BCTaBKaDICLPRWGCLWED, Н115 S126yaaneHHe/BCTaBKaDICLPRWGCLWED,
Tl28P134удаление/вставка01СЕР(tm)ОС1ЛУЕБ, P406BCTaBKaIEDICLPRWGCLW,
P406BcTaBKaGGGSIEDICLPRWGCLW, P406BCTaBKaDICLPRWGCLWED,
P406BCTaBKaGGGSDICLPRWGCLWED, S103S11 lyflaneHHe/ecTaBKaSFGRGDIRNV,
HI 15S126y даление/BCTaBKaSFGRGDIRN V, Tl 27P134y даление/BcraBKaSFGRGDIRN V,
P406BCTaBKaCSFGRGDIRNVC, P406BCTaBKaGGGSCSFGRGDIRNVC, V158T, V158D,
L287T, E296V, M298K и M298Q.
В некоторых примерах модифицированные полипептиды FVII включают модификацию в положении, соответствующем положению Р54, Q66, L121, А122, Р129 или Е132 в полипептиде FVII с аминокислотной последовательностью, приведенной в SEQ ID NO: 3, или включают модификацию в соответствующих остатках в полипептиде FVII. Примеры модификаций включают P54S, Q66N, L121S, A122N, Р129А и E132S. В некоторых примерах модифицированные полипептиды FVII, содержащие модификацию в положении, соответствующем Р54, Q66, L121, А122, Р129 или Е132, также содержат одну или несколько дополнительных модификаций, включая замену аминокислоты, вставку и удаление в другом положении полипептида FVII. Такие модификации включают P54S, S52N, Y58S, S119N, G124S, T128N, T130N, V158D, A175S, S222A, G241S, E296V, M298Q, E394N, Р395А, R396S, G318N и Q366V. Таким
образом, примеры сочетания модификаций полипептида FVII, предусмотренные здесь, включают
S119N/L121S, Tl 28N/P129А, А122N/G124S, А122N/G124S/A175S,
A122N/G124S/E394N/P395A/R396S, A122N/G124S/E394N/P395A/R396S/G318N,
A122N/G124S/E394N/P395A/R396S, S52N/P54S/A122N/G124S/E394N/P395A/R396S,
S52N/P54S, S119N/L121S/A175S, T128N/P129A/A175S, T130N/E132S, Q66N/Y68S,
Tl28N/P129A/V158D/E296V/M298Q, Т128N/P129A/S222А,
T128N/P129A/A175S/Q366V, A122N/G124S/A175S/Q366V, T128N/P129A/A175S/S222A,
A122N/G124S/A175S/S222A , T128N/P129A/M298Q и T128N/P129A/M298Q/H373F.
Кроме того, в настоящем документе предусмотрены модифицированные полипептиды FVII, включающие модификацию
T239S, T239Q, T239V, T239L, Т239Н,
T239I, Р321К, Р321Е, P321Y, P321S, Q366D, Q366N, Q366V, Q366I, Q366L, Q366M,
H373D, Н373Е, H373S, H373F, Н373А, K161S, K161V, H216S, Н216К, H216R, S222A,
S222K, S222V, S222D, S222N, S222E или H257S в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII. Дополнительно такие модифицированные полипептиды FVII также могут содержать одну или несколько дополнительных модификаций в другом положении, например, в аминокислотной позиции
А51, S52, Р54, S60, Q66, Y68, К109, S119, А122, G124, Т130, Е132, V158, К161,
А175, D196, К197, К199, R202, Н216, S222, G237, Т239, Н257, Q286, L287, R290 А292,
А294, Е296, М298, L305, S314, G318, Р321, К337, К341, Q366, Н373, F374, Е394, Р395 и
R396. Примеры модификаций по этим положениям включают Q286N, Q286E, Q286D,
Q286S, Q286T, Q286R, Q286K, Q286A, Q286V, Q286M, Q286L, Q286Y, D196K, D196R,
D196A, D196Y, D196F, D196W, D196L, D196I, K197Y, К197А, К197Е, K197D, K197L,
К197М, K197I, K197V, K197F, K197W, К199А, K199D, К199Е, G237W, G237T, G237I,
G237V, Т239А, R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, К341Е,
K341R, K341Q, K341N, К341М, K341D, 0237Т238вставкаА, G237T238BcTaBKaS,
0237Т238вставкаУ, G237T238BCTaBKaAS, G237T238BciaBKaSA, Э196К197вставкаК,
D196K197BCTaBKaR, D 196К197вставкаУ, D 196К197вставка\У; 0196К197вставкаА,
В196К197встаВкаМ, К1971198вставкаЕ, К197И98вставкаУ, К1971198вставкаА,
K197I198BCTaBKaS, T239S, T239N, T239Q, T239V, T239L, Т239Н, T239I, L287T, Р321К,
Р321Е, P321Y, P321S, Q366D, Q366E, Q366N, Q366T, Q366S, Q366V, Q366I, Q366L,
Q366M, H373D, Н373Е, H373S, H373F, Н373А , K161S, К161А, K161V, H216S, Н216А,
Н216К, H216R, S222A, S222K, S222V, S222N, S222E, S222D, Н257А, H257S, замена Gla
из FIX, замена Gla из FX, замена Gla из белка С, замена Gla из белка S, замена Gla из
тромбина, замена Gla из FIX, {замена Gla из FIX/E40L}, {замена Gla из FIX/K43I},
{замена Gla из FIX/Q44S}, {замена Gla из FIX/M19K}, {замена Gla из
FIX/MI9K/E40L/K43I/Q44S}, S52A, S60A, E394N, Р395А, R396S, R202S, A292N, A294S,
G318N, A175S, K109N, A122N, G124S, A51N, T130N, E132S, S52N, P54S, S119N,
L121S, T128N, Р129А, Q66N, Y68S,
S103S11 ^^eHHe/BCTaBKaQRLMEDICLPRWGCLWEDDF, H115S126yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, T128P134yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, S103S11 lyдaлeниe/вcтaвкaIEDICLPRWGCLWE, Н115S126yfl^eHHe/BCTaBKaIEDICLPRWGCL WE,
Т128Р134yдaлeниe/вcтaвкaIEDICLPRWGCLWE, S103 S111 удаление/BCTaBKaDICLPRWGCLWED, H115S126yдaлeниe/вcтaвкaDICLPRWGCLWED,
T128P134удаление/BCTaBKaDICLPRWGCLWED, P406BCTaBKaIEDICLPRWGCLW, P406BCTaBKaGGGSIEDICLPRWGCLW, P406BCTaBKaDICLPRWGCLWED, P406BCTaBKaGGGSDICLPRWGCLWED, SI03SI 1 lyдaлeниe/вcтaвкaSFGRGDIRNV, H115S126yrianeiffle/BCTaBKaSFGRGDIRNV, T127P134yflaneHHe/BCTaBKaSFGRGDIRNV, P406BCTaBKaCSFGRGDIRNVC, P406BCTaBKaGGGSCSFGRGDIRNVC, V158T, V158D, L287T, M298K и M298Q. Таким образом, комбинация модификаций может включать модификации Q366D/H373E, Q366V/H373V, Q366V/H373L, Q366V/H373I, S222K/H257A, H216A/S222A, S222S/3aMeHa Gla из FIX, S222A/H257А/замена Gla из FIX, S222A/M298Q, S222A/H257A/M298Q, S222A/A292N/A294S/Q366V, A175S/S222A/Q366V, S222A/Q366V, H257S/Q366V, S222A/H373A, M298Q/H373F, S52A/S60A/S222A, S222A/T239V, V158D/T239V/E296V/M298Q, S222A/T239I, V158D/E296V/M298Q/H373F, замена Gla из FIX/Q366V, M298Q/Q366N/H373F,
T239V/M298Q/H373F и T239I/M298Q/H373F.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие две или более модификаций в полипептиде FVII, их аллельные и видовые варианты или активные фрагменты, в которых две или более модификаций аминокислот выбраны из модификаций аминокислот Н216А, Н257А, E394N, Р395А, R396S, K109N, A292N, A175S, Н257А и замена Gla из FIX. Например, предусмотренные в настоящем документе модифицированные полипептиды FVII относятся к полипептидам с модификациями, выбранными из Н216А/Н257А, E394N/P395A/R396S и K109N/A175S. Кроме того, также могут быть включены модификации M298Q или A294S. Таким образом, в настоящем документе также предусмотрены модифицированные полипептиды FVII, включающие модификации, выбранные из Н216А/Н257А, E394N/P395A/R396S и K109N/A175S. В некоторых примерах модифицированные полипептиды FVII также содержат соответствующие модификации M298Q или A294S. Это может привести, например, к модифицированным полипептидам FVII, включающим модификации H257A/M298Q или K109N/A292N/A294S. Также в настоящем документе предусмотрены модифицированные полипептиды FVII, включающие модификации S52A/S60A/V158D/E296V/M298Q или V158D/T239I/E296V/M298.
В некоторых примерах предусмотренные в настоящем документе модифицированные полипептиды FVII содержат связывающую сывороточный альбумин последовательность, такую как последовательность аминокислот, приведенная в любой из последовательностей SEQ ID NO: 103-109, или ее часть, достаточную для связывания сывороточного альбумина. Такие модифицированные полипептиды FVII могут проявлять повышенную аффинность к сывороточному альбумину или повышенную способность связывать сывороточный альбумин по сравнению с немодифицированным полипептидом FVII. Например, модифицированные полипептиды FVII, содержащие связывающую сывороточный альбумин последовательность, могут обладать повышенной аффинностью или повышенной способностью связывать сывороточный альбумин по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более. Связывающая сывороточный альбумин последовательность может заменить непрерывную последовательность аминокислотных остатков немодифицированного полипептида FVII. Модифицированные полипептиды FVII, содержащие связывающую сывороточный альбумин последовательность, могут содержать модификации, выбранные из
SI 03 SI 1 lyfl^eHne/BCTaBKaQRLMEDICLPRWGCLWEDDF,
H115S126yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF,
T128P134yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF,
S103S111 удаление/BCTaBKaIEDICLPRWGCLWE,
H115 S126yдaлeниe/вcтaвкaIEDICLPRWGCLWE,
T128P134yflaneHHe/BCTaBKaIEDICLPRWGCLWE,
SI 03 SI 1 ^^eHHe/BCTaBKaDICLPRWGCLWED,
HI 15 S12 6y д ал ение/BCTaBKaDICLPRWGCL WED,
T128P134yдaлeниe/вcтaвкaDICLPRWGCLWED, P406BCTaBKaIEDICLPRWGCLW,
P406BCTaBKaGGGSIEDICLPRWGCLW, P406BCTaBKaDICLPRWGCLWED и
P406BCTaBKaGGGSDICLPRWGCLWED.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие связывающую интегрин тромбоцитов aIIb|33 последовательность. Такие модифицированные полипептиды FVII могут проявлять повышенную аффинность или связывание с интегрином тромбоцитов aIIbf33 по сравнению с немодифицированным полипептидом FVII. Например, модифицированные полипептиды FVII, содержащие связывающую интегрин тромбоцитов aIIb|33 последовательность, могут обладать аффинностью или связыванием с интегрином тромбоцитов aIIb|33 повышенным по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более по сравнению с немодифицированным полипептидом FVII. Примеры связывающей сывороточный альбумин последовательности, которая может заменить непрерывную последовательность аминокислотных остатков немодифицированного полипептида FVII, включают последовательности аминокислот, приведенные в любой из SEQ ID NO: 110-112, или их части, достаточные для связывания интегрина тромбоцитов aIIb|33. Модифицированные полипептиды FVII содержат модификации, выбранные из
S103S11 lyдалeниe/вcтавкаSFGRGDIRNV, Н115S126yflaneHHe/BCTaBKaSFGRGDIRNV, T127P134yдaлeниe/вcтaвкaSFGRGDIRNV, P406BCTaBKaCSFGRGDIRNVC и P406BCTaBKaGGGSCSFGRGDIRNVC. Модифицированные полипептиды FVII, содержащие связывающие сывороточный альбумин или интегрин тромбоцитов aIIb|33 последовательности, также могут содержать одну или несколько дополнительных модификаций в других положениях полипептида FVII, таких как замена аминокислоты в положении, соответствующем положению G237V. Таким образом, в настоящем документе также предусмотрены модифицированные полипептиды FVH, содержащие модификации,
выбранные из S103Slllyдалeниe/вcтавкаIEDICLPRWGCLWE/G237V,
S103S11 lynjuieHHe/BCTaBKaDICLPRWGCLWED/G237V,
H115S126yflaneHHe/BCTaBKaQRLMEDICLPRWGCLWEDDF/G237V,
HI 15 S12 6y дал ение/BCTaBKalEDICLPRWGCL WE/G237V,
H115S126yдaлeниe/вcтaвкaDICLPRWGCLWED/G237V,
T128P134yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF/G237V,
T128P134yflЈmeHHe/BCTaBKaIEDICLPRWGCLWE/G23 7V,
S103S11 lyдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF/G237V и
T128P134yдaлeниe/вcтaвкaDICLPRWGCLWED/G237V.
В некоторых примерах в настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие 2, 3, 4, 5, 6, 7 или более модификаций. В дополнительных примерах предусмотренные в настоящем документе модифицированные полипептиды FVII содержат гетерологичный домен Gla или его часть, достаточную для связывания фосфолипидов. Такие полипептиды могут проявлять повышенную аффинность или повышенное связывание с фосфолипидами по сравнению с немодифицированным полипептидом FVII, например аффинность или связывание с фосфолипидами, повышенные по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более. Гетерологичные домены Gla могут быть выбраны из домена Gla фактора IX (FIX), фактора X (FX), протромбина, белка С, белка S, остеокальцина, матриксного белка Gla, Growth-arrest-specific белка 6 (Gas6) и белка Z и в некоторых примерах могут иметь последовательность
аминокислот, приведенную в любой из SEQ ID NO: 83-91, 93 и 94, или ее часть, достаточную для связывания фосфолипидов. Нативный домен Gla фактора FVII или его непрерывная часть, которая может включать аминокислоты 1-45 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или соответствующие остатки в полипептиде FVII, можно удалить и заменить гетероло-гичным доменом Gla, или его частью, достаточной для связывания фосфолипидов. Предусмотренные в настоящем документе модифицированные полипептиды FVII могут обладать повышенной устойчивостью к антитромбину III по сравнению с немодифицированным полипептидом FVII. Такие модифицированные полипептиды FVII могут обладать большей устойчивостью к антитромбину III по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более по сравнению с устойчивостью немодифицированного полипептида FVII. Предусмотренные в настоящем документе модифицированные полипептиды FVII также могут обладать повышенной каталитической или коагулянтной активностью по сравнению с немодифицирован-ным полипептидом FVII, например повышенной по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% и более по сравнению с немодифицированным полипептидом FVII. Кроме того, модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут обладать повышенной устойчивостью к TFPI по сравнению с немодифицированным полипептидом FVII. Такие модифицированные полипептиды FVII могут быть более устойчивы к TFPI по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% и более по сравнению с не-модифицированным полипептидом FVII. Предусмотренные в настоящем документе модифицированные полипептиды FVII также могут обладать повышенной устойчивостью к ингибиторному эффекту Zn2+ по сравнению с немодифицированными полипептидами FVII. Например, модифицированные полипептиды FVII могут быть более устойчивы к ингибиторному эффекту Zn2+ по меньшей мере приблизительно на 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% и более по сравнению с немодифицированными полипептидами FVII.
В некоторых примерах предусмотренные в настоящем документе модифицированные полипептиды FVII содержат одну или несколько модификаций, которые вводят и/или ликвидируют один или несколько сайтов гликозилирования по сравнению с немодифицированным полипептидом FVII. Например, 1, 2,
3, 4, 5, 6 или более сайтов гликозилирования могут быть введены или ликвидированы. Сайты гликозили-рования, которые могут быть введены или ликвидированы, включают сайты N-гликозилирования и О-гликозилирования. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут содержать одну или несколько других модификаций аминокислот, повышающих устойчивость к антитромбину-III, увеличивающих связывание и/или аффинность к фосфолипидам, повышающих аффинность к тканевому фактору, увеличивающих собственную активность, увеличивающих ТФ-зависимую активность, увеличивающих коагулянтную активность, изменяющих конформацию полипептида для изменения зимогенности, увеличивающих каталитическую или коагулянтную активность, сдвигающих равновесие между высокоактивной и менее активной конформациями FVIIa в пользу высокоактивной конформации, повышающих устойчивость к протеазам, уменьшающих гликозилирование, увеличивающих гликозилирование, снижающих иммуногенность, повышающих стабильность и/или способствующих связыванию химических групп. В некоторых примерах измененная зимогенность относится к более зимогенподобной форме или менее зимогенподобной форме.
В некоторых примерах модифицированные полипептиды FVII, предусмотренные в настоящем документе, содержат одну или несколько других модификаций аминокислот, выбранных из
S279C/V302C, L280C/N301C, V281C/V302C,
S282C/V299C, вставки тирозина в положение 4, F4S, F4T, P10Q, Р10Е, P10D, P10N,
Q21N, R28F, R28E, I30C, I30D, I30E, K32D, K32Q, К32Е, K32G, К32Н, К32Т, К32С,
К32А, K32S, D33C, D33F, D33E, D33K, А34С, А34Е, A34D, A34I, A34L, А34М, A34V, A34F, A34W, A34Y, R36D, R36E, Т37С, T37D, Т37Е, К38С, К38Е, К38Т, K38D, K38L, K38G, К38А, K38S, K38N, К38Н, L39E, L39Q, L39H, W41N, W41C, W41E, W41D, I42R, I42N, I42S, I42A, I42Q, I42N, I42S, I42A, I42Q, I42K, S43Q, S43N, Y44K, Y44C, Y44D, Y44E, S45C, S45D, S45E, D46C, A51N, S53N, G58N, G59S, G59T, К62Е, K62R, K62D, K62N, K62Q, К62Т, L65Q, L65S, L65N, F71D, F71Y, F71E, F71Q, F71N, P74S, Р74А, А75Е, A75D, Е77А, E82Q, E82N, E82S, Е82Т Т83К, N95S, N95T, G97S, G97T, Y101N, D104N, T106N, K109N, E116D, G117N, G124N, S126N, T128N, L141C, L141D, L141E, E142D, E142C, K143C, K143D, K143E, R144E, R144C, R144D, N145Y, N145G, N145F, N145M, N145S, N1451, N145L, N145T, N145V, N145P, N145K, N145H, N145Q, N145E, N145R, N145W, N145D, N145C, K157V, K157L, K157I, K157M, K157F, K157W, K157P, K157G, K157S, K157T, K157C, K157Y, K157N, K157E, K157R, K157H, K157D, K157Q, V158L, V158I, V158M, V158F, V158W, V158P, V158G, V158S, V158T, V158C, V158Y, V158N, V158E, V158R, V158K, V158H, V158D, V158Q, A175S, A175T, G179N, 1186S5 1186T, V188N, R202S, R202T, I205S, I205T, D212N , E220N, I230N, P231N, P236N, G237N, Q250C, V253N, E265N, T267N, E270N, A274M, A274L, A274K, A274R, A274D, A274V, A274I, A274F, A274W, A274P, A274G, A274T, A274C, A274Y, A274N , A274E, A274H, A274S, A274Q, F275H, R277N, F278S, F278A. F278N, F278Q, F278G, L280N, L288K, L288C, L288D, D289C, D289K, L288E, R290C, R290G, R290A, R290S, R290T, R290K, R290D, R290E, G291E, G291D, G291C, G291N, G291K, A292C, A292K, A292D, A292E, T293K, E296V, E296L, E296I, E296M, E296F, E296W, E296P, E296G, E296S, E296T, E296C, E296Y, E296N, E296K, E296R, E296H, E296D, E296Q, M298Q, M298V, M298L, M298I, M298F, M298W, M298P, M298G, M298S, M298T, M298C, M298Y, M298N, M298K, M298R, M298H, M298E, M298D, P303S, P303T, R304Y, R304F, R304L, R304M, R304G, R304T, R304A, R304S, R304N, L305V, L305Y, L305I, L305F, L305A, L305M, L305W, L305P, L305G, L305S, L305T, L305C, L305N, L305E, L305K, L305R, L305H, L305D, L305Q, M306D, M306N, D309S, D309T, Q312N, Q313K, Q313D, Q313E, S314A, S314V, S3141, S314M, S314F, S314W, S314P, S314G, S314L, S314T, S314C, S314Y, S314N, S314E, S314K, S314R, S314H, S314D, S314Q, R315K, R315G, R315A, R315S, R315T, R315Q, R315C, R315D, R315E, K316D, K316C, K316E, V317C, V317K, V317D, V317E, G318N, N322Y, N322G, N322F, N322M, N322S, N3221, N322L, N322T, N322V, N322P, N322K, N322H, N322Q, N322E, N322R, N322W, N322C, G331N, Y332S, Y332A, Y332N, Y332Q, Y332G, D334G, D334E, D334A, D334V, D334I, D334M, D334F, D334W, D334P, D334L, D334T, D334C, D334Y, D334N, D334K, D334R, D334H, D334S,
D334Q, S336G, S336E, S336A, S336V, S336I, S336M, S336F, S336W, S336P, S336L, S336T, S336C, S336Y, S336N, S336K, S336R, S336H, S336D, S336Q, K337L, K337V, K337I, К337М, K337F, K337W, К337Р, K337G, K337S, К337Т, К337С, K337Y, K337N, К337Е, K337R, К337Н, K337D, K337Q, К341Е, K341Q, K341G, К341Т, К341А, K341S, G342N, H348N, R353N, Y357N, 136IN, F374P, F374A, F374V, F374I, F374L, F374M, F374W, F374G, F374S, F374T, F374C, F374Y, F374N, F374E, F374K, F374R, F374H, F374D, F374Q, V376N, R379N, L390C, L390K, L390D, L390E, M391D, M391C, M391K, M391N, M391E, R392C, R392D, R392E, S393D, S393C, S393K, S393E, E394K, P395K, E394C, P395D, P395C, P395E, R396K, R396C, R396D, R396E, P397D, P397K, P397C P397E, G398K, G398C, G398D, G398E, V399C, V399D, V399K, V399E, L400K, L401K, L401C, L401D, L401E, R402D, R402C, R402K, R402E, A403K, A403C, A403D, A403E, P404E, P404D, P404C, P404K, F405K, P406C, K32N/A34S, K32N/A34T, F31N/D33S, F31N/D33T, I30N/K32S, I30N/K32T, A34N/R36S, A34N/R36T, K38N/F40S, K38N/F40T, T37N/L39S, T37N/L39T, R36N/K38S, R36N/K38T, L39N/W41S, L39N/W41T, F40N/I42S, F40N/I42T, I42N/Y44S, I42N/Y44T, Y44N/D46S, Y44N/D46T, D46N/D48S, D46N/D48T, G47N/Q49S, G47N/Q49T, K143N/N145S, K143N/N145T, E142N/R144S, E142N/R144T, L141N/K143S, L141N/K143T, I140N/E142S, I140N/E142T, R144N/A146S, R144N/A146T,
A146N/K148S,
A146N/K148T,
S147N/P149S/,
S147N/P149T,
R290N/A292S,
R290N/A292T,
D289N/G291S,
D289N/G291T,
L288N/R290S,
L288N/R290T,
L287N/D289S,
L287N/D289T,
A292N/A294S,
A292N/A294T,
T293N/L295S,
T293N/L295T,
R315N/V317S,
R315N/V317T,
S314N/K316S,
S314N/K316T,
Q313N/R315S,
Q313N/R315T,
K316N/G318S,
K316N/G318T,
V317N/D319S,
V317N/D319T,
K341N/D343S,
K341N/D343T,
S339N/K341S,
S339N/K341T,
D343N/G345S,
D343N/G345T,
R392N/E394S,
R392N/E394T,
L390N/R392S,
L390N/R392T,
K389N/M391S,
K389N/M391T,
S393N/P395S,
S393N/P395T,
E394N/R396S,
E394N/R396T,
P395N/P397S,
P395N/P397T,
R396N/G398S,
R396N/G398T,
P397N/V399S,
P397N/V399T,
G398N/L400S,
G398N/L400T,
V399N/L401S,
V399N/L401T,
L400N/R402S,
L400N/R402T,
L401N/A403S,
L401N/A403T, R402N/P404S, R402N/P404T, A403N/F405S, A403N/F405T, P404N/P406S и P404N/P406T.
В некоторых примерах модифицированные полипептиды FVII также содержат замещение позиций 300-322, 305-322, 300-312 или 305-312 соответствующими аминокислотами трипсина, тромбина или FX или содержат замещение позиций 310-329, 311-322 или 233-329 соответствующими аминокислотами трипсина.
Примеры модифицированных полипептидов FVII, предусмотренных в настоящем документе, имеют последовательности аминокислот, приведенные в любой из SEQ ID NO: 113-273. В некоторых примерах модификации вводят в немодифицированный полипептид FVII, который представляет собой аллель-ный или видовой вариант полипептида, приведенного в SEQ ID NO: 3. Аллельный, или видовой, или другой вариант может обладать 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% идентичности последовательности с полипептидом, приведенном в SEQ ID NO: 3, исключая модификацию аминокислоты (аминокислот). Модифицированный полипептид FVII, предусмотренный в настоящем документе, может представлять собой человеческий полипептид, не человеческий полипептид и/или зрелый полипептид. В некоторых примерах модифицирована только первичная последовательность. В других примерах также включены химическая модификация или пост-трансляционные модификации. Например, модифицированный полипептид FVII может быть гликозилирован, карбоксилирован, гидроксилирован, сульфатирован, фосфорилирован, альбуминирован или конъюгирован с полиэтиленгликольным (ПЭГ) фрагментом.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут представлять собой одноцепочечные полипептиды, двухцепочечные полипептиды и/или быть активными или активированными. Активация может быть осуществлена протеолитическим расщеплением в процессе самоактивации, расщеплением фактором IX (FIX), расщеплением фактором X (FXa), расщеплением фактором XII (FXIIa) или расщеплением тромбином.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут сохранить
один или более видов активности немодифицированного полипептида FVII. Например, модифицированные полипептиды FVII могут содержать модификации в 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 или в 60 аминокислотных позициях, пока полипептид сохраняет по меньшей мере одну активность немодифици-рованного полипептида FVII. Такие модифицированные полипептиды FVII могут сохранять по меньшей
мере приблизительно 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100, 200, 300, 400,
500% или более активности немодифицированного полипептида FVII. В некоторых примерах один или более видов активности выбраны из связывания тканевого фактора (ТФ), активации фактора X (FX), активации фактора IX (FIX), связывания фосфолипидов и коагулянтной активности. Кроме того, сохраненные активности могут быть увеличены или уменьшены по сравнению с немодифицированным полипептидом FVII. В некоторых примерах коагулянтная активность увеличена по сравнению с немодифициро-ванным полипептидом FVII, например увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII. Активность может быть измерена in vitro, ex vivo или in vivo.
В настоящем документе предусмотрены молекулы нуклеиновой кислоты, содержащие последовательность нуклеотидов, кодирующую модифицированные полипептиды FVII по изобретению. Также предусмотрены векторы, содержащие такие молекулы нуклеиновой кислоты, в том числе прокариотиче-ские векторы, вирусные векторы или эукариотические векторы, такие как векторы млекопитающих. Вирусные векторы могут быть выбраны из аденовируса, адено-ассоциированного вируса, ретровируса, вируса герпеса, лентивируса, поксвируса и цитомегаловируса. В настоящем документе предусмотрены клетки, содержащие эти векторы, в том числе эукариотические клетки, такие как клетки млекопитающих. Примером клеток млекопитающих являются клетки почки детеныша хомяка (BHK-21), клетки 293 или клетки СНО. В некоторых примерах клетки экспрессируют модифицированный полипептид FVII. Таким образом, в настоящем документе также предусмотрены модифицированные полипептиды FVII, продуцируемые этими клетками.
В настоящем документе предусмотрены фармацевтические композиции, содержащие терапевтически эффективную концентрацию или количество любого модифицированного полипептида FVII, молекулы нуклеиновой кислоты, вектора или клеток, предусмотренных в настоящем документе, в фармацевтически приемлемом носителе. В некоторых примерах фармацевтическая композиция составлена для локального, системного или местного введения, такого как оральное, носовое, легочное, буккальное, трансдермальное, подкожное, интрадуоденальное, энтеральное, парентеральное, внутривенное или внутримышечное введение. Фармацевтические композиции также могут быть составлены для контролируемого высвобождения и/или введения одной дозой.
В настоящем документе предусмотрены способы лечения введением субъекту предусмотренной в настоящем документе фармацевтической композиции, где субъект страдает заболеванием или состоянием, которое поддается лечению введением FVII или прокоагулянта, например введением активного FVII (FVIIa). В некоторых примерах лечение фармацевтической композицией улучшает или смягчает симптомы, связанные с заболеванием или состоянием. В других примерах способы лечения, предусмотренные в настоящем документе, также включают наблюдение за изменением у субъекта симптомов, связанных с заболеванием или состоянием, которое подвергается лечению введением FVII или прокоагулянта. Заболевания или состояния, подвергающиеся лечению по способам, предусмотренным здесь, могут быть выбраны из нарушений свертывания крови, гематологических нарушений, геморрагических расстройств, гемофилий (таких как гемофилия А, гемофилия В или гемофилия С, врожденная или приобретенная гемофилия), дефицита фактора VII и нарушений, связанных с кровотечением, в том числе кровотечением, вызванным операцией (такой как операция на сердце, ангиопластика, операция на легких, абдоминальная операция, операция на позвоночнике, операция на головном мозге, операция на сосудах, стоматологическая операция или трансплантация органов) или травмой. В некоторых примерах, кровотечение проявляется в виде острых гемартрозов, хронической гемофильной артропатии, гематомы, гематурии, кровотечения в центральной нервной системе, желудочно-кишечного кровотечения или кровоизлияния в мозг. В дополнительных примерах кровотечение происходит из-за удаления зубов. Трансплантационная хирургия может представлять собой трансплантацию костного мозга, сердца, легких, поджелудочной железы и печени.
В некоторых примерах предусмотренный здесь способ лечения может быть использован для лечения субъекта, который вырабатывает аутоантитела к фактору VIII или фактору IX. Способы, предусмотренные здесь, также могут включать введение одного или нескольких дополнительных факторов свертывания крови, таких как очищенные из плазмы или рекомбинантные факторы свертывания, прокоагулян-тов, включая витамин K, производные витамина K и ингибиторы белка С, плазмы, тромбоцитов, эритроцитов и кортикостероидов или лекарственных средств.
В настоящем документе предусмотрены изделия, содержащие упаковочный материал и фармацевтическую композицию, предусмотренную в настоящем документе, помещенную в упаковочный материал. В некоторых примерах модифицированные полипептиды FVII, содержащиеся в фармацевтической композиции, эффективны для лечения связанного с FVII заболевания или нарушения, а упаковочный
материал включает этикетку, указывающую, что модифицированные полипептиды FVII используют для лечения связанного с FVII заболевания или нарушения. Кроме того, в настоящем документе предусмотрены комплекты, включающие описанную здесь фармацевтическую композицию, устройство для введения композиции и, при необходимости, инструкции для введения.
Краткое описание фигур На фиг. 1 представлен каскад свертывания крови. Показаны внутренний и внешний пути свертывания, приводящие к независимому образованию FXa, и схождение путей в общей путь для образования тромбина и фибрина с образованием сгустка. Эти пути взаимосвязаны. На чертеже изображен порядок молекул, участвующих в активации каскада, в котором зимоген преобразуется в активированную протеа-зу путем расщепления одной или нескольких пептидных связей. Активированная протеаза затем служит активирующей протеазой для следующей молекулы зимогена в каскаде, что, в конечном счете, приводит к образованию сгустка.
На фиг. 2 приведена клеточная модель свертывания (см., например, Hoffman и др., (2001) Thromb Haemost 85:958-965). Изображены акты коагуляции, разделенные на три этапа, где начало коагуляции осуществляется путем активации FX с образованием FXa под действием ТФ/FVIIa комплекса на несущей ТФ клетке, в результате чего образуется небольшое количество тромбина в результате активации FXa/ FVa комплексом. Усиление каскада происходит при связывании тромбина с тромбоцитами и их активации, что инициирует активацию достаточного количества соответствующих факторов свертывания крови для образования FVIIIa/FIX и FVa/FXa комплексов. Распространение коагуляции происходит на поверхности большого количества активированных тромбоцитов в месте повреждения, что приводит к быстрому увеличению количества тромбина, образующего достаточное количество фибрина из фибриногена для формирования сгустка в месте повреждения.
На фиг. 3 приведены механизмы, посредством которых FVIIa могут инициировать образование тромбина. Фиг. 3 иллюстрирует ТФ-зависимый путь образования тромбина фактором FVIIa, который действует на поверхности ТФ-несущей клетки и включает образование комплекса FVIIa с ТФ для активации FX с образованием FXa. На фигуре также показаны ТФ-независимые пути образования тромбина фактором FVIIa, в ходе которых FVIIa связывается с фосфолипидами на поверхности активированных тромбоцитов и активирует FX в FXa, который, в свою очередь, образует комплекс с FVa и расщепляет протромбин с образованием тромбина.
Подробное раскрытие изобретения
Последовательность изложения.
A. Определения
B. Обзор гемостаза
1. Адгезия и агрегация тромбоцитов
2. Свертывание
a. Инициация
b. Усиление
c. Распространение
3. Регуляция свертывания
C. Фактор VII (FVII)
1. Структура и организации FVII
2. Пост-трансляционные модификации
3. Процессинг FVII
4. Активация FVII
5. Функции FVII
a. Зависимая от тканевого фактора активность FVIIa
b. He зависимая от тканевого фактора активность FVIIa
6. FVII как лекарственное средство
D. Модифицированные полипептиды FVII 1. Увеличение каталитической активности
а. Примеры изменений для увеличения каталитической активности
1. Основные аминокислотные замены в положении 286.
II. Другие мутации в положении 286.
2. Повышенная устойчивость к АТ-III. Примеры модификаций для достижения повышенной устойчивости к АТ-III.
3. Повышенная устойчивость к ингибированию Zn2+. Примеры модификаций для повышения устойчивости к ингибированию Zn2+.
4. Изменение гликозилирования. Примеры модификаций для изменения гликозилирования.
5. Увеличение связывания сывороточного альбумина и/или интегрина тромбоцитов aIIbp3.
a. Примеры полипептидов FVII со связывающей сывороточный альбумин последовательностью.
b. Примеры полипептидов FVII со связывающей интегрин тромбоцитов aIIbp3 последовательностью
6. Модификация введением гетерологичного домена Gla
7. Дополнительные модификации и их комбинации
a. Модификации, которые повышают устойчивость к TFPI
b. Модификации, которые увеличивают собственную активность
c. Модификации, которые повышают устойчивость к протеазам
d. Модификации, которые повышают аффинность к фосфолипидам
e. Модификации, которые изменяют гликозилирование
f. Модификации, которые облегчают связывание химических групп
g. Примеры сочетания мутаций
E. Получение полипептидов FVII
1. Векторы и клетки
2. Системы экспрессии
a. Прокариотические системы экспрессии
b. Дрожжи
c. Насекомые и клетки насекомых
d. Клетки млекопитающих
e. Растения
2. Очистка
3. Гибридные белки
4. Модификации полипептидов
5. Нуклеотидные последовательности
F. Оценка активности модифицированных полипептидов FVII
1. In vitro тесты
a. Пост-трансляционные модификации
b. Протеолитическая активность
c. Коагулянтная активность
d. Связывание с другими белками и/или ингибирование другими белками
e. Связывание фосфолипидов
2. Не человеческие животные модели
3. Клинические анализы
G. Композиции и введение
1. Композиции
a. Дозировки
b. Лекарственные формы
2. Введение модифицированных полипептидов FVII
3. Введение нуклеиновой кислоты, кодирующей модифицированные полипептиды FVII (генная терапия)
H. Терапевтическое применение
I. Врожденные связанные с кровоточивостью нарушения
a. Гемофилии
b. дефицит FVII
c. другие
2. Приобретенные нарушения свертываемости крови
a. приобретенная в результате химиотерапии тромбоцитопения
b. другие коагулопатии
c. кровотечение вследствие трансплантации
d. кровотечение вследствие антикоагулянтной терапии
e. приобретенная гемофилия
3. Кровотечения вследствие травмы и хирургического вмешательства I. Комбинированная терапия
J. Изделия и комплекты K. Примеры А. Определения.
Если не указано иное, все технические и научные термины, используемые здесь, имеют тот же смысл, как это обычно понимается специалистом в области техники, к которой относится изобретение. Если не указано иное, все патенты, заявки, опубликованные заявки и публикации, последовательности Genbank, базы данных, веб-сайты и другие опубликованные материалы, упомянутые в настоящем документе, приведены в качестве ссылки в полном объеме. Если для упоминаемого в настоящем документе термина существует множество определений, предпочтительно приведенное в этом разделе определение. В случае приведения ссылки на URL или другого подобного идентификатора или адреса понимается, что идентификатор может изменяться и информация в сети Интернет может появляться и исчезать, но аналогичную информацию можно найти в сети Интернет. Подобная ссылка свидетельствует о наличии ин
формации и открытом доступе. В настоящем документе термины "путь свертывания" или "свертывание" относятся к серии актов активации, которые приводят к образованию нерастворимого сгустка фибрина. В каскаде или пути свертывания неактивные сериновые протеазы (также называемые зимогенами) превращаются в активные протеазы путем расщепления одной или нескольких пептидных связей, указанные протеазы затем служат для активации следующей молекулы протеазы в каскаде. На конечном этапе про-теолитического каскада фибриноген протеолитически расщепляется тромбином с образованием фибрина, который затем сшивается в месте повреждения и формирует сгусток. В настоящем документе термин "гемостаз" относится к остановке кровотечения или притока крови в орган или часть тела. Термин гемостаз может охватывать весь процесс свертывания крови для предотвращения потери крови после повреждения кровеносного сосуда и последующее растворение тромба после восстановления тканей.
В настоящем документе термины "коагуляция" или "свертывание" относятся к образованию нерастворимых сгустков фибрина или к процессу, посредством которого факторы свертывания крови взаимодействуют в каскаде свертывания, что, в конечном счете, приводит к образованию нерастворимых сгустков фибрина.
"Протеаза" представляет собой фермент, который катализирует гидролиз ковалентной пептидной связи. Этот термин включает зимогенную форму и активированные одноцепочечную и двухцепочечную формы протеаз. Упоминание протеазы относится ко всем формам. В зависимости от каталитической активности их активного центра и механизма расщепления пептидных связей в целевом субстрате протеа-зы включают, например, сериновые протеазы, цистеиновые протеазы, аспарагиновые протеазы, треони-новые протеазы и металлопротеазы. В настоящем документе сериновые протеазы или сериновые эндо-пептидазы относятся к классу пептидаз, которые характеризуются наличием остатка серина в активном центре фермента. Сериновые протеазы участвуют в широком спектре функций в организме, в том числе в свертывании крови и воспалении, а также функционируют в качестве пищеварительных ферментов у прокариот и эукариот. Механизм расщепления связей сериновыми протеазами основан на нуклеофиль-ной атаке целевой пептидной связи серином. Цистеин, треонин или молекула воды, связанная с аспарта-том или металлом, также могут играть эту роль. Выровненные боковые цепи серина, гистидина и аспар-тата формируют каталитическую триаду, общую для большинства сериновых протеаз. Активный центр сериновых протеаз представляет собой расщелину, где связывается полипептидный субстрат.
Рассматриваемый в настоящем документе фактор VII (FVII, F7, также упоминается как фактор 7, фактор свертывания VII, сывороточный фактор VII, сывороточный ускоритель преобразования протромбина, SPCA, проконвертин и эптаког а) относится к сериновым протеазам, которые являются частью каскада свертывания. FVII включает домен Gla, два EGF домена (EGF-1 и EGF-2) и домен сериновой протеазы (или пептидазный домен S1), который высоко консервативен у всех членов семейства пептида-зы S1 сериновых протеаз, например химотрипсина. Последовательность примера предшественника FVII с сигнальным пептидом и пропептидом приведена в SEQ ID NO: 1. Пример зрелого полипептида FVII приведен в SEQ ID NO: 3. FVII встречается в одноцепочечной зимогенной, зимогеноподобной двухцепо-чечной цепи и полностью активированной двухцепочечной форме. Полная активация, которая происходит при конформационном изменении зимогеноподобной формы, происходит при связывании с кофактором фермента, тканевым фактором. Кроме того, могут быть введены мутации, приводящие к конфор-мационным изменениям в отсутствие тканевого фактора. Следовательно, упоминание FVII включает его одноцепочечные и двухцепочечные формы, включая зимогеноподобную и полностью активированную двухцепочечные формы.
При упоминании полипептида FVII также подразумевают полипептиды-предшественники и зрелые полипептиды FVII в одноцепочечной или двухцепочечной форме, их активные усеченные формы, подразумевают аллельные варианты и видовые варианты, варианты, кодируемые вариантами сплайсинга, и другие варианты, в том числе полипептиды по меньшей мере на 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или более идентичные последовательности предшественника полипептида, приведенной в SEQ ID NO: 1 или последовательности его зрелой формы. Также подразумевают модифицированные полипептиды FVII, такие как приведенные в SEQ ID NO: 113 и 273 и их варианты. Также подразумевают полипептиды, которые сохраняют по меньшей мере одну активность FVII, такую как связывание ТФ, связывание фактора X, связывание фосфолипидов и/или коагулянтная активность FVII. При сохранении активности она может быть изменена, например снижена или повышена по сравнению с FVII дикого типа, пока уровень сохраненной активности достаточен для получения заметного воздействия. Полипептиды FVII включают, но не ограничиваются, тканеспецифическими изоформами и их аллельными вариантами, синтетическими молекулами, полученными трансляцией нуклеиновых кислот, белками, полученными химическим синтезом, таким как синтез, который включает лигирование коротких полипептидов, белками, полученными рекомбинантными методами, белками, выделенными из человеческих и не человеческих тканей и клеток, химерными полипептидами FVII и их модифицированными формами. FVII полипептиды также включают фрагменты или части FVII, которые имеют достаточную длину или включают соответствующие районы для сохранения по меньшей мере одного вида активности (при активации при необходимости) полноразмерного зрелого полипептида. Полипептиды FVII также включают полипептиды с химическими или посттрансляционными модификациями и полипептиды без химических или
посттрансляционных модификаций. Такие модификации включают, но не ограничиваются, пегилирова-нием, альбуминированием, гликозилированием, фарнизилированием, карбоксилированием, гидроксили-рованием, фосфорилированием и другими известными в уровне техники модификациями полипептидов.
Примеры полипептидов FVII включают полипептиды млекопитающих, включая человека. Примеры аминокислотных последовательностей FVII человеческого происхождения приведены в SEQ ID № 1, 2 и 3. Примеры вариантов таких человеческих полипептидов FVII включают любые полипептиды-предшественники, приведены в SEQ ID NO: 18-74. Полипептиды FVII также включают любые полипептиды не человеческого происхождения, включая, но не ограничиваясь, мышиными, собачьими, кошачьими, заячьими, птичьими, бычьими, бараньими, свиными, лошадиными, рыбьими, лягушачьими полипептидами и полипептидами фактора VII приматов. Примеры FVII полипептидов не человеческого происхождения включают, например, полипептиды коровы (Bos taurus, SEQ ID NO: 4), мыши (Mus гшшсшш, SEQ ID NO: 5), карликового шимпанзе (Pa^anis^s, SEQ ID NO: 6), шимпанзе (Pan troglodytes, SEQ ID NO: 7), кролика (O^^o^gus сшисшш, SEQ ID NO: 8), крысы (Rattus norvegkms, SEQ ID NO: 9), резус-макаки (Масаса mulatto, SEQ ID NO: 10), свиньи (Sus sCTofa, SEQ ID NO: 11), собаки (Canis familiaris, SEQ ID NO: 12), полосатого данио (Bradiydanio rerio, SEQ ID NO: 13), рыбы фугу (Fugu rubripes, SEQ ID NO: 14), курицы (Gallus Gallus , SEQ ID NO: 15), орангутанга (Pongo pygmaeus, SEQ ID NO: 16) и гориллы (Gorilla gorilla, SEQ ID NO: 17).
Специалисту в данной области техники очевидно, что указанные позиции зрелого полипептида фактора VII (SEQ ID NO: 3) отличаются на 60 аминокислотных остатков от позиций изоформы предшественника полипептида FVII, приведенной в SEQ ID NO: 1, где изоформа полипептида фактора VII содержит сигнальный пептид и пропептидную последовательность. Таким образом, первая аминокислота из SEQ ID NO: 3 соответствует шестьдесят первому (61) аминокислотному остатку из SEQ ID NO: 1. Специалисту в данной области также очевидно, что указанные позиции зрелого полипептида фактора VII (SEQ ID NO: 3) отличаются на 38 аминокислотных остатков от позиций предшественника полипептида FVII, приведенного в SEQ ID NO: 2, который представляет собой изоформу b полипептида фактора VII, содержащую сигнальный пептид и пропептидную последовательность. Таким образом, первый аминокислотный остаток из SEQ ID NO: 3 соответствует тридцать девятому (39) аминокислотному остатку из
SEQ ID NO: 2.
В настоящем документе "соответствующие остатки" относятся к остаткам, которые находятся в соответствующих локусах. Близкие полипептиды или варианты полипептидов могут быть выровнены любым способом, известным специалистам в данной области. При таких способах обычно добиваются максимального совпадения, и способы включают выравнивание вручную и выравнивание с помощью многочисленных доступных программ выравнивания (например, BLASTP и другие известные специалистам в данной области программы). По выравниванию последовательностей полипептидов специалист в данной области может определить соответствующие остатки, используя консервативные и идентичные аминокислотные остатки в качестве ориентиров. Например, за счет выравнивания последовательностей полипептидов фактора VII, используя консервативные и идентичные аминокислотные остатки в качестве ориентиров, специалист в данной области может определить соответствующие остатки. Например, ала-нин в положении 1 (А1) из SEQ ID NO: 3 (зрелый фактор VII) соответствует аланину в положении 61 (А61) из SEQ ID NO: 1 и аланину в положении 39 (A39) из SEQ ID NO: 2. В других случаях могут быть идентифицированы соответствующие районы. Например, домен Gla соответствует аминокислотным позициям с А1 до F45 из SEQ ID NO: 3, аминокислотным позициям с А61 до S105 из SEQ ID NO: 1 и аминокислотным позициям с А39 до S83 из SEQ ID NO: 2. Специалист в данной области также может использовать консервативные аминокислотные остатки в качестве ориентиров для нахождения соответствующих аминокислотных остатков между человеческими и не человеческими последовательностями и среди человеческих и не человеческих последовательностей. Например, аминокислотные остатки с S43 до Е163 из SEQ ID NO: 3 (человеческий) соответствуют остаткам с S83 до Е203 из SEQ ID NO: 4 (бычий). Нахождение соответствующих позиций также может быть основано на структурном выравнивании, например компьютерном выравнивании, структуры белка. В других случаях могут быть идентифицированы соответствующие районы. В настоящем документе термины "прорайон", "пропептид" или "пропос-ледовательность" относятся к домену или сегменту, которые расщепляются с образованием зрелого белка. Они могут включать сегменты, функционирующие для подавления протеолитической активности, маскирующие каталитический центр и, таким образом, предотвращающие образование каталитического интермедиата (т.е. пространственно блокирующие сайт связывания субстрата). Прорайон представляет собой аминокислотную последовательность, расположенную на N-конце зрелого биологически активного полипептида, и может состоять всего лишь из нескольких аминокислот или представлять собой многодоменную структуру.
В настоящем документе термин "зрелый фактор VII" относится к полипептиду FVII, у которого отсутствует сигнальная последовательность и пропептидная последовательность. Как правило, сигнальная последовательность направляет белок для секреции через эндоплазматический ретикулум (ЭР) и через аппарат Гольджи и отщепляется после прохождения в ЭР в процессе трансляции. Пропептидная последовательность функционирует при посттрансляционной модификации белка и отщепляется до секреции
белка из клетки. Таким образом, зрелый белок FVII представляет собой секретируемый белок. В одном примере зрелый человеческий полипептид FVII приведен в SEQ ID NO: 3. Приведенная в SEQ ID NO: 3 аминокислотная последовательность отличается от последовательностей полипептидов-предшественников, приведенных в SEQ ID NOS: 1 и 2, в последовательности SEQ ID NO: 3 отсутствует сигнальная последовательность, которая соответствует остаткам 1-20 в SEQ ID NOS: 1 и 2; и отсутствует пропептидная последовательность, соответствующая аминокислотным остаткам 21-60 в SEQ ID NO: 1 и аминокислотным остаткам 21-38 в SEQ ID NO: 2. Упоминание зрелого полипептида FVII относится к одноцепочечной зимогенной форме и двухцепочеченой форме.
В настоящем документе термины "белок дикого типа" или "нативный белок" по отношению к полипептиду FVII обозначают полипептид FVII, кодируемый нативным или встречающимся в естественных условиях геном, включая аллельные варианты, присутствующие в организме, таком как человек или другие животные. Упоминание фактора VII дикого типа без упоминания вида относится к факторам VII дикого типа любого вида. Полипептиды FVII дикого типа включают полипептиды-предшественники, их фрагменты и процессированные формы, включая полипептиды без сигнального пептида, а также любые их пре- или посттрансляционно процессированные формы. Полипептиды FVII дикого типа также включают посттрансляционно модифицированные полипептиды, включая, но не ограничиваясь гликозилиро-ванными, карбоксилированными и гидроксилированными полипептидами. Нативные полипептиды FVII также включают одноцепочечные и двухцепочечные формы. Например, у людей экспрессируется натив-ный FVII. Примеры аминокислотной последовательности человеческого FVII дикого типа приведены в SEQ ID NOS: 1, 2 и 3, а аллельные варианты и их зрелые формы приведены в SEQ ID NOS: 44-100. Другие животные также производят нативный FVII, включая, но не ограничиваясь, коровой (Bos taurus, SEQ ID NO: 4), мышью (Mus musCTilus, SEQ ID NO: 5), карликовым шимпанзе (Pa^anis^s, SEQ ID NO: 6), шимпанзе (Pan troglodytes, SEQ ID NO: 7), кроликом (O^^o^gus стпсшш, SEQ ID NO: 8), крысой (Rat-tus norvegicus, SEQ ID NO: 9), резус-макакой (Масаса mulatto, SEQ ID NO: 10), свиньей (Sus sCTofa, SEQ ID NO: 11), собакой (Canis familiaris, SEQ ID NO: 12), полосатым данио (Bradiydanio rerio, SEQ ID NO: 13), рыбой фугу (Fugu rabripes, SEQ ID NO: 14), курицей (Gallus Gallus, SEQ ID NO: 15), орангутангом (Pongo pygmaeus, SEQ ID NO: 16) и гориллой (Gorilla gorilla, SEQ ID NO: 17).
В настоящем документе "видовые варианты" относятся к вариантам полипептидов среди различных видов, в том числе различных видов млекопитающих, таких как мышь и человек. В настоящем документе аллельные варианты относятся к изменениям в белках среди представителей одного и того же вида. В настоящем документе варианты сплайсинга относятся к вариантам, образованным в результате различного процессинга первичного транскрипта геномной ДНК, что приводит к более чем одному типу мРНК.
В настоящем документе термин "зимоген" относится к протеазам, которые активируются посредством протеолитического расщепления, в том числе расщепления, приводящего к созреванию, такого как активационное расщепление, и/или посредством образования комплекса с другим белком(белками) и/или кофактором(кофакторами). Зимоген является неактивным предшественником протеолитических ферментов. Такие предшественники, обычно, хотя и не обязательно, обладают большим размером, чем активная форма белка. Зимогены сериновых протеаз преобразуются в активные ферменты путем специфического расщепления, в том числе каталитического и автокаталитического расщепления, или путем связывания активирующего кофактора, которое приводит к активному ферменту. Как правило, зимогены присутствуют в одноцепочечной форме. Зимогены, как правило, являются неактивными и могут быть преобразованы в зрелый активный полипептид каталитическим или автокаталитическим расщеплением по одному или нескольким протеолитическим сайтам с образованием мультицепочечного, такого как двухцепочеч-ный, полипептида. Зимоген, таким образом, представляет собой ферментативно неактивный белок, который преобразуется в протеолитический фермент под действием активатора. Расщепление может быть осуществлено посредством самоактивации. Множество белков свертывания представляют себя зимоге-ны, они неактивны, но расщепляются и активируются при инициировании системы свертывания после повреждения сосуда. Полипептиды FVII существуют в плазме крови в виде зимогенов до расщепления протеазами, такими как, например, активированный фактор IX (FIX), активированный фактор X (FXa), активированный фактор XII (FXIIa), тромбин, или до самоактивации с образованием зимогеноподобной двухцепочечной формы, которая затем требует дальнейшего изменения конформации для полноценной активности.
В настоящем документе "зимогеноподобный" белок или полипептид относится к белку, который был активирован протеолитическим расщеплением, но еще обладает свойствами, которые связывают белок с зимогеном, такими как, например, низкая или нулевая активность или конформация, которая напоминает конформацию зимогенной формы белка. Например, при отсутствии связи с тканевым фактором двухцепочечная активированная форма FVII является зимогеноподобным белком, она сохраняет похожую на нерасщепленный зимоген FVII конформацию и поэтому обладает очень низкой активностью. При связывании с тканевым фактором двухцепочечная активированная форма FVII претерпевает конформационные изменения и приобретает свою полную активность фактора свертывания.
В настоящем документе "активационная последовательность" относится к аминокислотной последовательности зимогена, которая представляет собой сайт, необходимый для активационного расщепле
ния или расщепления для созревания с образованием активной протеазы. Расщепление активационной последовательности может быть автокаталитическим или катализироваться активирующим партнером.
В настоящем документе "активационное расщепление" является одним из видов расщепления для созревания, которое вызывает изменение конформации, необходимое для проявления полной ферментативной активности. Это классический путь активации, например, для сериновых протеаз, в которых расщепление приводит к появлению нового N-конца, взаимодействующего с консервативным районом про-теазы, таким как Asp194 в химотрипсине, что вызывает конформационные изменения, необходимые для проявления активности. Активация может привести к образованию мультицепочечной формы протеазы. В некоторых случаях одноцепочечная форма протеазы может проявлять протеолитическую активность.
Используемый в настоящем документе термин "активированный фактор VII" или "FVIIa" относится к любой двухцепочечной форме полипептида FVII. Двухцепочечная форма обычно является результатом протеолитического расщепления, но может быть получена синтетическим путем. Активированный фактор VII, таким образом, включает зимогеноподобную двухцепочечную форму с низкой коагулянтной активностью, полностью активированную форму (с приблизительно в 1000 раз большей активностью), которая образуется при связывании с тканевым фактором, и мутированные формы, которые существуют в полностью активированной двухцепочечной форме или проходят конформационные изменения с образованием полностью активированной формы. Например, одноцепочечная форма полипептида FVII (см., например, SEQ ID NO: 3) претерпевает протеолитическое расщепление между аминокислотными остатками R152 и 1153 зрелого полипептида FVII. Продукты расщепления, тяжелая цепь FVII и легкая цепь FVII, которые удерживаются вместе дисульфидной связью (между аминокислотными остатками С135 и С262 в FVII из SEQ ID NO: 3), образуют двухцепочечный активированный FVII фермент. Протеолитиче-ское расщепление может быть осуществлено, например, активированным фактором IX (FIX), активированным фактором X (FXa), активированным фактором XII (FXIIa), тромбином или путем самоактивации.
В настоящем документе "свойство" полипептида FVII относится к физическим или структурным свойствам, таким как трехмерная структура, pI, период полураспада, конформация и другие подобные физические характеристики.
В настоящем документе "активность" полипептида FVII относится к любой активности, проявляемой полипептидом фактора VII. Такие активности могут быть исследованы in vitro и/или in vivo и включают, но не ограничиваются, свертывание или коагулянтную активность, прокоагулянтную активность, протеолитическую или каталитическую активность, такую как активация фактора X (FX) или активация фактора IX (FIX), антигенность (способность связываться с анти-FVII антителом или конкурировать с полипептидом за связывание с анти-FVII антителом), способность связывать тканевый фактор, фактор X или фактор IX и/или способность связываться с фосфолипидами. Активность может быть оценена in vitro или in vivo с использованием признанных тестов, например путем измерения свертывания in vitro или in vivo. Результаты таких анализов показывают, что полипептид проявляет активность, которая может коррелировать с активностью полипептида in vivo, где in vivo активность может быть оценена как биологическая активность. Анализы для определения функциональности или активности модифицированной формы FVII известны специалистам в данной области. Примеры тестов для оценки активности полипептида FVII включают анализ на тромбопластиновое время (ТВ), или анализ на активированное частичное тромбопластиновое время (АЧТВ) для оценки коагулянтной активности, или анализы с использованием хромогенных синтетических субстратов, как описано в примерах ниже, для оценки каталитической или протеолитической активности.
В настоящем документе выражение "проявление по меньшей мере одного вида активности" или "сохранение по меньшей мере одного вида активности" относится к активности модифицированного полипептида FVII по сравнению с немодифицированным полипептидом FVII того же вида и в тех же условиях. Например, модифицированный полипептид FVII в двухцепочечной форме сравнивают с немоди-фицированным полипептидом FVII в двухцепочечной форме в одинаковых экспериментальных условиях, где различием между двумя полипептидами является только модификация исследуемого полипептида. В качестве другого примера модифицированный полипептид FVII в одноцепочечной форме сравнивают с немодифицированным полипептидом FVII в одноцепочечной форме в одинаковых экспериментальных условиях, где различием между двумя полипептидами является только модификация исследуемого полипептида. Как правило, модифицированный полипептид FVII, который сохраняет и проявляет по меньшей мере один вид активности немодифицированного полипептида FVII в такой же форме, сохраняет активность в достаточной степени, поэтому при введении in vivo модифицированный полипептид FVII терапевтически эффективен в качестве прокоагулянтного лекарственного средства. В большинстве случаев для проявления терапевтической эффективности в качестве прокоагулянта модифицированный полипептид FVII должен сохранить приблизительно 0,5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более от активности немодифици-рованного полипептида FVII в той же форме, который проявляет терапевтическую эффективность как прокоагулянт. Активность, которая необходима для поддержания терапевтической эффективности в качестве прокоагулянта, может быть определена эмпирически, если это необходимо. Как правило, сохранение от 0,5 до 20%, от 0,5 до 10%, от 0,5 до 5% активности достаточно для сохранения терапевтической
эффективности в качестве прокоагулянта in vivo.
Подразумевается, что проявляемая или сохраненная модифицированным полипептидом FVII активность может представлять собой любую активность, включая, но не ограничиваясь коагуляцией или коагулянтной активностью, прокоагулянтной активностью; протеолитической или каталитической активностью, такой как активация фактора X (FX) или активация фактора IX (FIX); антигенностью (способностью связываться с анти-FVII антителом или конкурировать с полипептидом за связывание с анти-FVII антителом); способностью связывать тканевый фактор, фактор X или фактор IX; и/или способностью связываться с фосфолипидами. В некоторых случаях модифицированный полипептид FVII может сохранять активность FVII, при этом активность увеличена по сравнению с немодифицированным полипептидом FVII. В некоторых случаях модифицированный полипептид FVII может сохранять активность, при этом активность снижена по сравнению с немодифицированным полипептидом FVII. Активность модифицированного полипептида FVII может составлять любой процент от активности немодифициро-ванного полипептида, включая, но не ограничиваясь, 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более от активности немодифицированного полипептида, где оба полипептида представлены в одной форме. Например, модифицированный полипептид FVII может обладать повышенной или пониженной активностью по сравнению с немодифицированным полипептидом FVII в той же форме. Например, он может сохранить по меньшей мере приблизительно 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98% или по меньшей мере 99% от активности немодифи-цированного полипептида FVII. В других вариантах активность увеличена по меньшей мере приблизительно в 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 раз или более по сравнению с немодифицированным FVII. Конкретный уровень сохраненной активности зависит от предполагаемого использования полипептида и может быть определен эмпирически. Активность может быть измерена, например, с использованием in vitro или in vivo анализов, таких как анализы, описанные здесь или в примерах ниже.
В настоящем документе "активность свертывания", "коагулянтная активность" или "прокоагулянт-ная активность" относятся к способности полипептида вызывать коагуляцию. Анализы для оценки коа-гулянтной активности известны специалистам в данной области и включают анализ на протромбиновое время (ПВ) или анализ на активированное частичное тромбопластиновое время (АЧТВ).
В настоящем документе термины "каталитическая активность" или "протеолитическая активность" со ссылкой на FVII относятся к способности белка FVII катализировать протеолитическое расщепление субстрата и являются взаимозаменяемыми. Анализы для оценки такой активности известны в данной области техники. Например, протеолитическая активность FVII может быть измерена с помощью хромо-генных субстратов, таких как субстрат Spe^K^ine FVIIa (CH3SO2-D-CHA-But-Arg-pNA), где за расщеплением субстрата следят по оптическому поглощению и скорость гидролиза субстрата определяют с помощью линейной регрессии.
В настоящем документе термин "собственная активность" со ссылкой на FVII относится к каталитической, протеолитической и/или коагулянтной активности белка FVII в отсутствие тканевого фактора.
В настоящем документе термин "домен" (представляет собой последовательность из трех или более, как правило 5, 7 и более аминокислот) относится к части молекулы, такой как белок или кодирующая нуклеиновая кислота, которая структурно и/или функционально отличается от других частей молекулы и является идентифицируемой. Например, домены включают те участки полипептидной цепи, которые способны самостоятельно формировать складчатую структуру в белке, состоящую из одного или нескольких структурных мотивов и/или распознаваемую по функциональной активности, такой как про-теолитическая активность. Белок может иметь один или несколько различных доменов. Например, домен может быть идентифицирован, определен или различен по гомологии последовательности в близких членах семейства, такой как гомология с мотивами, которые определяют протеазный домен или Gla домен. В другом примере домен можно отличить по его функции, например по протеолитической активности или способности взаимодействовать с биомолекулами, например, по связыванию ДНК, связыванию лиганда и димеризации. Домен самостоятельно может проявлять биологическую функцию или активность, так что домен самостоятельно или при слиянии с другой молекулой может проявлять активность, такую как, например, протеолитическая активность или способность связывать лиганд. Домен может представлять собой линейную последовательность аминокислот или не линейную последовательность аминокислот. Многие полипептиды содержат множество доменов. Такие домены известны и могут быть идентифицированы специалистами в данной области. Для иллюстративных целей в настоящем документе приводятся определения, но подразумевается, что специалист в данной области может распознать конкретный домен по названию. Если необходимо, для выявления доменов может быть использовано соответствующее программное обеспечение.
В настоящем документе "протеазный домен" представляет собой каталитически активную часть протеазы. Упоминание протеазного домена протеазы подразумевает одно-, двух- и мультицепочечные формы любого из белков по настоящему изобретению. Протеазный домен белка содержит все необходимые свойства для проявления его протеолитической активности, такие как, например, каталитический центр. Протеазный домен FVII обладает гомологией и структурным сходством с протеазными доменами
белков семейства химотрипсина/трипсина, включая каталитическую триаду. Например, в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, протеазный домен соответствует аминокислотным позициям с 153 до 392.
В настоящем документе "у-карбоксиглутаматный (Gla) домен" относится к части белка, например витамин K-зависимого белка, которая содержит посттрансляционные модификации путем витамин K-зависимого карбоксилирования глутаматных аминокислотных остатков, как правило, большей части, но не всех глутаматных аминокислотных остатков. Gla домен ответственен за высокоаффинное связывание ионов кальция и связывание отрицательно заряженных фосфолипидов. Как правило, домен Gla начинается на N-конце зрелой формы витамин K-зависимых белков и заканчивается консервативным ароматическим остатком. В зрелом полипептиде FVII домен Gla соответствует аминокислотным позициям с 1 по 45 в примере полипептида, приведенном в SEQ ID NO: 3. Домены Gla хорошо известны и их локусы в конкретных полипептидах могут быть определены. Домены Gla различных витамин K-зависимых белков обладают гомологией последовательности, структурной и функциональной гомологией, включая кластеризацию N-концевых гидрофобных остатков в гидрофобную группу, которая выступает посредником во взаимодействии с отрицательно заряженными фосфолипидами на поверхности мембраны клетки. Примеры других Gla-содержащих полипептидов включают, но не ограничиваются, FIX, FX, протромбином, белком С, белком S, остеокальцином, белком Gla, Growth-arrest-specific белком 6 (Gas6) и белком Z. Домены Gla этих и других белков приведены в любой из последовательностей SEQ ID NO: 83-94.
Используемые в настоящем документе термины "нативный" или "эндогенный" со ссылкой на домен Gla относятся к нативному домену Gla, связанному со всем полипептидом или частью полипептида, обладающего доменом Gla. Для целей настоящего изобретения нативный домен Gla упоминают в связи с полипептидом FVII. Например, нативный домен Gla из FVII, приведенный в SEQ ID NO: 92, соответствует аминокислотам 1-45 из последовательности аминокислот, приведенной в SEQ ID NO: 3.
В настоящем документе "гетерологичный домен Gla" представляет собой домен Gla из полипептида того же вида или другого вида, который не является Gla доменом FVII.
Примеры гетерологичного домена Gla включают домены Gla из Gla-содержащих полипептидов, включая, но не ограничиваясь, FIX, FX, протромбин, белок С, белок S, остеокальцин, матриксный белок Gla, Growth-arrest-specific белоком 6 (Gas6) и белком Z. Домены Gla этих и других белков приведены в любой из последовательностей SEQ ID NO: 83-91, 93 и 94.
В настоящем документе "непрерывная часть домена Gla" относится по меньшей мере к двум или нескольким непрерывно соединенным аминокислотам, как правило, 2, 3, 4, 5, 6, 8, 10, 15, 20, 30, 40 или более аминокислотам вплоть до всех аминокислот, которые составляют домен Gla.
Используемый в настоящем документе термин "достаточная для связывания фосфолипидов часть домена Gla" относится по меньшей мере к одной аминокислоте, как правило, 2, 3, 4, 5, 6, 8, 10, 15 или более аминокислотам домена, но менее чем всем аминокислотам домена, при этом полипептид, который содержит такие аминокислоты, связывает фосфолипиды.
Используемый в настоящем документе термин "замена" по отношению к домену Gla или термин "замена домена Gla" относится к процессу, посредством которого эндогенный домен Gla белка заменен с использованием рекомбинантных, синтетических или других методов на домен Gla другого белка. В контексте "замены домена Gla" "домен Gla" представляет собой любой набор аминокислот из домена Gla и соседних районов, который сохраняет способность связывать фосфолипиды. Как правило, замена домена Gla включает замену от 40 до 50 аминокислот эндогенного белка последовательностью от 40 до 50 аминокислот другого белка, но может включать меньше или больше аминокислот.
Используемый в настоящем документе термин "домен эпидермального фактора роста" (EGF) (EGF-1 или EGF-2) относится к части белка, обладающей гомологией последовательности со специфической частью последовательности эпидермального фактора роста (EGF), включающей от 30 до 40 аминокислотных остатков. EGF домен включает шесть остатков цистеина, которые (в EGF) образуют дисульфид-ные связи. Основой структуры домена EGF является двухцепочечный р-лист, за которым следует петля с коротким С-концевым двухцепочечным листом. FVII включает два домена EGF: EGF-1 и EGF-2. Эти домены соответствуют аминокислотным позициям 46-82 и 87-128 соответственно, в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3.
В настоящем документе термины "немодифицированный полипептид" или "немодифицированный FVII" и их грамматические модификации относятся к исходному полипептиду, который был выбран для модификации, как это предусмотрено в настоящем документе. Исходный полипептид может представлять собой природную форму, дикий тип полипептида. Кроме того, исходный полипептид может быть изменен или мутирован, так что он отличается от нативной изоформы дикого типа, но, тем не менее, полипептид может упоминаться в настоящем документе в качестве исходного немодифицированного полипептида по отношению к последующей его модификации, производимой по настоящему документу. Таким образом, известные в уровне техники белки, которые были изменены для получения желаемого увеличения или уменьшения конкретного вида активности или свойства по сравнению с немодифицирован-ным белком, могут быть выбраны и использованы в качестве исходного немодифицированного полипеп
тида. Например, белок, который был изменен относительно его нативной формы путем одной или нескольких аминокислотных замен и который обладает увеличенным или уменьшенным требуемым свойством, например белок, в котором модифицирован аминокислотный остаток или остатки для изменения гликозилирования, может представлять собой целевой белок для дальнейшей модификации того же или другого свойства и упоминаться в настоящем документе как немодифицированный. Примеры модифицированных полипептидов FVII известны и включают любые полипептиды FVII описанные, например, в патентах США №№ 5580560, 6017882, 6693075, 6762286 и 6806063, опубликованных заявках США №№ 20030100506 и 20040220106 и международных заявках №№ WO 1988010295, WO 200183725, WO 2003093465, WO 200338162, WO 2004083361, WO 2004108763, WO 2004029090, WO 2004029091, WO 2004111242 и WO 2005123916.
Используемые здесь термины "модифицированные полипептиды фактора VII" и "модифицированный фактор VII" относятся к полипептиду FVII, который обладает одним или более отличиями аминокислотной последовательности по сравнению с немодифицированным полипептидом фактора VII. Одно или несколько отличий аминокислотной последовательности могут представлять собой мутации аминокислот, такие как одну или несколько аминокислотных замен (замещений), вставок и удалений или могут представлять собой вставку и удаление целых доменов, а также любые их комбинации. Как правило, модифицированный полипептид FVII обладает одним или несколькими модификациями первичной последовательности по сравнению с немодифицированным полипептидом FVII. Например, модифицированный полипептид FVII, предусмотренный в настоящем документе, может обладать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 или более аминокислотными отличиями по сравнению с немодифицированным полипептидом FVII. Любые модификации допустимы, пока полученный полипептид проявляет по меньшей мере одну активность нативного полипептида FVII, такую как, например, каталитическая активность, протеолитическая активность, способность связывать ТФ или способность связываться с активированными тромбоцитами.
В настоящем документе термин "ингибиторы коагуляции" относится к белкам или молекулам, которые ингибируют или предотвращают свертывание или образование сгустков. Ингибирование или предотвращение коагуляции можно наблюдать in vivo или in vitro и проанализировать с помощью любого способа, известного в уровне техники, включая, но не ограничиваясь анализом тромбопластинового времени (ТВ) или активированного частичного тромбопластинового времени (АЧТВ).
В настоящем документе "ингибитор пути тканевого фактора" (TFPI, также известный как TFPI-1) является ингибитором Кунитца, который участвует в формировании четвертичного ТФ/FVIIa/TFPI/FXa ингибиторного комплекса, в котором активность FVIIa ингибирована. После альтернативного сплайсинга TFPI экспрессируется с образованием двух предшественников, TFPIa (SEQ ID NO: 75) и TFPip (SEQ ID NO: 77) предшественников, которые расщепляются во время секреции с образованием зрелых белков, содержащих 276 аминокислот (SEQ ID NO: 76) и 223 аминокислоты (SEQ ID NO: 78) соответственно. TFPI содержит 3 домена Кунитца, из которых домен Кунитца 1 отвечает за связывание и ингибирование FVIIa. В настоящем документе TFPI-2 (также известный как плацентарный белок 5 (РР5) и связанный с матриксом ингибитор сериновых протеаз (MSPI)) относится к гомологу TFPI. Состоящий из 213 аминокислот зрелый белок TFPI-2 (SEQ ID NO: 79) содержит три домена Кунитца, которые обладают 43, 35 и 53% идентичности первичной последовательности с доменами Кунитца 1, 2, 3 TFPI-1 соответственно. TFPI-2 играет роль в регуляции расщепления и реконструкции внеклеточного матрикса и не считается важным фактором свертывания.
В настоящем документе "антитромбин III" (AT-III) относится к ингибиторам сериновых протеаз (серпинам). АТ-III синтезируется в виде белка-предшественника, содержащего 464 аминокислотных остатка (SEQ ID NO: 95), который расщепляется во время секреции с образованием зрелого антитромбина, включающего 432 аминокислоты (SEQ ID NO: 96).
В настоящем документе "кофакторы" относятся к белкам или молекулам, которые связываются с другими специфическими белками или молекулами с образованием активного комплекса. В некоторых примерах связывание с кофактором необходимо для оптимальной протеолитической активности. Например, тканевый фактор (ТФ) является кофактором FVIIa. Связывание FVIIa для ТФ индуцирует конфор-мационные изменения, которые приводят к увеличению протеолитической активности FVIIa по отношению к его субстратам, FX и FIX.
В настоящем документе "тканевый фактор" (ТФ) относится к трансмембранному гликопротеину, включающему 263 аминокислоты (SEQ ID NO: 97), который функционирует в качестве кофактора для FVIIa. Тканевый фактор конститутивно экспрессируется в гладкомышечных клетках и фибробластах и способствует инициации коагуляции путем связывания FVII и FVIIa при контакте указанных клеток с кровотоком после повреждения тканей.
В настоящем документе "активированные тромбоциты" относятся к тромбоцитам, в которых связывание молекул, таких как коллаген, тромбоксан А2, АДФ и тромбин индуцирует различные изменения в морфологии, фенотипе и функции клеток, что, в конечном счете, способствует коагуляции. Например, форма активированных тромбоцитов изменяется на более аморфную форму с пальцеобразными выступами. Активированные тромбоциты также претерпевают "флип-переход" клеточной мембраны, заклю
чающийся в перемещении фосфатидилсерина и других отрицательно заряженных фосфолипидов, которые обычно присутствуют на внутренней стороне клеточной мембраны, на внешнюю, обращенную к плазме поверхность мембраны. Мембраны активированных тромбоцитов представляют собой поверхность, на которой осуществляются многие из реакций свертывания. Активированные тромбоциты также секретируют везикулы, содержащие такие прокоагулянтные факторы, как фактора Виллебранда, FV, тромбин, АДФ и тромбоксан А2, и склеиваются друг с другом с образованием тромбоцитной пробки, которая стабилизируется фибрином с формированием сгустка.
В настоящем документе термин "увеличенное связывание и/или увеличенная аффинность к активированным тромбоцитам", а также любые его грамматические изменения относятся к увеличению способности полипептида или белка, например полипептида FVII, связываться с поверхностью активированных тромбоцитов по сравнению с исходным полипептидом или белком. Например, способность модифицированного полипептида FVII связываться с активированными тромбоцитами может быть больше, чем способность немодифицированного полипептида FVII связываться с активированными тромбоцитами. Связывание и/или аффинность полипептида к активированным тромбоцитам может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со связыванием и/или аффинностью немодифицированного полипептида. Анализы для определения связывания и/или аффинности полипептида к активированным тромбоцитам известны в области техники. Связывание полипептида FVII с активированными тромбоцитами опосредуется взаимодействием аминокислот в домене Gla полипептида FVII с отрицательно заряженными фосфо-липидами, такими как фосфатидилсерин, на активированных тромбоцитах. Таким образом, способы анализа связывания полипептидов, таких как полипептиды FVII, с активированными тромбоцитами основаны на использовании мембран ивезикул, которые содержат фосфолипиды, такие как фосфатидилсерин. Например, способность полипептида связываться с активированными тромбоцитами отражается на способности полипептида связываться с фосфолипидными везикулами, которую можно измерить с помощью рассеяния света.
В настоящем документе термин "увеличенное связывание и/или аффинность к фосфолипидам", а также любые его грамматические изменения относятся к увеличению способности полипептида или белка связываться с фосфолипидами по сравнению с исходным полипептидом или белком. Фосфолипиды могут включать любые фосфолипиды, но особенно фосфатидилсерин. Связывание и/или аффинность полипептида к фосфолипидам может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со связыванием и/или аффинностью немодифицированного полипептида. Анализы для определения аффинности и/или связывания полипептида с фосфолипидами известны в уровне техники. Например, связывание полипептида FVII с фосфолипидными везикулами может быть определено по относительному рассеянию света под углом 90° к падающему свету. Для определения константы диссоциации измеряют интенсивность рассеяния света на фосфолипидных везикулах и на фосфолипидных везикулах с FVII. Для измерения аффинности полипептидов FVII к фосфолипидным мембранам также может быть использован поверхностный плазмонный резонанс, например, измеренный на биосенсоре BIAcore.
В настоящем документе "повышенная устойчивость к ингибиторам", "повышенная устойчивость к АТ-III" или "повышенная устойчивость к TFPI" относятся к любому снижению чувствительности полипептида к действию ингибитора, такого как АТ-III или TFPI, по сравнению с начальным полипептидом, таким как немодифицированный полипептид FVII. Повышенная устойчивость к ингибитору, такому как АТ-III, может быть оценена по связыванию модифицированного полипептида FVII с ингибитором. Повышенная устойчивость к ингибиторам, таким как АТ-III, также может быть оценена путем измерения собственной активности или коагулянтной активности полипептида FVII в присутствии АТ-III. Анализы для определения связывания полипептида с ингибитором известны в уровне техники. Для ковалентных ингибиторов, таких как, например, АТ-III, может быть измерена константа скорости второго порядка для ингибирования. Для нековалентных ингибиторов, таких как, например, TFPI, может быть измерена константа ингибирования. Кроме того, для измерения связывания полипептидов FVII с АТ-III или другими ингибиторами также может быть использован поверхностный плазмонный резонанс, измеренный, например, с помощью биосенсора BIAcore. Однако для ковалентных ингибиторов, таких как АТ-III, с помощью BIAcore может быть измерена только скорость ассоциации. Анализы для определения ингиби-торного эффекта, например ингибиторного эффекта АТ-III, на коагулянтную активность или собственную активность FVII также известны в уровне техники. Например, может быть измерена способность модифицированного полипептида FVII расщеплять его субстрат FX при наличии или в отсутствие АТ-III, при этом может быть определена степень, в которой АТ-III ингибирует реакцию. Полученные результаты можно сравнить со способностью немодифицированного полипептида FVII расщеплять его субстрат FX при наличии или в отсутствие АТ-III. Модифицированный полипептид может обладать повышенной устойчивостью к ингибитору, например, повышенной на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более устойчивостью к воздействию ингибитора по сравнению с немодифицированным полипептидом.
Используемые в настоящем документе термины "повышенная устойчивость к ингибированию
Zn2+", "повышенная устойчивость к ингибиторному эффекту Zn2+" или "повышенная устойчивость к Zn2+" означают любое уменьшение чувствительности полипептида к ингибиторному эффекту Zn2+ по сравнению с начальным полипептидом, таким как немодифицированный полипептид FVII. Повышенная устойчивость к Zn2+ может быть оценена, например, по измерению собственной активности или коагу-лянтной активности полипептида FVII в присутствии Zn, как описано в примере 11. Повышенная устойчивость к ингибиторному эффекту Zn2+ может быть результатом снижения связывания с Zn2+. Снижение связывания Zn2+ может быть оценено путем измерения количества связанного Zn2+ на молекулу FVIIa, путем измерения аффинности связывания Zn2+ с FVIIa или путем измерения IC50 для ингибирования активности FVIIa цинком. Модифицированный полипептид может обладать повышенной устойчивостью к воздействию Zn2+, например повышенной на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более устойчивостью к воздействию Zn2+ по сравнению с немодифицированным полипептидом.
В настоящем документе "связывающая сывороточный альбумин последовательность" относится к последовательности аминокислотных остатков, которая может связывать сывороточный альбумин. Таким образом, при вставке в полипептид FVII связывающей сывороточный альбумин последовательности может быть увеличена аффинность или связывание полипептида FVII с сывороточным альбумином. Модифицированный полипептид может обладать повышенной аффинностью и/или связыванием с сывороточным альбумином, например повышенной на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более аффинностью и/или связыванием с сывороточным альбумином по сравнению с немодифицированным полипептидом. Обычно связывающая сывороточный альбумин последовательность включает 10 или более аминокислот, обычно 10, 11, 12, 13, 14, 15, 20, 30, 40 или более аминокислот. Примеры связывающих сывороточный альбумин последовательностей приведены в SEQ ID NOS: 103-109.
В настоящем документе "связывающая интегрин тромбоцитов aIIbp3 последовательность" относится к последовательности аминокислотных остатков, которая может связывать интегрин тромбоцитов aIIbp3. Таким образом, при вставке в полипептид FVII связывающей интегрин тромбоцитов aIIbp3 последовательности может быть увеличена способность полипептида FVII связывать интегрин тромбоцитов aIIbp3 и, следственно, тромбоциты, в том числе активированные тромбоциты. Модифицированные полипептиды FVII, включающие связывающую интегрин тромбоцитов aIIbp3 последовательность, проявляют увеличенную аффинность и/или связывание с интегрином aIIbp3 и/или тромбоцитами. Модифицированный полипептид может обладать повышенной аффинностью и/или связыванием с интегрином тромбоцитов aIIbp3, например повышенной на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500% или более аффинностью и/или связыванием с интегрином тромбоцитов aIIbp3 по сравнению с немодифицированным полипептидом. Обычно связывающая интегрин тромбоцитов aIIbp3 последовательность содержит по меньшей мере 5 или более аминокислот, как правило, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40 или более аминокислот. Примеры связывающих интегрин тромбоцитов aIIbp3 последовательностей приведены в SEQ ID NO: 110-112.
В настоящем документе "сайт гликозилирования" относится к аминокислоте в полипептиде, к которой может быть присоединен углеводный фрагмент. Как правило, гликозилированный белок содержит один или более аминокислотных остатков, таких как аспарагин или серин, для прикрепления углеводных фрагментов.
В настоящем документе "нативный сайт гликозилирования" относится к аминокислоте, к которой в полипептиде дикого типа присоединен углеводный фрагмент. В FVII существует четыре нативных сайта гликозилирования, два сайта N-гликозилирования в положениях N145 и N322 и два сайта О-гликозилирования в положениях S52 и S60, положения соответствуют позициям аминокислот в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3.
В настоящем документе "ненативный сайт гликозилирования" относится к аминокислоте, к которой в модифицированном полипептиде присоединен углеводный фрагмент и к которой не присоединен такой фрагмент в полипептиде дикого типа. Ненативные сайты гликозилирования могут быть введены в полипептид FVII с помощью замен аминокислот. Сайты О-гликозилирования могут быть созданы, например, путем замены нативного остатка аминокислоты на серин или треонин.
Сайты N-гликозилирования могут быть созданы, например, путем создания мотива Asn-Xaa-Ser/Thr/Cys, где Хаа не является пролином. Создание указанной консенсусной последовательности модификацией аминокислот может включать, например, замену одного нативного аминокислотного остатка на аспарагин, замену одного нативного аминокислотного остатка на серин, треонин и цистеин или двойную замену аминокислот, включающую первую замену нативного аминокислотного остатка на аспара-гин и вторую замену нативного аминокислотного остатка на серин, треонин и цистеин.
Используемый здесь термин "биологическая активность" относится к активности соединения in vivo или физиологической реакции, которая проявляется при in vivo введении соединения, композиции или другой смеси. Биологическая активность, таким образом, охватывает терапевтический эффект и фармацевтическую активность таких соединений, композиций и смесей. Биологическую активность можно
наблюдать в in vitro системах, предназначенных для исследования или использования такой активности. Таким образом, в настоящем документе биологическая активность полипептида FVII охватывает коагу-лянтную активность.
Используемый здесь термин "оценка" и его грамматические изменения относятся к качественному и количественному определению абсолютного значения активности полипептида, а также к получению индекса, коэффициента, процента, визуального показателя или другого показателя уровня активности. Оценка может быть прямой или косвенной. Например, обнаружение расщепления субстрата полипептида может осуществляться прямым измерением продукта или косвенным путем через определение активности расщепленного субстрата.
В настоящем документе термин "нумерация химотрипсина" относится к нумерации аминокислот зрелого полипептида химотрипсина из SEQ ID NO: 80. Протеазный домен другой протеазы, такой как, например, протеазный домен фактора VII, может быть выровнен с химотрипсином. В этом случае аминокислотам фактора VII, которые соответствуют аминокислотам химотрипсина, дают номера аминокислот химотрипсина. Соответствующие позиции могут быть определены специалистом в данной области техники с помощью ручного выравнивания или с помощью многочисленных доступных программ выравнивания (например, BLASTP). Соответствующие позиции также могут быть определены на основании структурного выравнивания, например с помощью компьютерного выравнивания структуры белка. Утверждение, что аминокислоты полипептида соответствуют аминокислотам указанной последовательности, относится к аминокислотам, идентифицированным в процессе выравнивания полипептида с раскрытой последовательностью с достижением максимальной идентичности или гомологии (выравниваются консервативные аминокислоты) с помощью стандартного алгоритма выравнивания, такого как алгоритм GAP. Соответствующие химотрипсиновые номера аминокислот с 1 по 406 из полипептида FVII, приведенного в SEQ ID NO: 3, представлены в табл. 1. Аминокислотные позиции, соответствующие приведенной в SEQ ID NO: 3 последовательности, показаны обычным шрифтом, аминокислотные остатки на этих позициях выделены жирным шрифтом, соответствующие номера по нумерации химотрипсина выделены курсивом. Например, при выравнивании зрелого фактора VII (SEQ ID NO: 3) со зрелыми химот-рипсином (SEQ ID NO: 80) изолейцину (I) в положении 153 в факторе VII дается номер 116 по нумерации химотрипсина. Последующие аминокислоты пронумерованы соответственно. В еще одном примере глутаминовая кислота (Е) в положении 210 зрелого фактора VII (SEQ ID NO: 3) соответствует аминокислотной позиции Е70 по нумерации химотрипсина. Если остаток присутствует в протеазе, но отсутствует в химотрипсине, аминокислотному остатку дают буквенное обозначение. Например, остатки, которые являются частью петли с аминокислотой 60 по нумерации химотрипсина, но представляют собой вставку в последовательность фактора VII по сравнению с химотрипсином, называют, например, К60а, I60b, К60с и N60d. Эти остатки соответствуют К197, I198, К199 и N200 соответственно, по нумерации последовательности зрелого фактора VII (SEQ ID NO: 3).
Таблица 1
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
60A
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
60B
60C
60D
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
100
101
102
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
118
119
120
121
122
123
124
125
126
127
128
129
129 A
129B
129C
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
129D
129E
129F
129G
134
135
136
137
138
139
140
141
142
143
144
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
145
146
147
149
150
151
152
153
154
155
156
157
158
159
160
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
161
162
163
164
165
166
167
168
169
170
170 A
170B
170C
170D
170E
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
170F
170G
170H
1701
175
176
177
178
179
180
181
182
183
184A
184
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
185
186
187
188A
188
189
190
191
192
193
194
195
196
197
198
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
214
215
216
217
219
220
221A
221
222
223
224
225
226
227
228
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
393
394
395
396
397
398
399
400
401
402
403
404
405
406
244
245
246
247
248
249
250
251
252
253
254
255
256
257
В настоящем документе "нуклеиновые кислоты" включают ДНК, РНК и их аналоги, в том числе пептидные нуклеиновые кислоты (PNA) и их смеси. Нуклеиновые кислоты могут быть одноцепочечны-ми или двухцепочечными. Когда речь идет о зондах или праймерах, которые по желанию являются мечеными, например, обнаруживаемой меткой, например люминесцентной или радиоактивной меткой, подразумеваются одноцепочечные молекулы. Такие молекулы, как правило, обладают такой длиной, что их мишени при зондировании или праймировании библиотеки являются статистически уникальными или встречаются в виде низкого числа копий (обычно менее 5, как правило, менее 3). Обычно зонд или прай-мер содержит последовательность по меньшей мере из 14, 16 или 30 непрерывно расположенных нук-леотидов, комплементарных или идентичных интересующему гену. Зонды и праймеры могут включать 10, 20, 30, 50, 100 или более нуклеотидов в длину.
В настоящем документе "пептид" относится к полипептиду, который включает от 2 до 40 аминокислот в длину.
В настоящем документе аминокислоты, входящие в различные аминокислотные последовательности, предусмотренные здесь, обозначаются в соответствии с известными трехбуквенными или однобук-венными аббревиатурами (табл. 2). Нуклеотиды, входящие в различные фрагменты нуклеиновых кислот, называют стандартными однобуквенными обозначениями, обычно используемыми в уровне техники.
В настоящем документе "аминокислота" представляет собой органическое соединение, содержащее аминогруппу и карбоксильную группу. Полипептид содержит две или более аминокислот. В настоящем документе аминокислоты включают двадцать природных аминокислот, неприродные аминокислоты и аналоги аминокислот (например, аминокислоты, у которых а-атом углерода имеет боковую цепь).
Аббревиатуры для аминокислотных остатков в соответствии со стандартной номенклатурой полипептидов, описанной в J. Biol. Cliem., 243:3552-3559 (1969) и принятой 37 C.F.R, §§ 1.821-1.822, приведены в табл. 2.
Таблица 2
Следует отметить, что все последовательности аминокислотных остатков, представленные в настоящем документе в виде формулы, ориентированы слева направо в обычном направлении от амино-конца к карбоксильному концу.
Кроме того, термин "аминокислотный остаток" в широком смысле включает аминокислоты, перечисленные в табл. соответствия (табл. 2), модифицированные и необычные аминокислоты, такие как упомянутые в 37 C.F.R. §§ 1.821-1.822 и включенные здесь в качестве ссылки. Кроме того, следует отметить, что тире в начале или в конце аминокислотной последовательности указывает на пептидную связь с дальнейшей последовательностью из одного или более аминокислотных остатков, с аминоконцевой группой, такой как NH2, или с карбоксильной группой, такой как СООН.
В настоящем документе термин "гидрофобные аминокислоты" включает любую из аминокислот, для которой с использованием непрерывной шкалы гидрофобности Айзенберга установлено, что она является гидрофобной. Примерами являются природные гидрофобные аминокислоты, такие как изолей-цин, фенилаланин, валин, лейцин, триптофан, метионин, аланин, глицин, цистеин и тирозин (Eisenberg и
др., (1982) Faraday Symp. Chem. Soc.l7:109-120). Неприродные гидрофобные аминокислоты также включены в этот термин.
В настоящем документе "кислые аминокислоты" включают аспарагиновую кислоту и глутамино-вую кислоту из природных аминокислот. Неприродные кислые аминокислоты также включены в этот термин.
Используемый здесь термин "природные аминокислоты" относится к 20 L-аминокислотам, которые встречаются в полипептидах.
Используемый здесь термин "неприродные аминокислоты" относится к органическим соединениям, содержащим аминогруппу и карбоксильную группу, которые не являются природными аминокислотами, перечисленными в табл. 2. Неприродные аминокислоты, таким образом, включают, например, аминокислоты или аналоги аминокислот за исключением 20 природных аминокислот и включают, но не ограничиваются, D-изостереомеры аминокислот. Примеры неприродных аминокислот известны специалистам в данной области и могут быть включены в модифицированные полипептиды фактора VII.
В настоящем документе "конструкция ДНК" представляет собой одноцепочечную или двухцепо-чечную линейную или кольцевую молекулу ДНК, которая содержит сегменты ДНК, комбинированные и составленные в порядке, не встречающемся в природе. Конструкция ДНК существует как результат человеческой деятельности и включает клоны и другие копии подвергнутых манипуляции молекул.
В настоящем документе "сегмент ДНК" представляет собой часть большей молекулы ДНК с указанными свойстами. Например, сегмент ДНК, кодирующий указанный полипептид, представляет собой часть большей молекулы ДНК, например плазмиды или фрагмента плазмиды, который при его прочтении от 5'-конца к 3'-концу кодирует последовательность аминокислот указанного полипептида.
Используемый здесь термин "полинуклеотид" означает одноцепочечный или двухцепочечный полимер дезоксирибонуклеотидов или рибонуклеотидов, читаемый от 5' к 3' концу. Полинуклеотиды включают РНК и ДНК и могут быть выделены из природных источников, синтезированы in vitro или получены комбинированием натуральных и синтетических молекул. Длина полинуклеотидной молекулы дается здесь в нуклеотидах (сокращенно "нт") или парах оснований (сокращенно "bp").
Термин "нуклеотиды" используется для одноцепочечных и двухцепочечных молекул, где позволяет контекст. Когда термин применяется к двухцепочечной молекуле, он используется для обозначения общей длины и является синонимом термина пара оснований. Для специалиста в данной области техники очевидно, что две цепи двухцепочечного полинуклеотида могут незначительно отличаться по длине, и концы их могут быть расположены уступом, поэтому все нуклеотиды в двухцепочечной молекуле поли-нуклеотида не могут образовывать пары. Такие неспаренные концы обычно не превышают 20 нуклеоти-дов в длину.
В настоящем документе "первичная последовательность" относится к последовательности аминокислотных остатков в полипептиде.
Используемый здесь термин "сходство" для двух белков или нуклеиновых кислот относится к близости аминокислотных последовательностей белков или нуклеотидных последовательностей нуклеиновых кислот. Сходство может быть основано на степени идентичности и/или гомологии последовательностей остатков.
Способы оценки степени сходства белков или нуклеиновых кислот известны специалистам в данной области. Например, в одном способе оценки сходства последовательностей две аминокислотные или нуклеотидные последовательности выравнивают таким образом, чтобы достичь максимального уровня идентичности между последовательностями. Идентичность относится к степени, в которой аминокислотные или нуклеотидные последовательности инвариантны. При выравнивании аминокислотных последовательностей и в некоторой степени последовательностей нуклеотидов также можно принять во внимание консервативные различия и/или частые замены аминокислот (или нуклеотидов). Консервативными различиями являются те, при которых сохраняются физико-химические свойства участвующих остатков. Выравнивание может быть глобальным (выравнивание сравниваемых последовательностей по всей длине последовательностей и по всем остаткам) или локальным (выравнивание частей последовательностей, которые включают только наиболее близкий район или районы).
Используемые здесь термины "гомология" и "идентичность" употребляются как синонимы, но гомология по отношению к белкам может включать консервативные замены аминокислот. В общем, для определения соответствующих позиций последовательности аминокислот выравнивают для достижения наибольшего совпадения (см., например, Computational Molecular Biology, Lesk, A.M., изд, Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., изд, Academic Press, New York, 1993; Computer Analysis of Sequence Data, часть I, Griffin, A.M., and Griffin, H. G., изд., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; и Sequence Analysis Primer, Gribskov, M. and Devereux, J., изд., М Stockton Press, New York, 1991; Carillo и др. (1988) SIAMJ Applied Math 48:1073).
В настоящем документе термин "идентичность последовательности" относится к числу идентичных аминокислот (или нуклеотидных оснований) при сравнении исследуемого и исходного полипептида или полинуклеотида. Гомологичные полипептиды обладают заранее определенным числом идентичных или
гомологичных аминокислотных остатков. Гомология подразумевает консервативные аминокислотные замены и идентичные остатки. Идентичность последовательности может быть определена по стандартному алгоритму выравнивания, использующему выбранные по умолчанию штрафы за разрыв в последовательности, установленные разработчиком. Гомологичные молекулы нуклеиновой кислоты обладают заранее определенным числом идентичных или гомологичных нуклеотидов. Гомология подразумевает замены, которые не изменяют закодированные аминокислоты (т.е. "молчащие замены") и идентичные остатки. Существенно гомологичные молекулы нуклеиновых кислот обычно гибридизуются в умеренных условиях или в жестких условиях по всей длине нуклеиновой кислоты или по меньшей мере приблизительно по 70, 80 или 90% от полной длины интересующей молекулы нуклеиновой кислоты. Также предусмотрены молекулы нуклеиновых кислот, которые содержат вырожденные кодоны вместо кодона в гибридизуемой молекуле нуклеиновой кислоты. (Для определения гомологии белков консервативные аминокислоты а также идентичные аминокислоты могут быть выровнены, в этом случае процент идентичности и процент гомологии отличаются). Обладают ли любые две молекулы нуклеиновой кислоты нуклеотидными последовательностями (или любые два полипептида имеют аминокислотные последовательности), которые по меньшей мере на 80, 85, 90, 95, 96, 97, 98 или 99% "идентичны", может быть определено с помощью известных алгоритмов, таких как программа FASTA с использованием, например, параметров по умолчанию, как описано Pearson и др., Proc. Natl. Acad. Sci. USA 85: 2444 (1988) (другие программы включают пакет программ GCG (Devereux, J., и др., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S.F., и др., J. Molec. Biol. 215:403 (1990); Guide to HugeComputers, Martin J. Bishop, изд., Academic Press, San Diego (1994), и Carillo и др. SIAM J Applied Math 48: 1073 (1988)). Например, функция BLAST базы данных Национального центра биотехнологической информации может быть использована для определения идентичности. Другие коммерчески доступные или общедоступные программы включают программу DNAStar "MegAlign" (Madison, Висконсин) и программу "Gap" генетической компьютерной группы университета Висконсина University of Wisconsin Genetics Computer Group (UWG) (Madison, Висконсин). Процент гомологии или идентичность белков и/или молекул нуклеиновых кислот могут быть определены, например, путем сравнения информации о последовательностях с использованием программы GAP (см., например, Needleman и др., J. Mol. Biol. 48: 443 (1970), с изменениями, внесенными Smith и Waterman (Adv. Appl. Math. 2: 482 (1981)). Программа GAP определяет сходство как число выровненных символов (т.е. нуклеотидов или аминокислот), которые являются одинаковыми, деленное на общее число символов в более короткой из двух последовательностей. Параметры по умолчанию для программы GAP могут включать: (1) унарную матрицу сравнения (содержащую значение 1 для совпадения и 0 для не совпадения) и взвешенную матрицу сравнения Gribskov и др., Nucl. Acids Res. 14: 6745 (1986), как описано Schwartz и Dayhoff, Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, cc. 353-358 (1979); (2) штраф в размере 3,0 для каждого разрыва в последовательности, дополнительный штраф 0,10 для каждого символа в каждом разрыве и (3) штраф не применяется для разрывов в концах последовательности.
Таким образом, используемый здесь термин "идентичность" относится к сравнению исследуемого и начального полипептида или полинуклеотида. Например, фраза "по меньшей мере на 90% идентичны" относится к идентичности от 90 до 100% по отношению к начальному полипептиду. Принимая для иллюстративных целей длину исследуемого и начального полипептидов за 100 аминокислот, идентичность на уровне 90% и более свидетельствует о том, что не более чем 10% (т.е. 10 из 100) аминокислот в исследуемом полипептиде отличается от начального полипептида. Подобные сравнения можно провести между исследуемым и начальным полинуклеотидами. Такие различия могут быть представлены в виде точечных мутаций, случайно распределенных по всей длине аминокислотной последовательности, или различия могут быть сосредоточены в одном или нескольких местах различной длины вплоть до максимально допустимой, например, 10/100 различающихся аминокислот (около 90% идентичности). Различия определяются как замены, вставки и удаления нуклеиновых оснований и аминокислот. При уровне гомологии или идентичности выше приблизительно 85-90%) результат не должен зависеть от программы и параметров штрафа за разрыв, такие высокие уровни идентичности могут быть легко оценены, часто без использования программного обеспечения.
В настоящем документе термины "в значительной степени идентичные" или "сходные" варьируются в зависимости от контекста, как это понимает специалист в данной области техники.
В настоящем документе "выровненная последовательность" относится к использованию гомологии (сходства и/или идентичности) для выравнивания соответствующих позиций в последовательности нук-леотидов или аминокислот. Как правило, две или более последовательности, которые связаны 50% и более идентичности, выравниваются. Выровненное множество последовательностей относится к 2 или более последовательностям, которые являются выровненными в соответствующих позициях, и может включать выравнивание последовательностей, полученных из РНК, таких как EST и другие кДНК, с последовательностью геномной ДНК.
В настоящем документе термин "специфически гибридизируется" относится к отжигу через комплементарное спаривание оснований молекулы нуклеиновой кислоты (например, олигонуклеотида) с целевой молекулой нуклеиновой кислоты. Специалистам в данной области известны in vitro и in vivo
параметры, которые влияют на специфическую гибридизацию, такие как длина и состав конкретной молекулы. Особенно важные для in vitro гибридизации параметры дополнительно включают температуру отжига и отмывания, состав буфера и концентрацию соли. Примеры условий отмывания для удаления неспецифически связанных молекул нуклеиновой кислоты включают 0,1 х SSPE, 0,1% SDS, 65°С при высокой жесткости, и 0,2 х SSPE, 0,1% SDS, 50°С при умеренной жесткости. Эквивалентные условия известны в уровне техники. Специалист в данной области может легко изменить условия, подходящие для конкретной задачи для достижения специфической гибридизации молекул нуклеиновой кислоты с целевыми молекулами нуклеиновой кислоты.
В настоящем документе "выделенный" или "очищенный" полипептид или белок или его биологически-активная часть практически не содержит клеточного материала или других загрязняющих белков из клеток или тканей, из которых происходит белок, или является в значительной степени свободным от химических веществ-предшественников и других химических веществ при химическом синтезе. Препараты могут быть определены как существенно чистые, если они являются свободными от легко обнаруживаемых примесей, определяемых с помощью стандартных способов анализа, таких как тонкослойная хроматография (ТСХ), гель-электрофорез и высокоэффективная жидкостная хроматография (ВЭЖХ), используемых специалистами в области техники для оценки чистоты, или препараты могут быть определены как достаточно чистые, если дальнейшая очистка не изменяет физические и химические свойства вещества, такие как протеолитическая и биологическая активность. Способы очистки соединений для получения существенно химически чистых соединений известны специалистам в данной области. Существенно химически чистые соединения, однако, могут представлять собой смесь стереоизомеров. В таких случаях дополнительная очистка может увеличить удельную активность соединения.
Термин "практически свободный от клеточного материала" относится к препаратам белков, где белок отделен от клеточных компонентов клеток, из которых он выделен или получен рекомбинантно. В одном варианте термин практически свободный от клеточного материала относится к препарату протеа-зы, имеющему приблизительно менее 30% (на сухой вес) белков, не являющихся протезами (также называемых здесь загрязняющими белками), как правило, менее 20% белков, не являющихся протезами, или 10% белков, не являющихся протезами, или приблизительно менее 5% белков, не являющихся протезами. Если протеаза или ее активная часть являются рекомбинантными, то они являются существенно свободными от культуральной среды, т.е. культуральная среда составляет менее приблизительно или точно 20, 10 или 5% от объема препарата протеазы.
Используемый здесь термин "практически не содержат химических веществ-предшественников и других химических веществ" относится к препарату протеазы, в котором белок отделен от химических веществ-предшественников и других химических веществ, которые использовали в синтезе белка. Этот термин включает препараты протеазы, имеющие менее 30% (на сухой вес), 20, 10, 5% или менее химических веществ-предшественников или химических веществ или компонентов, не являющихся протеазой.
В настоящем документе получение рекомбинантными методами с помощью методов рекомбинант-ной ДНК относится к использованию хорошо известных способов молекулярной биологии для экспрессии белков, кодируемых клонированной ДНК.
В настоящем документе "вектор" (или плазмида) относится к дискретному элементу, который используется для введения гетерологичных нуклеиновых кислот в клетки для их экспрессии или репликации. Векторы обычно остаются в эписомном состоянии, но могут быть разработаны для осуществления интеграции гена или его части в хромосому генома. Также предусмотрены векторы, которые представляют собой искусственные хромосомы, такие как бактериальные искусственные хромосомы, искусственные хромосомы дрожжей и искусственные хромосомы млекопитающих. Выбор и использование таких векторов хорошо известны специалистам в данной области.
В настоящем документе "экспрессия" означает процесс, посредством которого нуклеиновая кислота транскрибируется в мРНК и транслируется в пептид, полипептид или белок. Если нуклеиновая кислота происходит от геномной ДНК, то при наличии соответствующей выбранной эукариотической клетки-хозяина или организма экспрессия может включать процессинг, такой как сплайсинг РНК.
В настоящем документе "вектор экспрессии" включает векторы, способные экспрессировать ДНК, функционально связанную с регуляторными последовательностями, такими как промоторные районы, которые способны вызывать экспрессию таких фрагментов ДНК. Такие дополнительные сегменты могут включать промоторные и терминаторные последовательности и, при необходимости, могут включать одну или несколько точек начала репликации, один или более маркеров для отбора, энхансер, сигнал полиаденилирования и т.п. Векторы экспрессии обычно получают из плазмидной или вирусной ДНК, или вектор может содержать элементы того и другого. Таким образом, вектор экспрессии относится к рекомбинантным ДНК или РНК конструкциям, например плазмидам, фагам, рекомбинантным вирусам или другим векторам, которые после введения в соответствующую клетку-хозяина приводят к экспрессии клонированной ДНК. Соответствующие векторы экспрессии хорошо известны специалистам в данной области и включают векторы, которые реплицируются в эукариотических клетках и/или прокарио-тических клетках, векторы, которые остаются в эписомном состоянии, или векторы, которые интегриру
ются в геном клетки-хозяина.
В настоящем документе вектор также включает "вирусный вектор" или "вирусные векторы". Вирусные векторы представляют собой сконструированные вирусы, функционально связанные с экзогенным геном для передачи (как носитель или челкок) экзогенного гена в клетки.
В настоящем документе "аденовирус" относится к любому вирусу из группы ДНК-содержащих вирусов, которые вызывают конъюнктивит и инфекции верхних дыхательных путей у человека.
В настоящем документе "голая" ДНК относится к свободной от гистонов ДНК, которая может быть использована для получения вакцин и генной терапии. Голая ДНК представляет собой генетический материал, который передается от клетки к клетке во время переноса генов, называемого трансформацией или трансфекцией. При трансформации или трансфекции очищенная или голая ДНК, поглощенная клеткой-реципиентом, дает клетке-реципиенту новую характеристику или фенотип.
В настоящем документе термины "функционально" или "функционально связанный" по отношению к сегментам ДНК означают, что сегменты расположены так, что они функционируют в соответствии с их назначением, например транскрипция инициируется на промоторе и проходит через кодирующий сегмент до терминатора.
В настоящем документе "агент" модулирует активность белка или экспрессию гена или нуклеиновой кислоты, уменьшает или увеличивает или иным образом изменяет активность белка или каким-либо образом усиливает или ослабляет или иным образом изменяет экспрессию нуклеиновой кислоты в клетке.
В настоящем документе "химерный белок" или "гибридный белок" относится к полипептиду, функционально связанному с другим полипептидом. Химерные или гибридные белки, предусмотренные в настоящем документе, могут включать один или несколько полипептидов FVII или их части и один или несколько других полипептидов с любым одним или несколькими сигналами управления транскрипции/трансляции, сигнальными последовательностями, меткой для локализации, меткой для очистки, доменом иммуноглобулина G и/или нацеливающим агентом. Химерные полипептиды FVII также включают полипептиды с эндогенными доменами или районами, обмененными с другим полипептидом. Эти химерные или гибридные белки включают белки, полученные с помощью рекомбинантной технологии как гибридные белки, полученные химическими методами белки, например полученные путем химического соединения, например соединения сульфгидрильных групп, белки, полученные с использованием любого другого способа, с помощью которого по меньшей мере один полипептид (т.е. FVII) или его часть связаны прямо или косвенно через линкер(линкеры) с другим полипептидом.
В настоящем документе понятие "функционально связанные" по отношению к гибридному белку относится к протеазе и не протеазе, которые гибридизованы в одной рамке считывания друг с другом. Полипептид, не являющийся протеазой, может быть гибридизован с N-концом или С-концом протеазы.
В настоящем документе "нацеливающий агент" представляет собой любой фрагмент, такой как белок или его активная часть, который обеспечивает специфическое связывание с молекулой клеточной поверхности, такой как рецептор клеточной поверхности, которая в некоторых случаях может интерна-лизовать связанный конъюгат или его часть. Нацеливающий агент также может представлять собой агент, который способствует или облегчает, например, аффинное выделение или очистку конъюгата, прикрепление конъюгата к поверхности или выявление конъюгата или комплекса, содержащего конъю-гат.
В настоящем документе "производное" или "аналог" молекулы относится к части молекулы или модифицированной молекуле.
Используемый здесь термин "заболевание или расстройство" относится к патологическим состояниям организма, возникшим в результате факторов или состояний, включающих, но не ограничивающихся, инфекцией, приобретенными состояниями, генетическими состояниями, и характеризующихся идентифицируемыми симптомами. Заболевания и расстройства по настоящему документу включают заболевания и расстройства, затрагивающие коагуляцию, включая опосредованные участвующими в коагуляции белками заболевания и расстройства и заболевания и расстройства, в которых участвующие в коагуляции белки играют важную роль в этиологии и патологии. Заболевания и расстройства также включают вызванные отсутствием белков заболевания и расстройства, такие как гемофилии, при которых коагуляция не происходит из-за дефицита или дефекта белков, такие заболевания и расстройства представляют особый интерес в настоящем документе.
В настоящем документе термин "прокоагулянт" относится к любому веществу, которое способствует свертыванию крови.
В настоящем документе термин "антикоагулянт" относится к любому веществу, которое препятствует свертыванию крови.
В настоящем документе "гемофилия" относится к заболеванию, связанному с кровотечениями, обусловленному дефицитом в крови факторов свертывания. Гемофилия может быть результатом, например, отсутствия, уменьшения экспрессии или снижения функционирования фактора свертывания крови. Наиболее распространенным типом гемофилии является гемофилия А, являющаяся результатом дефицита фактора VIII. Второй по распространенности тип гемофилии представляет собой гемофилию В, являющуюся результатом дефицита фактора IX. Гемофилия С, которую также называют дефицитом FXI, явля
ется более мягкой и менее распространенной формой гемофилии.
Используемый здесь термин "врожденная гемофилия" относится к типам гемофилии, которые наследуются. Врожденная гемофилия является результатом мутации, удаления, вставки или другой модификации гена фактора свертывания крови, при которых фактор свертывания не образуется, образуется в меньшем количестве или не функционирует. Например, наследственные мутации в генах факторов свертывания крови, таких как фактор VIII и фактор IX, приводят к врожденным гемофилиям, гемофилии А и В соответственно.
В настоящем документе термин "приобретенная гемофилия" относится к типу гемофилии, который развивается в зрелом возрасте в результате образования аутоантител, которые инактивируют FVIII.
Используемый здесь термин "нарушение свертываемости крови" относится к состоянию, при котором у субъекта снижена способность останавливать кровотечения. Нарушения свертываемости крови могут быть наследственными или приобретенными и могут возникнуть в результате, например, дефекта или недостаточности пути коагуляции, дефекта или недостаточности активности тромбоцитов или дефектов сосудов.
В настоящем документе "приобретенное нарушение свертываемости крови" относится к нарушению свертываемости крови, вызванному недостаточностью свертывания вследствие заболевания печени, дефицита витамина K или применения кумадина (варфарина) или другой антикоагулянтной терапии.
В настоящем документе "лечение" субъекта, страдающего заболеванием или состоянием, означает, что полипептид, композиция или другой продукт, предусмотренный в этом документе, вводят субъекту.
В настоящем документе "терапевтический агент", "схема лечения", "радиопротектор" или "химио-терапевтический агент" означают обычные лекарства и лекарственную терапию, включая вакцины, которые известны специалистам в данной области. Радиотерапевтические агенты хорошо известны в уровне техники.
В настоящем документе "лечение" представляет собой любой способ уменьшения или иного благотворного изменения симптомов состояния, расстройства или заболевания. Поэтому лечение включает профилактику, терапию и/или излечение. Лечение также включает любое фармацевтическое использование композиции по настоящему документу. Лечение также включает любое фармацевтическое использование предусмотренных в настоящем документе модифицированных FVII и композиций.
В настоящем документе "улучшение симптомов заболевания или расстройства" посредством лечения, например, фармацевтической композицией или лекарственным средством, относится к любому уменьшению, постоянному или временному, устойчивому или кратковременному, симптомов, связанному с введением или приписываемому введению композиции или лекарственного средства.
В настоящем документе "профилактика" или "предотвращение" относится к способам уменьшения риска развития заболевания или состояния. Профилактика включает уменьшение риска развития заболевания или состояния и/или предотвращение ухудшения симптомов или развития заболевания, или уменьшение риска ухудшения симптомов или развития заболевания.
В настоящем документе "эффективное количество соединения или композиции" для лечения конкретного заболевания представляет собой количество, которое является достаточным для улучшения или любого уменьшения симптомов, связанных с заболеванием. Такое количество может быть введено одной дозой или согласно режиму введения, при котором введение эффективно. Указанное количество может привести к выздоровлению, но обычно приводит к улучшению симптомов заболевания. Обычно для достижения желаемого улучшения симптомов требуются повторные введения.
В настоящем документе "пациент" или "субъект", подвергающийся лечению, включает человека и животных, не представляющих собой человека, в том числе млекопитающих. Млекопитающие включают приматов, таких как люди, шимпанзе, гориллы и низшие приматы; домашних животных, таких как собаки, лошади, кошки, свиньи, козы, коровы; и грызунов, таких как мыши, крысы, хомяки и песчанки.
В настоящем документе "комбинация" относится к любому соединению двух или более элементов. Комбинация может быть пространственной или относится к использованию двух или более элементов для одной цели.
В настоящем документе "композиция" относится к любой смеси двух или более продуктов или соединений (например, агентов, модуляторов, регуляторов, и т.д.). Композиция может представлять собой раствор, суспензию, жидкость, порошок, пасту, водную или неводную рецептуру или их комбинации.
В настоящем документе "изделие" представляет собой продукт, который изготавливается и продается. В настоящем документе термин включает модифицированные протеазы и нуклеиновые кислоты, содержащиеся в упаковке.
В настоящем документе "жидкая композиция" относится к любой композиции, которая может течь. Таким образом, жидкие композиции включают композиции в полужидкой форме, пасты, растворы, водные смеси, гели, лосьоны, кремы и другие подобные композиции.
В настоящем документе "набор" относится к комбинации, помещенной в упаковку, по желанию содержащей реагенты и другие продукты и/или компоненты для осуществления способов по изобретению с помощью элементов комбинации. Например, в настоящем документе предусмотрены наборы, содержащие модифицированные протеазы или молекулы нуклеиновой кислоты по изобретению и еще один
элемент, предназначенный для введения, диагностики или оценки биологической активности или свойства. По желанию, наборы включают инструкции по использованию.
В настоящем документе "антитела" включают фрагменты антител, такие как Fab фрагменты, которые состоят из легкой цепи и вариабельного района тяжелой цепи.
В настоящем документе "рецептор" относится к молекуле, обладающей аффинности к конкретному лиганду. Рецепторы могут быть природными или синтезированными молекулами. Рецепторы могут быть упомянуты как антилиганды.
В настоящем документе "животные" включают любых животных, включая, но не ограничиваясь, приматов, таких как человек, горилла и низшие приматы; грызунов, таких как мыши и крысы; птиц, таких как куры; жвачных животных, таких как козы, коровы, олени, овцы, мелкий домашний скот, такой как свиньи; и других животных. В понятии "не включающие человека животные" люди исключены из числа предусмотренных животных. Предусмотренные здесь протеазы могут происходить из любого источника, включая животных, растения, прокариоты и грибы.
В настоящем документе "генная терапия" включает перенос гетерологичных нуклеиновых кислот, таких как ДНК, в определенные клетки, клетки-мишени млекопитающих, особенно человека, страдающего расстройством или состоянием, для которого известна такая терапия. Нуклеиновые кислоты, такие как ДНК, вводят в выбранные клетки-мишени непосредственно либо в векторе или другом средстве доставки таким образом, что гетерологичные нуклеиновые кислоты, такие как ДНК, экспрессируются и производят таким образом закодированный терапевтический продукт. Альтернативно, гетерологичные нуклеиновые кислоты, такие как ДНК, могут каким-либо образом влиять на экспрессию ДНК, которая кодирует терапевтический продукт, или могут кодировать продукт, такой как пептид или РНК, который каким-либо образом влияет, прямо или косвенно, на экспрессию терапевтического продукта. Генная терапия также может быть использована для доставки нуклеиновой кислоты, кодирующей генетический продукт, который заменяет дефектный ген или дополняет генетический продукт, продуцируемый млекопитающим или клеткой, в которые введена нуклеиновая кислота. Введенная нуклеиновая кислота может кодировать терапевтическое соединение, такое как протеаза или модифицированная протеаза, которые обычно не производятся млекопитающим-хозяином или не производятся в терапевтически эффективных количествах или в терапевтически полезное время.
Гетерологичные нуклеиновые кислоты, такие как ДНК, кодирующие терапевтический продукт, могут быть модифицированы до введения в клетки страдающего хозяина для усиления или иного изменения продукта или его экспрессии. Генетическая терапия также может включать доставку ингибитора, репрессора или другого модулятора экспрессии генов.
В настоящем документе "гетерологичная нуклеиновая кислота" представляет собой нуклеиновую кислоту, которая в нормальных условиях не продуцируется клеткой in vivo, в которой она экспрессиру-ется, или представляет собой нуклеиновую кислоту, которая продуцируется клеткой, но находится в другом локусе, или представляет собой нуклеиновую кислоту, которая иначе экспрессируется, или влияет на экспрессию эндогенных нуклеиновых кислот или кодирует посредник, который изменяет экспрессию эндогенных нуклеиновых кислот, таких как ДНК, путем воздействия на транскрипцию, трансляцию, или другие регулируемые биохимические процессы. Гетерологичная нуклеиновая кислота, как правило, не является эндогенной для клетки, в которую она введена, но такая нуклеиновая кислота может быть получена из другой клетки или получена синтетически. Гетерологичная нуклеиновая кислота может быть эндогенной нуклеиновой кислотой, но экспрессироваться с другого локуса или обладать изменениями в экспрессии. Обычно, но не обязательно, такие нуклеиновые кислоты кодируют РНК и белки, которые обычно не продуцируются клеткой или продуцируются клеткой, в которой экспрессированы нуклеиновые кислоты, иным образом. Гетерологичная нуклеиновая кислота, такая как ДНК, также может быть упомянута как чужеродная нуклеиновая кислота, такая как ДНК. Таким образом, гетерологичные нуклеиновые кислоты или чужеродные нуклеиновые кислоты включают молекулы нуклеиновой кислоты, которые не присутствуют в такой ориентации или позиции, как аналогичная молекула нуклеиновой кислоты, такая как ДНК, присутствующая в геноме. Гетерологичная нуклеиновая кислота также может относиться к молекуле нуклеиновой кислоты из другого организма или вида (т.е. экзогенной нуклеиновой кислоте).
Любая нуклеиновая кислота, такая как ДНК, которую специалист в области техники определяет или рассматривает как гетерологичную или чужеродную для клетки, в которой нуклеиновая кислота экспрес-сируется, рассматривается здесь как гетерологичная нуклеиновая кислота; гетерологичная нуклеиновая кислота включает экзогенно внесенную нуклеиновую кислоту, которая экспрессируется эндогенно. Примеры гетерологичных нуклеиновых кислот включают, но не ограничиваются, нуклеиновые кислоты, которые кодируют отслеживаемые белки-маркеры, такие как белок, который придает лекарственную устойчивость, нуклеиновые кислоты, которые кодируют терапевтически эффективные вещества, такие как противораковые агенты, ферменты и гормоны, и нуклеиновые кислоты, такие как ДНК, которая кодирует другие типы белков, такие как антитела. Антитела, кодируемые гетерологичными нуклеиновыми кислотами, могут быть секретированы или экспрессированы на поверхности клеток, в которые были введены гетерологичные нуклеиновые кислоты.
В настоящем документе "терапевтически эффективный продукт" в генной терапии представляет собой продукт, который кодируется гетерологичной нуклеиновой кислотой, как правило, ДНК, который при введении нуклеиновой кислоты в хозяина экспрессируется и улучшает или устраняет симптомы и проявления наследственного или приобретенного заболевания или который вылечивает заболевание. Терапевтически эффективный продукт также подразумевает биологически активные молекулы нуклеиновых кислот, такие как интерферирующие и антисмысловые РНК.
В настоящем документе утверждение, что полипептид "состоит в основном" из указанной последовательности аминокислот означает, что только указанная ее часть или ее фрагмент присутствует в полипептиде полной длины. Полипептид, по желанию, как правило, включает дополнительные аминокислоты из другого источника или может быть вставлен в другой полипептид.
В настоящем документе упоминание понятий в единственном числе также включает множественное число, если контекст с очевидностью не указывает на иное. Таким образом, например, упоминание соединения, включающего "внеклеточный домен" относится к соединениям с одним или несколькими внеклеточными доменами.
В настоящем документе диапазоны и количества могут быть обозначены, как конкретные значения или диапазоны с добавлением термина "приблизительно". Термин приблизительно также включает в себя точное значение. Следовательно, "приблизительно 5 оснований" означает "приблизительно 5 оснований", а также "5 оснований".
В настоящем документе термины "по желанию" или "необязательно" означают, что описанные явления или обстоятельства могут иметь место или не иметь места и что описание включает случаи, когда указанное явление или обстоятельство происходит, и случаи, когда это не так. Например, необязательно замещенная группа означает, что группа не является замещенной или является замещенной.
В настоящем документе аббревиатуры для любых защитных групп, аминокислот и других соединений, если не указано иное, употребляются в соответствии с их обычным использованием и являются признанными аббревиатурами или употребляются в соответствии с Комиссией по биохимической номенклатуре IUPAC-IUB (см. (1972) Biochem. U: 1726).
В. Обзор гемостаза.
В настоящем документе предусмотрены модифицированные полипептиды фактора VII (FVII). Такие полипептиды FVII модифицированы для увеличения коагулянтной активности. Соответственно, эти полипептиды имеют множество применений и возможностей применения, например, в качестве терапии для изменения гемостаза и других близких биологических процессов. Чтобы оценить предусмотренные в настоящем документе модификации и возможности применения таких модифицированных молекул FVII, необходимо понимание системы свертывания крови и каскада реакций свертывания. Приведенное ниже обсуждение обеспечивает такое понимание и является вступлением к обсуждению фактора VII и его модификаций.
Гемостаз является физиологическим механизмом остановки кровотечения, являющегося результатом повреждения сосудов. Нормальный гемостаз зависит от клеточных компонентов и растворимых белков плазмы и включает ряд сигнальных актов, которые в конечном итоге приводят к образованию сгустков. Процесс коагуляция быстро запускается после травмы, повреждающей кровеносный сосуд и эндоте-лиальные клетки. В первой фазе свертывания активируются тромбоциты, формирующие гемостатиче-скую пробку в месте повреждения. Вторичный гемостаз происходит с участием факторов коагуляции плазмы, которые действуют в протеолитическом каскаде, приводя к образованию нитей фибрина, которые укрепляют тромбоцитарную пробку. При травме сосуда приток крови непосредственно к травмированному участку ограничен за счет сужения сосуда, что позволяет тромбоцитам прикрепиться к экспонированному фибриллярному коллагену субэндотелиальной соединительной ткани. Адгезия тромбоцитов зависит от фактора фон Виллебранда (vWF), который связывается с эндотелием в течение трех секунд после травмы, тем самым способствуя адгезии и агрегации тромбоцитов. Активация агрегированных тромбоцитов приводит к секреции различных факторов, в том числе АДФ, АТФ, тромбоксана и се-ротонина. Также высвобождаются молекулы адгезии, фибриноген, фактор Виллебранда, тромбоспондин и фибронектин. Такая секреция способствует дополнительной адгезии и агрегации тромбоцитов, усилению активации тромбоцитов и сужению кровеносных сосудов, а также экспонированию анионных фос-фолипидов на поверхности тромбоцитов, которые служат платформами для сборки ферментных комплексов свертывания крови. Тромбоциты изменяют фору, формируя псевдоподии, что еще больше способствует агрегации тромбоцитов, приводящей к рыхлой тромбоцитарной пробке.
Одновременно запускается пептидазный каскад свертывания (каскад коагуляции). Каскад свертывания включает ряд активационных актов, включающих протеолитическое расщепление. В таком каскаде неактивные сериновые протеазы (также называемые зимогенами) превращаются в активные протеазы путем расщепления одной или нескольких пептидных связей, где активированные протеазы затем служат активирующими протеазы для следующей молекулы зимогена в каскаде, что, в конечном счете, приводит к формированию сгустка поперечно-сшитого фибрина. Например, каскад приводит к образованию активированных молекул, таких как тромбин (продукт расщепления протромбина), что еще больше активирует тромбоциты, а также приводит к образованию фибрина в процессе расщепления фибриногена.
Затем фибрин формирует сшитый полимер вокруг тромбоцитарной пробки для стабилизации сгустка. После исправления повреждений фибрин расщепляется фибринолитической системой, основными компонентами которой являются плазминоген и активатор плазминогена тканевого типа (tPA). Оба этих белка были включены в полимеризующийся фибрин, где они взаимодействуют с образованием плазмина, который, в свою очередь, действует на фибрин для растворения образованного сгустка. Во время образования сгустков ингибиторы факторов свертывания также циркулируют в крови для предотвращения образования сгустков вне места повреждения.
Действие системы от травмы до формирования сгустка и последующий фибринолиз описаны ниже.
1. Адгезия и агрегация тромбоцитов.
Свертывание крови активно блокируется при нормальных условиях. Эндотелий сосудов поддерживает расширение кровеносных сосудов, препятствует адгезии и активации тромбоцитов, подавляет коагуляцию, усиливает расщепление фибрина и обладает противовоспалительными свойствами. Клетки эндотелия сосудов секретируют молекулы, такие как оксид азота (NO) и простациклин, которые ингиби-руют агрегацию тромбоцитов и расширяют кровеносные сосуды. Высвобождение этих молекул активирует растворимую гуанилатциклазу (рГЦ) и цГМФ-зависимую протеинкиназу I (cGKI) и увеличивает уровень циклического гуанозинмонофосфата (цГМФ), что вызывает расслабление гладкой мускулатуры в стенке сосуда. Кроме того, эндотелиальные клетки экспрессируют на поверхности клетки АДФазы, такие как CD39, которые контролируют активацию и агрегацию тромбоцитов путем преобразования АДФ, высвобожденного из тромбоцитов, в адениновые нуклеотиды, ингибирующие тромбоциты. Эндотелий играет важную роль в регуляции ферментов фибринолитического каскада. Эндотелиальные клетки непосредственно содействуют образованию плазмина через экспрессию рецепторов плазминогена (ан-нексина II) и урокиназы, а также через секрецию активатора плазминогена тканевого типа и урокиназно-го активатора плазминогена, все они способствуют растворению сгустка. Эндотелиальные клетки также играют активную роль в подавлении свертывания через образование гепарансульфата, который увеличивает кинетику ингибирования тромбина и других факторов свертывания крови антитромбином III.
При острой сосудистой травме, однако, сосудосуживающие механизмы преобладают и эндотелий приобретает протромботический, прокоагулянтный и провоспалительный характер. Это достигается за счет уменьшения количества эндотелиальных расширяющих агентов: аденозина, NO и простациклина, а также прямым действием АДФ, серотонина и тромбоксана на гладкомышечные клетки сосудов, что вызывает их сокращение (Becker, Heindl и др., 2000). Главным толчком к изменению функции эндотелия, который приводит к формированию гемостатического тромба, является потеря эндотелиального барьера между кровью и компонентами внеклеточного матрикса (ЕСМ) (Ruggeri (2002) Nat Med 8:1227-1234). Циркулирующие тромбоциты выявляют и различают зоны поражения эндотелия и прикрепляются к экспонированному субэндотелию. Их взаимодействие с различными тромбогенными субстратами и локально образованными или высвобожденными агонистами приводит к активации тромбоцитов. Этот процесс описывают как включающий два этапа: 1) прикрепление - начальное связывание с поверхностью и 2) агрегацию - склеивание тромбоцитов друг с другом (Savage и др., (2001) Curr Opin Hematol 8:270-276).
Адгезия тромбоцитов начинается, когда циркулирующие тромбоциты связываются с экспонированным коллагеном через взаимодействие со связывающими коллаген белками на поверхности клеток и через взаимодействие с фактором Виллебранда, присутствующим на эндотелии. Фактор Виллебранда представляет собой белок мультимерной структуры и переменного размера, секретируемый эндотелием в двух направлениях: базолатерально и в кровоток. Фактор Виллебранда также связывается с фактором VIII, что играет важную роль в стабилизации фактора VIII и его существовании в крови.
Адгезия и последующая активация тромбоцитов достигаются при связывании фактора Виллебранда через домен А1 с GPIb (часть гликопротеинового рецепторного комплекса тромбоцитов GPIB-IX-V). Взаимодействие между фактором Виллебранда и GPIb регулируется поперечной силой, так что увеличение поперечного натяжения приводит к соответствующему увеличению аффинности фактора Виллеб-ранда к GPIb.
Интегрин а1р2, также известный как белок VLA-2 на лейкоцитах, является главным рецептором коллагена тромбоцитов, и связывание с этим рецептором генерирует внутриклеточные сигналы, которые способствуют активации тромбоцитов. Связывание a1p2 облегчает связывание с рецепторами коллагена низкой аффинности GP VI. Указанные рецепторы являются частью суперсемейства иммуноглобулинов и генерируют самый мощный внутриклеточный сигнал активации тромбоцитов. Активация тромбоцитов приводит к высвобождению аденозиндифосфата (АДФ), который превращается в тромбоксан А1.
Активации тромбоцитов также приводит к экспрессии на поверхности тромбоцитов гликопротеина рецептора IIB-IIIa (GP IB-IIIa), также известного как интегрин тромбоцитов aIIbp3 Рецепторы GP IIB-IIIa позволяют тромбоцитам присоединяться друг к другу (агрегировать) за счет молекул фибриногена, связывающих тромбоциты через рецепторы. Это приводит к образованию тромбоцитарной пробки на месте повреждения, что способствует предотвращению дальнейшей потери крови, а поврежденные ткани сосудов высвобождают факторы, которые запускают каскад коагуляции и образование стабилизированной фибриновой сетки вокруг тромбоцитарной пробки.
2. Каскад свертывания.
Коагуляционный путь представляет собой протеолитический путь, в котором каждый фермент присутствует в плазме в виде зимогена, неактивной формы. Расщепление зимогена приводит к образованию активной формы из молекулы-предшественника. Кофакторы активированных протеаз, такие как глико-протеины FVIII и FV, также активируются в каскаде реакций и играют важную роль в формировании сгустка. Коагуляционный путь функционирует как система положительных и отрицательных обратных связей, которые контролируют процесс активации, где конечной целью пути является образование тромбина, который затем может превращать растворимый фибриноген в фибрин с образованием сгустка. Факторы коагуляции, как правило, обозначают римскими цифрами со строчной буквой "а" для указания активированной формы. В табл. 3 ниже приведен примерный перечень факторов, включая их общепринятое название и роль в свертывании. Как правило, указанные белки участвуют в свертывании крови по одному или нескольким путям, таким как внутренний, внешний или общий пути свертывания (см. фиг. 1). Как будет показано ниже, эти пути взаимосвязаны, и свертывание крови, как полагают, происходит по клеточной модели, а активация фактора VII (FVII) является основным инициатором свертывания.
Таблица 3
Образование тромбина исторически было разделено на три пути, внутренний (в предположении, что все компоненты пути содержит плазма), внешний (в предположении, что один или более компонентов пути являются внешними по отношению к плазме) пути, которые обеспечивают альтернативные маршруты образования активированного фактора X (FXa), и окончательный общий путь, приводящий к образованию тромбина (фиг. 1). Эти пути вместе участвуют во взаимосвязанном и взаимозависимом процессе, приводящем к свертыванию. Была разработана клеточная модель коагуляции, описывающая эти пути (фиг. 2) (Hoffman и др. (2001) Thromb Haemost 85:958-965). В этой модели "внешний" и "внутренний" пути осуществляются на различных клеточных поверхностях, несущей тканевый фактор (ТФ) клетке и тромбоците соответственно. Процесс коагуляции разделен на отдельные фазы, инициацию, усиление и распространение, в ходе которых внешний и внутренний пути функционируют на различных этапах для получения большого количества тромбина, необходимого для преобразования достаточного количества фибриногена в фибрин для образования сгустка.
а. Инициация.
FVII считают фактором свертывания, отвечающим за инициацию каскада свертывания, которая зависит от его взаимодействия с ТФ. ТФ является трансмембранным гликопротеидом, экспрессируемым в различных клетках, таких как гладкомышечные клетки, фибробласты, моноциты, лимфоциты, грануло-циты, тромбоциты и эндотелиальные клетки. Миелоидные клетки и эндотелиальные клетки экспресси-руют ТФ только при стимулировании, например, провоспалительными цитокинами. Гладкомышечные клетки и фибробласты, однако, экспрессируют ТФ конститутивно. Соответственно, как только эти клетки вступают в контакт с кровотоком после повреждения тканей, свертывание быстро инициируется связыванием ТФ с фактором VII или FVIIa в плазме.
Как будет показано ниже, большая часть FVII в крови присутствует в зимогенной форме с небольшим количеством, примерно составляющим 1%, присутствующим в виде FVIIa. Однако в отсутствие связывания с ТФ даже FVIIa обладает зимогеноподобными характеристиками и не проявляет значительную активность, пока не образует комплекс с ТФ. Таким образом, FVII плазмы требует для полноценной активности протеолитического расщепления, а также дополнительных конформационных изменений при взаимодействии с ТФ. Было показано, что ряд протеаз, в том числе факторы IXa, Xa, XIIa и тромбин, способны расщеплять FVII in vitro, этот процесс ускоряется в присутствии ТФ. FVIIa также может активировать FVII в присутствии ТФ, этот процесс называется самоактивацией. Небольшие количества FVIIa присутствуют в крови, вероятно, из-за активации фактором FXa и/или FIX (Wildgoose и др., (1992) Blood 80:25-28, и Butenas и др. (1996) Biochemistry 35:1904-1910). Комплексы ТФ/FVIIa могут, таким образом, быть сформированы прямым связыванием FVIIa с ТФ или связыванием FVII с ТФ и последующей активацией FVII в FVIIa протеазой плазмы, такой как FXa, FIX, FXIIa или сам FVIIa. Комплекс ТФ/FVIIa остается связанным с несущей ТФ клеткой, где он активирует небольшие количества FX с образованием FXa в так называемом "внешнем пути" коагуляции.
Комплекс ТФ/FVIIa также расщепляет небольшие количества FIX с образованием FIXa. FXa ассоциирует со своим кофактором FVa с образованием комплекса на несущей ТФ клетке, который затем может превращать протромбин в тромбин. Образуется небольшое количество тромбина, которого, однако, недостаточно для поддержания необходимого уровня образования фибрина для полного свертывания.
Кроме того, активные FXa и FIXa ингибируются в кровотоке антитромбином III (АТ-III) и другими серпинами, которые описаны более подробно ниже. Это, как правило, предотвращает свертывание крови в кровотоке. При наличии травмы, однако, повреждение сосуда приводит к агрегации тромбоцитов и активации в этом месте образования тромбина, что приводит к усилению коагуляционного сигнала.
b. Усиление.
Усиление происходит, когда тромбин связывается с тромбоцитами и активирует их. Активированные тромбоциты высвобождают FV из альфа-гранул, который активируется тромбином с образованием FVa. Тромбин также высвобождает и активирует FVIII из FVIII/vWF комплекса на мембране тромбоцитов и расщепляет FXI в FXIa. Эти реакции приводят к активированным тромбоцитам с FVa, FVIIIa и FIXa на поверхности, которые представляют собой основу для стремительного увеличения количества тромбина на этапе распространения.
c. Распространение.
Распространение коагуляции происходит на поверхности большого количества тромбоцитов в месте повреждения. Как описано выше, активированные тромбоциты несут FXIa, FVIIIa и FVa на своей поверхности. Именно здесь осуществляется внешний путь свертывания. FXIa активирует FIX с образованием FIXa, который затем может связаться с FVIIIa. Этот процесс вместе с образованием небольшого количества FIXa при расщеплении закрепленного на несущей ТФ клетке ТФ/FVIIa комплекса приводит к большому количеству FXIa/FVIIIa комплексов, которые, в свою очередь, могут активировать значительное количество FX с образованием FXa. Молекулы FXa связываются с FVa с образованием протромби-назных комплексов, которые активируют протромбин в тромбин.
Тромбин действует в положительной обратной связи, активируя еще больше тромбоцитов и снова инициируя процессы, описанные для фазы усиления.
Очень быстро накапливается достаточное количество активированных тромбоцитов с соответствующими комплексами для создания большого количества тромбина, которого достаточно для получения достаточного количества фибрина из фибриногена для формирования сгустка фибрина. Фибриноген представляет собой растворимый в плазме димер, который при расщеплении тромбином высвобождает фибринопептид А и фибринопептид В. Фибринопептид В затем расщепляется тромбином, и полученные в результате второго протеолитического расщепления мономеры фибрина спонтанно формируют нерастворимый гель. Полимеризованный фибрин удерживается нековалентными и электростатическими силами и стабилизируется трансамидирующим ферментом фактором XIIIa (FXIIIa), образованным при расщеплении FXIII тромбином. Тромбин также активирует TAFI, который ингибирует фибринолиз за счет уменьшения образования плазмина на поверхности сгустка. Кроме того, тромбин сам включается в структуру сгустка для дальнейшей стабилизации. Описанные нерастворимые агрегаты фибрина (сгустки) вместе с агрегированными тромбоцитами (тромбы) блокируют поврежденный кровеносный сосуд и предотвращают дальнейшее кровотечение.
3. Регуляция свертывания.
Во время свертывания каскад регулируется конститутивными и стимулированными процессами, ингибирующими дальнейшее формирование сгустка. Для наличия таких регулирующих механизмов существует несколько причин. Во-первых, регуляция необходима для ограничения ишемии тканей при формирования сгустка фибрина. Во-вторых, регуляция предотвращает распространение тромбоза, ограничивая образование сгустка только местом повреждения тканей.
Регуляция достигается за счет нескольких ингибиторных молекул. Например, антитромбин III (AT-III) и ингибитор пути тканевого фактора (TFPI) конститутивно ингибируют факторы каскада свертывания. АТ-III ингибирует тромбин, FIXa и FXa, в то время как TFPI ингибирует FXa и FVIIa/ТФ комплекс.
Дополнительный фактор белок С, который стимулируется активацией тромбоцитов, регулирует коагуляцию путем протеолитического расщепления и инактивации FVa и FVIIIa. Белок S повышает активность белка С. Кроме того, еще одним фактором, который способствует ингибированию коагуляции, является интегральный мембранный белок тромбомодулин, который образуют эндотелиальные клетки сосудов и который служит в качестве рецептора для тромбина. Связывание тромбина с тромбомодулином ингибирует прокоагулянтную активность тромбина, а также способствует активации белка С.
Фибринолиз, разрушение фибринового сгустка, также представляет собой механизм регуляции свертывания. Сшитые мультимеры фибрина в сгустке разрушаются до растворимых полипептидов плаз-мином, сериновой протеазой. Плазмин может быть получен из его неактивного предшественника плаз-миногена и привлечен к фибриновому сгустку двумя способами: за счет взаимодействия с тканевым активатором плазминогена (tPA) на поверхности фибринового сгустка и за счет взаимодействия с уроки-назным активатором плазминогена (УАП) на клеточной поверхности. Полагают, что первый механизм является основным механизмом, ответственным за растворение тромбов в кровеносных сосудах. Второй механизм, способный опосредовать растворение сгустка, может также играть важную роль в перестройке ткани, миграции клеток и воспалении.
Растворение сгустка также регулируется двумя путями. Во-первых, эффективная активация плаз-мина и фибринолиз происходят только в комплексах, образованных на поверхности сгустка или на клеточной мембране, в то время как свободные белки в крови являются неэффективными катализаторами и быстро инактивируются. Во-вторых, активаторы плазминогена и плазмин инактивируются такими молекулами, как ингибитор активатора плазминогена 1 типа (PAI-1) и PAI-2, которые действуют на активаторы плазминогена, и такими как а2-антиплазмин и а2-макроглобулин, которые инактивируют плазмин. При нормальных обстоятельствах временной баланс между коагуляцией и фибринолизом приводит к эффективному формированию и растворению сгустков после повреждения сосудов, одновременно предотвращая нежелательные случаи тромбообразования или кровотечения.
Краткое описание примеров факторов свертывания крови, кофакторов и регуляторных белков и их активности приведены в табл. 4 ниже.
Таблица 4
Антитромбин III
Ингибирует свертывание, прежде всего тромбин и фактор Ха, но также факторы IXa, XIa и Vila, и Vila в комплексе с ТФ
Ингибитор пути тканевого фактора (TFPI)
Связывает фактор Ха и образует четвертичную структуру с ТФ/FVIIa для ингибирования ТФ/FVIIa
* Таблица адаптирована из M.W. King (2006) med.unibs.it/~Marchesi/blood.html С. Фактор VII (FVII).
Фактор VII представляет собой витамин K-зависимую сериновую протеазу, гликопротеин, который синтезируется у животных, включая млекопитающих, в виде одноцепочечного зимогена в печени и выделяется в кровь. Как описано выше, FVII является протеазой, участвующей в свертывании крови, ответственной за инициирование каскада протеолитических событий, которые приводят к образованию тромбина и фибрина. Фактор VII является частью внешнего пути, хотя продукты его активности также в значительной степени влияют на внутренний путь. Его интегральная роль в формировании сгустка привлекла значительный интерес к FVII в качестве мишени для клинической антикоагулянтной и гемостатиче-ской терапии. Например, рекомбинантный активированный FVII (rFVIIa) был разработан как гемостати-ческий агент для лечения гемофилических субъектов и субъектов с другими состояниями, связанными с кровотечением. В настоящем документе предусмотрены модифицированные полипептиды FVII, которые обладают увеличенной коагулянтной активностью после активации и которые могут служить улучшенным лекарственным средством для лечения заболеваний и состояний, поддающихся лечению фактором
VII.
1. Структура и организация FVII.
Человеческий ген FVII (F7) находится на хромосоме 13 в 13q34 и составляет 12,8 тпн в длину с 9 экзонами. Ген FVII обладает значительным сходством организации с генами, кодирующими другие витамин K-зависимые белки, такие как протромбин, фактор IX, фактор X и белок С. мРНК FVII претерпевает альтернативный сплайсинг с образованием двух транскриптов: вариант 1 (последовательность Gen-bank № NM 000131, приведенная в SEQ ID NO: 81) и вариант 2 (последовательность Genbank NM019616, приведенная в SEQ ID NO: 82). Вариант 2 транскрипта, который является более распространенной формой в печени, не включает экзон 1b и, таким образом, кодирует короткий предшественник полипептида из 444 аминокислот (изоформа предшественника FVII В; SEQ ID NO: 2) по сравнению с полипептидом-предшественником, включающим 466 аминокислот, кодируемым вариантом 1 транскрипта (изоформа предшественника FVII A; SEQ ID NO: 1). Аминокислоты, которые не представлены в изо-форме В предшественника полипептида FVII, соответствуют аминокислотным позициям с 22 по 43 изо-формы А предшественника FVII. Эти аминокислоты являются частью пропептидной последовательности, что приводит к усеченному пропептиду в изоформе В FVII. Полипептиды-предшественники состоят из следующих сегментов и доменов: гидрофобного сигнального пептида (аминокислоты 1-20 из SEQ ID NO: 1 и 2), пропептида (аминокислоты 21-60 из SEQ ID NO: 1, аминокислоты 21-38 из SEQ ID NO: 2), домена Gla (аминокислоты 39-83 из SEQ ID NO: 2, аминокислоты 61-105 из SEQ ID NO: 1), домена эпидермального фактора роста типа В (EGF-подобный домен 1, аминокислоты 84-120 из SEQ ID NO: 2, аминокислоты 106-142 из SEQ ID NO: 1), домена эпидермального фактора роста типа А (EGF-подобный домен 2, аминокислоты 125-166 из SEQ ID NO: 2, аминокислоты 147-188 из SEQ ID NO: 1) и домена сери-новой протеазы (аминокислоты 191-430 из SEQ ID NO: 2, аминокислоты 213-452 из SEQ ID NO: 1). Включающая 406 аминокислот зрелая форма полипептида FVII (SEQ ID NO: 3) не включает сигнальный пептид и пропептидную последовательность и является идентичной по длине и последовательности независимо от изоформы предшественника, из которой возникла зрелая форма. В зрелой форме полипептида FVII вышеупомянутым доменам соответствуют следующие аминокислотные позиции: домен Gla (аминокислоты 1-45 из SEQ ID NO: 3), EGF-подобный домен 1 (аминокислоты 46-82 из SEQ ID NO: 3), EGF-подобный домен 2 (аминокислоты 87-128 из SEQ ID NO: 3) и домен сериновой протеазы (аминокислоты 153-392 из SEQ ID NO: 3).
Домен Gla из FVII является связывающим мембрану мотивом, который в присутствии ионов кальция взаимодействует с фосфолипидами мембраны, которые включают фосфатидилсерин. Домен Gla также играет роль в связывании кофактора FVIIa, тканевого фактора (ТФ). В комплексе с ТФ домен Gla из FVIIa связывает семь ионов Са2+, выпускает три гидрофобных боковых цепи в направлении клеточной мембраны для взаимодействия с фосфолипидами на поверхности клеток и образует значительный контакт с С-концевым доменом ТФ. Gla домены консервативны среди витамин K-зависимых белков, таких как протромбин, факторы свертывания крови VII, IX и X, белки С, S и Z. Этим белкам требуется витамин K для пост-трансляционного синтеза у-карбоксиглутаминовой кислоты, сосредоточенной в N-концевом домене Gla этих белков. Все остатки глутаминовой кислоты в этом домене являются потенциальными сайтами карбоксилирования, и многие из них являются модифицированными путем карбоксилирования.
В дополнение к домену Gla зрелый белок FVII также содержит два EGF-подобных домена. Первый EGF-подобный домен (EGF-подобный домен 1 или EGF1) является связывающим кальций доменом EGF, в котором шесть консервативных цистеинов кора образуют три дисульфидных моста. Домен EGF1 из
FVII связывает только один ион Са2+, но со значительно более высокой аффинностью, чем домен Gla (Banner и др., (1996) Nature 380:41-46). Связывание иона Са2+ способствует сильному взаимодействию между доменом EGF1 из FVII и ТФ (Osterlund и др., (2000) Eur. J. Biochem. 267:6204-6211). Второй EGF-подобный домен (EGF-подобный домен 2 или EGF2) не является связывающим кальций доменом, но также образует 3 дисульфидных моста. Как и другие домены FVII EGF2, домен взаимодействует с ТФ. EGF2 домен также образует дисульфидную связь с протеазным доменом, с которым он обладает большой поверхностью контакта. Наконец, домен сериновой протеазы FVII является доменом, ответственным за протеолитическую активность FVIIa. Последовательность аминокислот каталитического домена FVII обладает высокой идентичностью последовательности и сходством третичной структуры с другими сериновыми протеазами, такими как трипсин и химотрипсин (Jin и др., (2001) J. Mol. Biol., 307: 15031517). Например, указанные сериновые протеазы обладают общей каталитической триадой Н57, D102, S195 по нумерации химотрипсина. В отличие от других сериновых протеаз, однако, расщепления FVIIa не достаточно для полного преобразования зимогена в полностью активный фермент. Вместо этого, как указано ниже, FVIIa аллостерически активируется при связывании с ТФ рецептором на поверхности клетки, который индуцирует конформационные изменения в протеазном домене FVIIa, переводя его из зимогеноподобного неактивного состояния в каталитически активный фермент. Район, включающий спираль и петлю, расположенный между сайтом связывания кофактора и активным сайтом FVIIa (т.е. аминокислотные остатки 305-321, соответствующие аминокислотным остаткам 163-170 по нумерации химотрипсина), важен для аллостерической регуляции и зимогенности FVIIa (Persson и др. (2004) Bio-chem. J., 379: 497-503). Указанный район состоит из короткой а-спирали (аминокислотные остатки с 307 по 312) и следующей за ней петли. N-концевая часть спирали формирует часть поверхности контакта между протеазным доменом и ТФ и содержит множество остатков, которые важны для протеазной активности и связывания ТФ. Сравнение кристаллической структуры FVIIa и FVIIa в комплексе с ТФ указывает, что а-спираль претерпевает значительные конформационные изменения при связывании FVIIa с ТФ. а-Спираль FVIIa без ТФ деформирована, укорочена и иначе ориентирована. Напротив, а-спираль FVIIa в комплексе с ТФ стабилизирована, и соседние петли расположены ближе к активному центру. В указанной стабилизации участвует, по меньшей мере, метионин в позиции 306 FVII (аминокислотный остаток Met164 по нумерации химотрипсина) (Pike и др. (1999) PNAS 8925-8930).
2. Пост-трансляционные модификации.
Полипептид-предшественник FVII (либо изоформа гена фактора VII) направляется по секреторному клеточному пути за счет гидрофобного сигнального пептида, который проникает в эндоплазматический ретикулум (ЭР), чтобы начать перемещение через мембрану. В процессе перемещения белка через мембрану ЭР включающий 20 аминокислот сигнальный пептид отщепляется сигнальной пептидазой в просвете ЭР, после чего полипептид подвергается дальнейшим пост-трансляционным модификациям, в том числе N- и О-гликозилированию, витамин K- зависимому карбоксилированию N-концевых остатков глу-таминовой кислоты в у-карбоксиглутаминовую кислоту и гидроксилированию аспарагиновой кислоты в p -гидроксиаспарагиновую кислоту.
Пропептид содержит сайт связывания витамин K-зависимой карбоксилазы, которая распознает ам-фипатическую а-спираль в пропептиде FVII из 10 остатков. После связывания карбоксилаза у-карбоксилирует 10 остатков глутаминовой кислоты в домене Gla полипептида FVII с образованием у-карбоксиглутамильных остатков в положениях Е66, Е67, Е74, Е76, Е79, Е80, Е85, Е86, Е89 и Е95 аминокислотной последовательности предшественника FVII, приведенной в SEQ ID NO: 2. Эти положения соответствуют положениям Е6, Е7, Е14, Е19, Е20, Е25, Е26, Е29 и Е35 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. Для оптимальной активности молекулам FVII требуется кальций, который связывается полипептидом и облегчает конформационные изменения, необходимые для связывания FVIIa с ТФ и липидами. у-Карбоксилированный домен Gla связывает семь ионов Са с различной аффинностью, что индуцирует конформационные изменения, позволяющие домену Gla взаимодействовать с С-концевым доменом ТФ, а также фосфатидилсеринами или другими отрицательно заряженными фосфолипидами на мембране тромбоцитов.
N-гликозилирование осуществляется путем переноса фрагмента Glc3Man9(GlcNAc) на два остатка аспарагина в полипептиде FVII в позициях, которые соответствуют аминокислотным остаткам 145 и 322 зрелого белка (SEQ ID NO: 3). О-гликозилирование претерпевают аминокислотные остатки 52 и 60 зрелого полипептида и гидроксилированная в p-гидроксиаспарагиновая кислота, находящаяся в положении остатка аспарагиновой кислоты 63. Указанные О-гликозилированные сериновые остатки и остаток p-гидроксилированной аспарагиновой кислоты находятся в EGF-1 домене FVII. Указанные модификации осуществляются в ЭР и комплексе Гольджи перед окончательным процессингом полипептида в его зрелую форму.
3. Процессинг FVII.
Модифицированный про-FVII полипептид транспортируется через просвет Гольджи к транс-Гольджи компартменту, где пропептид отщепляется пропептидазой непосредственно перед секрецией белка из клетки. РАСЕ/фурин (где РАСЕ является аббревиатурой от термина "фермент, расщепляющий
пары основных аминокислот") является эндопептидазой, локализованной в мембране Гольджи, которая расщепляет многие белки с карбоксиконцевой стороны последовательности Arg-[любой остаток]-(1^ или Arg)-Arg. Эта пропептидаза расщепляет витамин K-зависимые гликопротеины, такие как полипептиды профактора IX и про-vWF (Himmelspach и др., (2000) Thromb Research 97; 51-67), отделяя пропептид от зрелого белка. Включение соответствующего сайта распознавания РАСЕ/фурина в предшественника рекомбинантного фактора VII способствует правильному процессингу и секреции рекомбинантного полипептида (Margaritas и др., (2004) Clin. Invest. 113(7): 1025-1031). РАСЕ/фурин или другая субтилизин-подобная пропептидаза, вероятно, ответственна за протеолитическое превращение про-FVII в FVII. Про-пептидаза может распознавать и связывать -Arg-Arg-Arg-Arg- консенсусный мотив, соответствующий аминокислотным позициям 35-38 в последовательности, приведенной в SEQ ID NO: 1, и позициям 57-60 в последовательности, приведенной в SEQ ID NO: 2, и, отщепляя пропептид, освобождать зрелый белок для секреции.
4. Активация FVII.
Большая часть FVII в крови находится в виде неактивированного одноцепочечного зимогена, хотя его небольшое количество присутствует в двухцепочечной активированной форме. Активация FVII происходит за счет протеолитического расщепления связи Arg152-Ile153 (позиции в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), что приводит к двухцепочечному полипептиду, содержащему 152 аминокислоты в легкой цепи (примерно 20 кДа), связанной дисульфидным мостом с тяжелой цепью из 254 аминокислот (примерно 30 кДа). Легкая цепь FVIIa содержит домен Gla и EGF-подобный домен, в то время как тяжелая цепь содержит каталитический домен или домен сериновой протеазы. Превращение одноцепочечного FVII в двухцепочечный FVIIa происходит за счет расщепления FIXa, FXa, FXIIa, тромбином или автокаталитически эндогенным FVIIa (Butenas и др., (1996) Biochem 35:1904-1910;. Nakagaki и др., (1991) Biochem 30:10819-10824). Небольшое количество FVIIa, которое присутствует в кровотоке, вероятно, возникает под действием FXa и FIXa.
Как уже говорилось выше, расщепление зимогенной формы FVII с образованием FVIIa не является достаточным для полноценной активности. FVIIa требует наличия ТФ для полноценной активности (Hi-gashi и др., (1996) J. Biol. Chem. 271:26569-26574). Из-за этого FVIIa без ТФ приписывали зимогенопо-добные черты, включая зимогенные фолдинг и форму и относительно низкую активность. Указанные зимогеноподобные свойства FVIIa в отсутствие его связи с ТФ делают его относительно устойчивым к антитромбину III (AT-III) и другим серпинам, которые обычно действуют в основном на активные формы сериновых протеаз, а не на зимогенные формы. Кроме того, TFPI, главный ингибитор ТФ/FVIIa активности, также эффективно не связывает "неактивную" форму FVIIa, не образовавшую комплекс с ТФ.
При образовании комплекса с ТФ FVIIa претерпевает конформационные изменения, что приводит к молекуле с полной активностью. Все домены FVII участвуют во взаимодействии с ТФ, но конформаци-онные изменения происходят в протеазном домене FVIIa. Например, конформационные изменения, которые происходят при аллостерическом взаимодействии FVIIa с ТФ, включают создание протяженного экзосайта связывания высокомолекулярного субстрата. Указанный протяженный сайт связывания значительно усиливает протеолитическую активацию фактора X белком FVII. Активность FVIIa дополнительно увеличивается (в тысячу раз) при взаимодействии FVIIa с поверхностью экспрессирующей ТФ клетки. Это происходит за счет того, что фосфолипиды мембран, включающие отрицательно заряженные фосфолипиды, такие как фосфатидилсерин, являются местом взаимодействия других витамин K-зависимых факторов свертывания крови, таких как FIX и FX, которые связываются с мембраной с помощью своих доменов Gla. Это приводит к высокой локальной концентрация указанных витамин K-зависимых белков на поверхности клеток, способствуя их взаимодействию с комплексом ТФ/FVIIa.
5. Активность FVII.
Хотя FVIIa проявляет увеличенную активность после аллостерической активации фактором ТФ, есть доказательства того, что существуют механизмы, в которых свободный FVIIa может инициировать коагуляцию. Следовательно, FVII может функционировать как ТФ-зависимо, так и ТФ-независимо. Последний путь может играть значительно меньшую роль в нормальном гемостазе, хотя его значение может возрасти в контексте нарушений свертываемости крови и их лечения.
a. Зависимая от тканевого фактора активность FVIIa.
Циркулирующий в крови FVII связывает ТФ на поверхности клетки и активирует FIXa, FXa, тромбин или автокаталитически активирует эндогенный FVIIa, как описано выше. Кроме того, очень небольшое количество циркулирующего FVIIa может непосредственно связать ТФ. ТФ/FVIIa комплекс затем связывает небольшую часть FX плазмы, и каталитический домен FVIIa расщепляет FX с образованием FXa. Таким образом, тромбин формируется во внешнем пути на поверхности несущих ТФ клеток, когда FXa образует комплекс с FVa и активирует протромбин в тромбин (фиг. 3). FIX также активируется ТФ/FVIIa комплексом, что обеспечивает связь с внутренним путем, который действует на поверхности активированных тромбоцитов. Положительная обратная связь в описанном выше каскаде свертывания представляет собой средство, с помощью которого производится большое количество тромбина, который расщепляет фибриноген в фибрин с формированием сгустка.
b. Не зависимая от тканевого фактора активность FVIIa.
В дополнение к ТФ-зависимому механизму активации FX в FXa существуют доказательства того, что FVIIa также может активировать FX в отсутствие ТФ. Активированные тромбоциты перемещают фосфатидилсерины и другие отрицательно заряженные фосфолипиды на внешнюю, обращенную к плазме поверхность мембраны (Hemker и др., (1983) Blood Cells 9:303-317). Это обеспечивает альтернативные "рецепторы", через которые может связаться FVIIa, хотя и с относительно низкой аффинностью, которая в 1000 раз меньше, чем аффинность FVIIa к ТФ (Monroe и др., (1997) Br. J. Haematol. 99:542-7). Это взаимодействие опосредовано остатками в домене Gla (Harvey и др., (2003). 278:8363-8369). FVIIa может превращать FX в FXa и FIX в FIXa на поверхности активированных тромбоцитов (Hoffman и др., (1998) Blood Coagul Fibrinolysis 9:S61-S65). FXa остается связанным с поверхностью тромбоцитов, где он может связаться с FVa для образования достаточного количества тромбина из протромбина, а вновь образованный FIXa соединяется с FVIIIa и стимулирует активацию большего количества FX в FXa (фиг. 3). Гемостаз в отсутствие ТФ может быть достигнут за счет положительной обратной связи и механизмов распространения свертывания, описанных выше. Однако следует отметить, что, хотя FVIIIa вносит вклад в процесс коагуляции на активированных тромбоцитах, его наличие не требуется для образования тромбина в ТФ-независимом механизме (фиг. 3). Таким образом, есть доказательства того, что в отсутствие фактора VIII, например, у больных гемофилией, FVIIa может инициировать и/или усиливать образование тромбина через этот вторичный механизм и может привести к формированию сгустка.
6. FVII как лекарственный препарат.
FVII инициирует свертывание крови. Рекомбинантный FVIIa (Novoseven(r); rFVIIa) предназначен для лечения кровотечений или профилактики кровотечений при хирургических или инвазивных процедурах у пациентов с гемофилией А или В с ингибиторами фактора VIII или фактора IX, а также у пациентов с врожденным дефицитом фактора VII. Novoseven(r) является генно-инженерным фактором VIIa, который производится в системе экспрессии клеток млекопитающих с использованием клеток почки детеныша хомяка (ВНК).
Агент почти идентичен фактору VIIa плазмы по структуре и функциям (Ratko и др., (2004), Р & Т,
29: 712-720).
Было показано, что введение рекомбинантного FVIIa (rFVIIa) приводит к свертыванию крови у пациентов, страдающих гемофилией, и что лечение введением FVIIa безопасно и хорошо переносится человеком. Как правило, rFVIIa использовали для лечения пациентов, которые вырабатывают ингибиторы (т.е. аллоантитела) к фактору VIII или фактору IX. Использование rFVIIa в качестве коагулянта в дальнейшем было использовано для лечения других связанных с кровоточивостью расстройств, например тромбастении Гланцманна, других состояний, связанных с обширным кровотечением, например, возникшим в результате травмы или хирургического вмешательства, включая, но не ограничиваясь пересадкой печени, операцией на простате и геморрагической травмой; rFVIIa в качестве коагулянта был использован для лечения коагулопатии новорожденных, тяжелых заболеваний печени; при трансплантации костного мозга, при тромбоцитопении и нарушениях функции тромбоцитов; при срочной отмене оральных антикоагулянтов; врожденном недостатке факторов V, VII, X и XI и болезни Виллебранда с ингибиторами фактора фон Виллебранда. Для достижения терапевтического эффекта требуется высокая доза rFVII. Дозы и режим дозирования для введения rFVII варьируют в зависимости от клинических показаний. Например, типичная доза rFVII для эпизодов кровотечения у больных гемофилией А или гемофилией В, имеющих аллоантитела, составляет 90 мкг/кг при внутривенной (ВВ) инъекции. Так как rFVII имеет период полураспада 2 ч, требуется повторное введение. Дополнительное введение может осуществляться через каждые 2 ч до остановки кровотечения. Диапазон доз может быть изменен в зависимости от тяжести состояния. Например, были эффективны дозы 35-120 мкг/кг. Кроме того, дозы и режим дозирования может меняться в зависимости от других признаков. Например, пациентам с гемофилией А или гемофилией В, перенесшим операцию, можно вводить начальную дозу 90 мкг/кг непосредственно перед операцией с повторными введениями каждые 2 ч во время и после операции. В зависимости от тяжести операции и эпизода кровотечения ВВ болюсная инфузия может продолжаться от 2 до 6 ч до достижения желаемого эффекта. У пациентов с врожденным недостатком FVII, как правило, rFVII вводят для предотвращения кровотечения при операции или других инвазивных процедурах в дозе 15-30 мкг/кг каждые 4-6 ч до остановки кровотечения.
Механизм инициирования гемостаза фактором rFVIIa объясняет потребность в высоких дозах. Пациенты с гемофилией обладают нормальной фазой начала коагуляции, где ТФ/FVIIa комплекс активирует FX в FXa и приводит к образованию тромбина на несущей ТФ клетке. Впоследствии, однако, процесс коагуляции нарушается, так как у больных гемофилией отсутствует фактор VIII (гемофилия А) или FIX (гемофилия В), и поэтому у пациентов не происходит образование FVIIIa/FIXa комплексов на поверхности активированных тромбоцитов, которые обычно служат для активации большого количества FX в FXa в фазах усиления и распространения, описанных выше. В связи с наличием ингибиторов, таких как TFPI и АТ-III, фактор FXa, образованный на несущей ТФ клетке в результате расщепления ТФ/FVIIa комплексом, не способен легко диффундировать между поверхности клеток. В результате образования большого количества тромбина на поверхности активированных тромбоцитов не происходит, и сгусток не образуется.
Существует доказательство того, что кровоостанавливающее действие высоких доз rFVIIa может быть достигнуто за счет ТФ-зависимого и/или ТФ-независимого образования FXa фактором rFVIIa на активированных тромбоцитах (фиг. 3). ТФ-зависимое образование тромбина может быстро достичь максимальной скорости при насыщении молекул ТФ эндогенным FVIIa и rFVIIa. В некоторых случаях rFVI-Ia в высокой дозе может связывать активированные тромбоциты и превращать FX в FXa. Связанный с поверхностью FXa активирует FVa с образованием достаточного количества тромбина для гемостаза. Так как rFVII связывается с поверхностью тромбоцитов с низкой аффинностью, для образования тромбина может быть необходима высокая доза rFVII. Активация FXa на активированных тромбоцитах гарантирует, что rFVIIa-опосредованной гемостаз происходит в месте повреждения.
Способ снижения дозы rFVII может улучшить полезность и эффективность rFVII в качестве лекарственного средства. В настоящем документе предусмотрены модифицированные полипептиды FVII. К ним относятся модифицированные FVII полипептиды, обладающие повышенной устойчивостью к АТ-III и увеличенной каталитической активностью в присутствии и/или в отсутствие ТФ. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также могут обладать повышенной устойчивостью к TFPI, повышенной устойчивостью к ингибиторному эффекту Zn2+ , улучшенными фармако-кинетическими свойствами, такими как увеличенное время полураспада в сыворотке, увеличенным связыванием и/или аффинностью к активированным тромбоцитам, увеличенным связыванием и/или аффинностью к сывороточному альбумину и/или увеличенным связыванием и/или аффинностью к интегрину тромбоцитов aIIbp3. Указанные модифицированные полипептиды FVII могут проявлять увеличенную коагулянтную активность. Полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения, инициируя гемостаз по ТФ-зависимому и/или ТФ-независимому механизму, что приводит к образованию FXa и образованию тромбина.
D. Модифицированные полипептиды FVII.
В настоящем документе предусмотрены модифицированные полипептиды FVII. Полипептиды FVII проявляют изменения в одном или более видах активности или свойствах по сравнению с полипептидом FVII, который не был модифицирован или был модифицирован иначе. Активности или свойства, которые могут быть изменены в результате модификации, включают, но не ограничиваются, коагулянтной активностью; прокоагулянтной активностью; протеолитической или каталитической активностью, такой как активация фактора X (FX) или активация фактора IX (FIX); антигенностью (способностью связываться с анти-FVII антителом или конкурировать с полипептидом за связывание с анти-FVII антителом); способностью связывать тканевый фактор, фактор X или фактор IX; способностью связывать фосфоли-пиды; периодом полураспада; трехмерной структурой; pI и/или конформацией. Как правило, модифицированные полипептиды FVII проявляют прокоагулянтную активность. В настоящем документе предусмотрены модифицированные полипептиды FVII, которые обладают повышенной коагулянтной активностью при активации их зимогенной одноцепочечной формы. Такие модифицированные полипептиды FVII могут быть использованы для лечении нарушений свертываемости крови или состояний, таких как гемофилии или травмы, где полипептиды FVII могут содействовать свертыванию крови. Модифицированные полипептиды FVII включают полипептиды, которые обладают повышенной устойчивостью к ингибиторам, таким как антитромбин III (AT-III) и ингибитор пути тканевого фактора (TFPI), полипептиды, которые обладают повышенной устойчивостью к ингибиторному эффекту Zn2+, полипептиды, которые обладают увеличенной каталитической активностью в присутствии и/или в отсутствие ТФ, полипептиды, которые обладают улучшенными фармакокинетическими свойствами, такими как увеличенный период полураспада, полипептиды, которые обладают увеличенным связыванием и/или аффинностью к поверхности тромбоцитов, полипептиды, которые обладают увеличенным связыванием и/или аффинностью к сывороточному альбумину, и полипептиды, которые обладают увеличенным связыванием и/или аффинностью к интегрину тромбоцитов aIIbp3. В частности, такие модифицированные полипептиды FVII могут быть использованы при заболеваниях или состояниях для обеспечения коагулянтной активности в обход потребности в FVIIIa и FIXa. В одном примере модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения пациентов с гемофилией, имеющих антитела к FVIIIa и FIXa. Следовательно, модифицированные полипептиды FVII, предусмотренные в настоящем документе, обладают преимуществами, включая уменьшение количества вводимого FVII, которое требуется для поддержания достаточной для гемостаза концентрации активного FVII в сыворотке крови. Это может привести, например, к более низким дозам и/или меньшей частоте введения, необходимым для достижения сопоставимого биологического эффекта, к повышению комфортности лечения и одобрения лечения субъектами и к ослаблению побочных эффектов. Модификации полипептида FVII могут быть введены в любую форму полипептида FVII, в том числе в аллельные и видовые варианты полипептида, варианты сплайсинга, в известные в уровне техники варианты или в гибридные или химерные молекулы FVII. Например, предусмотренные в настоящем документе модификации могут быть введены в полипептид-предшественник FVII, приведенный в SEQ ID NO: 1 или 2, в зрелый полипептид FVII, приведенный в SEQ ID NO: 3, или в любой видовой, аллельный или модифицированный вариант полипептида и в их активные фрагменты, которые имеют 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97,
98 или 99% идентичности последовательности с любым из полипептидов FVII, приведенных в SEQ ID NO: 1-3. Аллельные варианты FVII включают, но не ограничиваются, любыми полипептидами-предшественниками, обладающими последовательностью аминокислот, приведенной в любой из SEQ ID NO: 18-74. Примеры видовых вариантов, которые могут быть модифицированы по настоящему документу, включают, но не ограничиваются, человеческими и не человеческими полипептидами, включая полипептиды FVII коровы, мыши, карликового шимпанзе, шимпанзе, кролика, крысы, макаки резус, свиньи, собаки, рыбы-зебры, рыбы фугу, курицы, орангутанга и гориллы, последовательности которых приведены в SEQ ID NO: 4-17 соответственно. Модификации в полипептиде FVII могут быть введены в полипептид FVII, который также содержит другие модификации, как описано в уровне техники, включая модификации первичной последовательности и модификации не в первичной последовательности полипептида.
Модификации полипептидов FVII также включают модификации полипептидов, которые являются гибридами различных полипептидов FVII, а также синтетических полипептидов FVII, полученных ре-комбинантно или синтезированных или построенных другими способами, известными в уровне техники, на основании последовательности известных полипептидов. Например, при выравнивании FVII с другими членами семейства факторов свертывания, такими как фактор IX (FIX) или фактор X (FX), среди членов семейства могут быть легко идентифицированы гомологичные домены. Могут быть сконструированы химерные варианты полипептидов FVII, в которых одна или более аминокислот или целые домены в аминокислотной последовательности FVII заменены с использованием аминокислотной последовательности соответствующего члена семейства. Кроме того, химерные полипептиды FVII включают полипептиды, в которых одна или более аминокислот или целые домены в аминокислотной последовательности человеческого FVII заменены с использованием аминокислотной последовательности различных видов (см., например, Williamson и др., (2005) J. Thromb. Haemost. 3: 1250-6). Такие химерные белки могут быть использованы в качестве начального, немодифицированного полипептида FVII в настоящем документе.
Предусмотренные в настоящем документе модификации начального, немодифицированного полипептида включают аминокислотные замены, вставки или удаления или любые их комбинации. Например, модифицированные полипептиды FVII включают полипептиды с 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 или более модифицированными позициями. Также в настоящем документе предусмотрены модифицированные полипептиды FVII с двумя или более модификациями по сравнению с начальным полипептидом FVII. Модифицированные полипептиды FVII относятся к полипептидам с 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 или более модифицированными позициями. Любые модификации, предусмотренные в настоящем документе, могут быть объединены с любыми другими модификациями, известными специалисту в данной области техники, если полученный модифицированный полипептид FVII проявляет увеличенную коагулянтную активность, когда он находится в двухцепочечной форме. Как правило, модифицированные полипептиды FVII обладают повышенной коагулянтной активностью. Активности или свойства, которые могут быть изменены в результате модификации, включают, но не ограничиваются, коагулянтной активностью; про-коагулянтной активностью; протеолитической или каталитической активностью, включая активацию фактора X (FX) или активацию фактора IX (FIX); антигенностью (способностью связывать анти-FVII антитела или конкурировать с полипептидом за связывание с анти-FVII антителами); способностью связывать тканевый фактор, ингибитор пути тканевого фактора (TFPI), антитромбин III, фактор X или фактор IX; способностью связывать фосфолипиды, сывороточный альбумин или интегрин тромбоцитов aIIbp3; периодом полураспада в сыворотке; трехмерной структурой; pI и/или конформацией. Модифицированные полипептиды FVII по настоящему документу включают полипептиды, которые имеют повышенную устойчивость к антитромбину III (AT-III), увеличенную каталитическую активность в присутствии и/или в отсутствие ТФ, повышенную устойчивость к ингибитору пути тканевого фактора (TFPI), повышенную устойчивость к ингибиторному эффекту Zn2+, улучшенные фармакокинетические свойства, такие как увеличенное время полураспада в сыворотке, увеличенную собственную активность, измененное гликозилирование, повышенную аффинность и/или связывание с сывороточным альбумином, повышенную аффинность и/или связывание с интегрином тромбоцитов и/или повышенную аффинность и/или связывание с активированными тромбоцитами.
В некоторых примерах модификация может повлиять на два или более свойств или активностей полипептида FVII. Например, модификация может привести к увеличению устойчивости к АТ-III и увеличенной каталитической активности модифицированного полипептида FVII по сравнению с немодифици-рованным полипептидом FVII. Для определения спектра эффектов модификации могут быть определены свойства и активности модифицированных полипептидов FVII, предусмотренных в настоящем документе. Такие анализы известны и описаны ниже. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также включают полипептиды FVII, которые дополнительно модифицированы клеточными механизмами, и включают, например, гликозилированные, у-карбоксилированные и p-гидроксилированные полипептиды.
Модификации полипептида FVII, предусмотренные в настоящем документе, предназначены для увеличения устойчивости к АТ-III, увеличения устойчивости к TFPI, увеличения устойчивости к ингиби
торному действию Zn2+, предназначены для улучшения фармакокинетических свойств, таких как увеличение времени полураспада в сыворотке, увеличения каталитической активности в присутствии и/или в отсутствие ТФ, повышения связывания активированных тромбоцитов, изменения гликозилирования, увеличения аффинности и/или связывания с интегрином тромбоцитов aIIbp3, увеличения аффинности и/или связывания с сывороточным альбумином и/или увеличения аффинности и/или связывания с активированными тромбоцитами. Например, полипептид FVII может включать модификацию (модификации), которая увеличивает каталитическую активность или связывание с тромбоцитами или оба указанных свойства. В других примерах любые модификации, предусмотренные в настоящем документе, могут быть комбинированы с любой другой модификацией, известной специалисту в данной области, если полученный модифицированный полипептид FVII проявляет увеличенную коагулянтную активность, когда присутствует в двухцепочечной форме. Как правило, такая повышенная коагулянтная активность связана с повышенной устойчивостью к АТ-III, увеличенной каталитической активностью, повышенной устойчивостью к ингибиторному эффекту Zn2+, улучшенными фармакокинетическими свойствами, такими как увеличенное время полураспада в сыворотке, повышенной устойчивостью к TFPI, измененным гликози-лированием, увеличенным связыванием и/или аффинностью к фосфолипидам, увеличенным связыванием и/или аффинностью к сывороточному альбумину и/или увеличенным связыванием и/или аффинностью к интегрину тромбоцитов aIIbp3.
В некоторых примерах модификации, которые были введены в полипептид FVII для изменения конкретной активности или свойства также могут влиять на другую активность или свойство или вместо конкретной активности или свойства влиять только на другую активность или свойство. Таким образом, предусмотренные в настоящем документе модификации могут влиять на свойства или активности, на которые модификации были направлены, и на одно или более других свойств или активностей. Например, модификации, введенные в полипептид FVII для увеличения каталитической активности, также могут увеличить устойчивость к АТ-III. В некоторых примерах одна модификация, такая как замена одной аминокислоты, изменяет 2, 3, 4 или более свойств или активностей полипептида FVII. Для определения спектра эффектов модификации может быть проанализировано каждое свойство и активность модифицированного полипептида FVII, предусмотренного в настоящем документе. Такие анализы известны и описаны ниже. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также включают полипептиды FVII, которые дополнительно модифицированы клеточными механизмами, и включают, например, гликозилированные, у-карбоксилированные и p-гидроксилированные полипептиды.
Предусмотренные в настоящем документе модификации могут быть введены с использованием стандартных методов рекомбинантной ДНК, хорошо известных специалистам в данной области. Может быть использован любой известный в уровне техники способ мутирования одной или нескольких аминокислот в целевом белке. Способы включают стандартный сайт-направленный мутагенез (с использованием, например, набора, такого как набор QuikChange от Stratagene) кодирующей молекулы нуклеиновой кислоты или метод твердофазного синтеза полипептидов. Кроме того, модифицированные химерные белки, предусмотренные в настоящем документе (т.е. белки с заменой домена Gla), могут быть получены обычными методами рекомбинантной ДНК. Например, химерные полипептиды могут быть получены с помощью ферментов рестрикции и методик клонирования для рутинного субклонирования желаемых компонентов химерного полипептида.
Другие модификации, которые представляют собой модификации первичной последовательности полипептида или не представляют собой модификации первичной последовательности, также могут быть введены в модифицированный полипептид FVII или его конъюгат, включая, но не ограничиваясь, добавлением углеводного фрагмента, добавлением фрагмента полиэтиленгликоля (ПЭГ), добавлением домена Fc и т.д. Например, такие дополнительные модификации могут быть введены для повышения стабильности или времени полураспада белка.
Полученные модифицированные полипептиды FVII включают полипептиды, которые являются од-ноцепочечными зимогенами, или полипептиды, которые являются двухцепочечными зимогеноподобны-ми полипептидами. Например, любые модифицированные полипептиды, предусмотренные в настоящем документе, которые представляют собой одноцепочечные полипептиды, могут быть автоактивированы или активированы другими факторами свертывания крови с образованием модифицированных FVII в двухцепочечной форме (т.е. FVIIa). Модифицированные полипептиды FVII, как правило, проявляют активность в двухцепочечной форме.
Предусмотренные в настоящем документе модифицированные полипептиды FVII могут проявлять повышенную устойчивость к антитромбину III (AT-III), увеличенную каталитическую активность в присутствии и/или в отсутствие ТФ, повышенную устойчивость к ингибиторному эффекту Zn2+, повышенную устойчивость к ингибитору пути тканевого фактора (TFPI), улучшенные фармакокинетические свойства, такие как увеличенное время полураспада в сыворотке, могут обладать измененным гликози-лированием, проявлять повышенную аффинность и/или связывание с фосфолипидами, повышенную аффинность и/или связывание с сывороточным альбумином, повышенную аффинность и/или связывание с интегрином тромбоцитов aIIbp3. Как правило, предусмотренные здесь модифицированные полипептиды
FVII проявляют такие свойства и/или активности при сохранении других видов активности или свойств FVII, включая, но не ограничиваясь, связывание ТФ и/или связывание и активацию FX. Следовательно, модифицированные полипептиды FVII, предусмотренные в настоящем документе, сохраняют способность связывать ТФ и/или связывать и активировать FX по сравнению с начальным полипептидом FVII или полипептидом FVII дикого типа. Как правило, такая активность остается в значительной степени неизменной (измененной менее чем на 1, 5 или 10%) по сравнению с исходным белком или белком дикого типа. В других примерах активность модифицированного полипептида FVII увеличивается или уменьшается по сравнению с полипептидом FVII дикого типа или исходным полипептидом FVII. Активность может быть оценена in vitro или in vivo и может быть сравнена с активностью немодифицирован-ного полипептида FVII, такого как, например, зрелый нативный полипептид FVII дикого типа (SEQ ID NO: 3), предшественник полипептида FVII дикого типа (SEQ ID NO: 1 или 2) или любой другой полипептид FVII, известный специалисту в данной области, который использовался в качестве исходного полипептида.
Следовательно, в силу предусмотренных в настоящем документе модификаций, модифицированные полипептиды FVII могут обладать повышенной коагулянтной активностью, увеличенной продолжительностью коагулянтной активности и/или повышенным терапевтическим индексом. Указанные изменения можно наблюдать ТФ-зависимо и/или ТФ-независимо. Как правило, повышенную коагулянтную активность, увеличенную продолжительность коагулянтной активности и/или повышенный терапевтический индекс модифицированных полипептидов FVII, предусмотренных в настоящем документе, можно наблюдать in vitro или ex vivo с помощью соответствующих анализов или можно наблюдать in vivo, например, при введении субъекту, например человеку или не человеку. Активность модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500% или более по сравнению с активностью исходного или немодифицированного полипептида FVIIa.
1. Увеличение каталитической активности.
FVII содержит остаток серина (положение 195 по стандартной нумерации химотрипсина (химот-рипсиногена)) в активном центре, который действует как нуклеофил в реакции расщепления. Каталитическая триада сериновых протеаз также включает в себя два дополнительных остатка: Н57 и D102 (по нумерации химотрипсина). Каталитическая триада человеческого FVIIa соответствует положениям H193, D242 и S344 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. Каждая из трех указанных ключевых аминокислот играет существенную роль в каталитической активности протеа-зы. Сериновые протеазы гидролизуют пептидные связи через образование тетраэдрического переходного состояния и ацил-ферментного интермедиата. Реакция начинается с нековалентного связывания субстрата в углублении на поверхности протеазы (т.е. в активном центре), которое содержит Н57 и S195, с образованием "комплекса Михаэлиса-Ментен". Прохождение реакции требует последующей нуклеофильной атаки Р1 карбонильного остатка субстрата О-гамма атомом серина активного центра (т.е. серином 195) фермента с образованием тетраэдрического переходного состояния, которое быстро превращается в ацил-ферментный интермедиат. Структура в активном центре, которая включает остатки глицина 193 и серина 195 (соответствующие G342 и S344 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), известная как оксианионная впадина, способствует эффективному катализу за счет стабилизации переходного состояния. В частности, амидные атомы водорода основной цепи этих двух остатков формируют стабилизирующие водородные связи с оксианионом (т.е. карбонильным кислородом остатка Р1), который образуется в тетраэдрическом переходном состоянии. В дополнение к стабилизации связывание субстрата в оксианионной впадине располагает расщепляющуюся связь должным образом для продуктивного ацилирования и деацилирования, которые приводят к разрыву связи. Важность ок-сианионной впадины в активности FVII подтверждается тем наблюдением, что мутации в аминокислотной позиции 342 (соответствующей позиции 193 по нумерации химотрипсина) могут привести к дефектному FVII (см., например, Bernardi и др., (1994) Br. J. Haematol . 86:610-618 и Bernardi и др., (1996) Human Mut. 8:108-115).
а. Примеры модификаций, увеличивающих каталитическую активность.
В настоящем документе предусмотрены модифицированные полипептиды FVII, которые обладают повышенной коагулянтной активностью. Такие полипептиды FVII могут быть получены за счет аминокислотной замены одного или нескольких остатков, где замена может повлиять на конформацию оксиа-нионной впадины. Внедрение различных аминокислотных остатков в конкретные положения (например, в положение 143 по нумерации химотрипсина или 286 по нумерации зрелого FVII) может изменить кон-формацию модифицированного полипептида FVII, что приведет к увеличению эффективности катализа оксианионной впадиной. Это может привести к модифицированным полипептидам FVII с повышенной каталитической активностью по сравнению с немодифицированным полипептидом FVII. Изменения в каталитической активности из-за мутации, влияющей на оксианионную впадину, могут проявляться как увеличение коагулянтной активности. Увеличение каталитической и коагулянтной активности модифицированных полипептидов FVII, предусмотренных в настоящем документе, можно наблюдать в присутствии и/или в отсутствие тканевого фактора (т.е. увеличение активности может быть ТФ-зависимым
и/или ТФ-независимым). Таким образом, при оценке в соответствующем in vitro, in vivo, или ex vivo анализе, таком как введение полипептида субъекту в качестве прокоагулянтной терапии, модифицированные полипептиды FVII могут проявлять увеличенную коагулянтную активность по сравнению с немоди-фицированным полипептидом FVII.
Конформация оксианионной впадины может быть изменена для образования более эффективной конформации путем модификации одного или более аминокислотных остатков, которые участвуют в образовании оксианионной впадины или находятся в непосредственной близости от оксианионной впадины. Как предусмотрено в настоящем документе, примером такого аминокислотного остатка является остаток Q286 (нумерация соответствует последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), который соответствует остатку Q143 по нумерации химотрипсина. Q286 может быть изменен, например, путем аминокислотной замены, удаления или вставки. Если модификация представляет собой аминокислотную замену, остаток глутамина в положении 286 может быть заменен на остаток любой другой аминокислоты.
Q286 находится рядом и контактирует с остатками, которые формируют районы активного центра и расщелины активного центра полипептида FVII. Таким образом, было предположено, что модификации в этом положении должны привести к снижению каталитической активности (см., например, патент США № 6806063). Это было продемонстрировано в предыдущих исследованиях (см., например, WO 2007031559), где глутаминовый остаток заменен на остаток аланина (Q286A). Полученный модифицированный полипептид FVIIa проявлял сниженную способностью к активации фактора X по сравнению с полипептидом дикого типа. В других исследованиях та же мутация практически не влияла на каталитическую активность мутанта FVIIa по отношению к фактору X (Dickinson и др., (1996) Proc. Nat. Acad. Sci. USA 93: 14379-14384) или по отношению к синтетическому субстрату (WO 2007031559).
Однако как показано здесь (см. пример 4 ниже), модификация полипептида FVII в положении 286 (нумерация соответствует последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3; соответствует положению 143 по нумерации химотрипсина), в частности замена на основный остаток, такой как аргинин (Arg, R), приводит к модифицированному полипептиду FVII с повышенной каталитической и коагулянтной активностью.
Таким образом, в настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие модификации, такие как замена аминокислоты основной аминокислотой в положении, соответствующем положению 286 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3 (положение 143 по нумерации химотрипсина). Предусмотренные в настоящем документе модификации в положении 286 могут быть введены в любой полипептид FVII, в том числе полипептид-предшественник FVII, приведенный в SEQ ID NO: 1 или 2, в зрелый полипептид FVII, приведенный в SEQ ID NO: 3, или могут быть введены в любой видовой, аллельный или модифицированный вариант и их активный фрагмент, который обладает 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% идентичностью последовательности с любым из полипептидов FVII, приведенных в SEQ ID NO: 1-3.
Модификация полипептида FVII в положении 286 по нумерации зрелого FVII (соответствует положению 143 по нумерации химотрипсина) может изменить конформацию оксианионной впадины таким образом, что измененная конформация способствует более эффективному катализу превращения субстрата. Увеличение каталитической активности таких модифицированных полипептидов FVII может проявляться в присутствии и/или в отсутствие тканевого фактора и может быть оценено с использованием in vitro тестов, как описано в примерах 4 и 7 ниже. В дополнение к проявлению увеличенной каталитической активности полипептиды FVII, которые были модифицированы в положении 286 по нумерации зрелого FVII, также могут обладать повышенной устойчивостью к АТ-III. Это может быть связано, например, с уменьшением связывания модифицированного полипептида FVII с АТ-III при определенных условиях (например, после инъекции пациенту) или с пониженной скоростью инактивации АТ-III (т.е. уменьшенной константой скорости второго порядка для ингибирования), что может проявляться как увеличение коагулянтной активности в присутствии АТ-III по сравнению с немодифицированным полипептидом FVII. Повышенная устойчивость к АТ-III может быть оценена с использованием in vitro тестов, как описано в примере 5.
Аминокислотный остаток Q286 по нумерации зрелого FVII (соответствующий остатку Q143 по нумерации химотрипсина) может быть модифицирован удалением, заменой или замещением аминокислоты любой другой аминокислотой. Альтернативно, аминокислота может быть вставлена непосредственно перед аминокислотным остатком Q286 или после остатка, изменяя конформацию в непосредственной близости от аминокислотного остатка Q286. Кроме того, полипептид FVII с модификацией Q286 также может содержать одну или несколько других модификаций, в том числе вставки, удаления, замены или замещения аминокислот, полипептид также может содержать модификации, не затрагивающие первичную последовательность полипептида, такие как добавление углеводного фрагмента, добавление фрагмента полиэтиленгликоля (ПЭГ), добавление домена Fc и т.д. или любую их комбинацию. Таким образом, полипептид FVII, содержащий модификацию в положении 286 по нумерации зрелого FVII, может содержать 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 или более модифицированных положений. Такие полипептиды сохраняют по меньшей мере один вид активности немодифициро
ванного полипептида FVII. Как правило, модифицированный полипептид FVII проявляет увеличенную коагулянтную активность.
Указанные изменения в активности могут проявляться как увеличение коагулянтной активности, увеличение продолжительности коагулянтной активности, ускорение наступления терапевтического эффекта, ускорение наступления коагулянтной активности и/или повышение терапевтического индекса. Таким образом, в настоящем документе предусмотрены модифицированные полипептиды FVII, включающие модификацию в положении 286 по нумерации зрелого FVII, которые обладают повышенной коа-гулянтной активностью по сравнению с немодифицированным полипептидом FVII. Такие модифицированные полипептиды FVII могут быть использованы для лечения нарушений свертываемости крови, таких как гемофилии, или при операциях, травмах, повреждениях, где полипептиды FVII помогут содействию свертыванию крови. Из-за повышенной коагулянтной активности модифицированные полипептиды FVII, предусмотренные в настоящем документе, содержащие модификацию в положении 286 по нумерации зрелого FVII, обладают преимуществами при лечении перед полипептидом FVII дикого типа, таким как фактор VII Novoseven(r), включая уменьшение количества вводимого FVII, которое требуется для поддержания достаточной для гемостаза концентрации активного FVII в сыворотке крови. Это может привести, например, к более низким дозам и/или частоте введения, необходимым для достижения сопоставимого биологического эффекта, может привести к быстрому наступлению терапевтического эффекта, более длительному действию, повышенной комфортности лечения и одобрению лечения субъектами и/или к ослаблению нежелательных побочных эффектов.
I. Основные аминокислотные замены в положении 286.
В настоящем документе предусмотрены модифицированные полипептиды FVII, в которых глута-мин в положении 286 (нумерация соответствует последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3; соответствует положению 143 по нумерации химотрипсина) заменен остатком основной аминокислоты, такой как любая аминокислота, выбранная из аргинина (Arg, R), гистидина (His, H) или лизина (Lys, K). В частности, в настоящем документе предусмотрены модифицированные полипептиды FVII, в которых глутамин в положении 286 заменен на аргинин (т.е. произошла замена Q286R, соответствующая замене Q143R по нумерации химотрипсина). Моделирование показывает, что замена глутамина на аргинин приводит к потере двух ключевых взаимодействий, которые стабилизируют неактивную конформацию оксианионной впадины в FVIIa дикого типа или в немодифицированном FVII. Дестабилизирующие взаимодействия в FVII дикого типа или немодифицированном FVII включают взаимодействие между боковой цепью остатка Q286 (соответствующего Q143 по нумерации химотрип-сина) и амидной группой G342 основной цепи (соответствующего G193 по нумерации химотрипсина), и взаимодействие между карбонильной группой главной цепи K341 (соответствующего K1 по нумерации химотрипсина) и амидной группой главной цепи S195 (соответствующего S344 по нумерации химотрип-сина). Замена глутамина в белке дикого типа на аргинин в положении 286, однако, не только нарушает указанные взаимодействия, но и создает два новых важных взаимодействия. Они включают создание солевого моста между основной боковой цепью модифицированной аминокислоты R286 (R143 по нумерации химотрипсина) и кислой боковой цепью нативного остатка D289 (D146 по нумерации химотрип-сина), и взаимодействие амидной группы основной цепи модифицированной аминокислоты R286 и карбонильной группы основной цепи K341, которые стабилизируют активную конформацию модифицированного полипептида FVIIa. Кроме того, новый солевой мост между модифицированной аминокислотой R286 и D289, как ожидается, изменяет конформацию и/или гибкость "петли автолиза", которая является частью расщелины активного центра. Петля автолиза вовлечена в распознавание высокомолекулярного субстрата и ингибиторную специфичность протеаз свертывания. Таким образом, изменение конформа-ции и/или гибкости этой петли может привести, например, к увеличению каталитической активности по отношению к субстрату (например, фактору X и/или фактору IX) и повышению устойчивости к ингибиторам (например TFPI и/или АТ-III). Таким образом, замена глутамина в положении 286 на основную аминокислоту, такую как аргинин (Arg, R), гистидин (His, H) или лизин (Lys, K), может привести к увеличению каталитической и коагулянтной активности по сравнению с полипептидом FVII дикого типа. Таким образом, предусмотренные здесь полипептиды FVII содержат мутации Q286R, Q286K или Q286H по нумерации зрелого FVII (соответствующие мутациям Q143R, Q143K или Q143H, соответственно, по нумерации химотрипсина). Примеры таких полипептидов представляют собой полипептиды с последовательностями аминокислот, приведенными в SEQ ID NO: 118, 119 и 129 соответственно.
Аминокислотная замена глутамина (Gin, Q) на основный аминокислотный остаток, в частности аргинин (Arg, R), в положении 286 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, может быть введена в любой полипептид FVII, в том числе полипептид-предшественник FVII с последовательностью, приведенной в SEQ ID NO: 1 или 2, введена в зрелый полипептид FVII, приведенный в SEQ ID NO: 3, или в любой видовой, аллельный и модифицированный вариант, такой как описано в уровне техники, и в их активные фрагменты, которые обладают 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% идентичностью последовательности с любым из полипептидов FVII, приведенных в SEQ ID NO: 1-3. Например, мутация Q286R может быть введена в любой модифицированный полипептид FVII, описанный в уровне техники, включая любые полипептиды, описанные в настоящем докумен
те. Такие модифицированные полипептиды FVII включают, но не ограничиваются, модифицированные полипептиды FVII, содержащие мутацию (мутации) M298Q (SEQ ID NO: 158), см., например, Persson и др., (2001) Proc. Nat. Acad. Sci. USA 98:13583-13588), E296V/M298Q (SEQ ID NO: 343), V158E (SEQ ID NO: 344), E296R/M298K (SEQ ID NO: 345), K337A (SEQ ID NO: 346), V158D/E296V/M298Q (SEQ ID NO: 98; NN1 731; см., например, Persson и др., (2007) Art. Thromb. Vase. Biol. 27 (3): 683-689), V158D/E296V/M298Q/K337A (SEQ ID NO: 347, см., например, Lisman и др., (2003) J. Thromb. Haem. 1:
2175-2178), V253N (SEQ ID NO: 348, см., например, US 7427592), T106N (SEQ ID NO: 349; см., например, US 7427592), T106N/V253N (SEQ ID NO: 350; см., например, US 7427592), K143N/N145T (SEQ ID NO: 351; US 7442524), R315N/V317T (SEQ ID NO: 352; US 7442524) или
K143N/N145T/R315N/V317T (SEQ ID NO: 353; US 7442524).
Мутация Q286R также может быть введена в химерные полипептиды FVII, или гибридные полипептиды FVII, или в полипептиды FVII, которые были модифицированы иным образом, например путем гликопегилирования (см., например, WO 2007022512; Ghosh и др., (2007), текст презентации на Am. Society. Hematol. Meeting 10 декабря 2007 г.). В одном примере аминокислотная замена глутамина на аргинин в положении, соответствующем положению 286 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, приводит к полипептиду FVII с аминокислотной последовательностью, приведенной в SEQ ID NO: 118.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие аминокислотную замену Q286R по нумерации зрелого FVII (соответствующую Q143R по нумерации химот-рипсина), где модифицированные полипептиды FVII обладают повышенной коагулянтной активностью. Такие модифицированные полипептиды FVII могут содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 или более модифицированных положений, в которых одно из модифицированных положений представляет собой положение 286. Таким образом, в настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие две или более модификаций, при этом одна модификация представляет собой аминокислотную замену Q286R (по нумерации зрелого FVII) и модифицированный полипептид FVII проявляет увеличенную коагулянтную активность по сравнению с немодифицированным полипептидом FVII. Мутацию Q286R можно комбинировать с любыми другими мутациями, описанными в настоящем документе или известными в уровне техники. Как правило, полученный модифицированный полипептид проявляет увеличенную коагулянтную активность. Специалист в уровне техники может определить коагулянтную активность полипептида FVII, содержащего модификацию Q286R, с использованием in vitro и in vivo анализов, известных в уровне техники и описанных здесь. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, включают полипептиды, которые содержат мутацию Q286R, а также одну или несколько мутаций, которые, например, повышают устойчивость к антитромбину-III, повышают способность активировать FX, повышают способность активировать FIX, увеличивают связывание и/или аффинность к фосфолипидам, увеличивают аффинность к тканевому фактору, увеличивают собственную активность, увеличивают ТФ-зависимую активность, изменяют конформацию полипептида для изменения зимогенности, увеличивают каталитическую или коагулянтную активность, например, сдвигая равновесие между высокоактивной и менее активной конформацией FVIIa в пользу высокоактивной конформации, повышают устойчивость к протеазам, уменьшают гликозилирование, увеличивают гликозилирование, уменьшают иммуногенность, повышают стабильность и/или содействуют химическому связыванию групп.
Увеличенная коагулянтная активность модифицированных полипептидов FVII, содержащих аминокислотную замену Q286R, может быть результатом увеличенной каталитической активности. Увеличенную каталитическую активность можно наблюдать в присутствии и/или в отсутствие тканевого фактора (ТФ). Таким образом, увеличенная каталитическая активность может быть ТФ-зависимой и/или ТФ-независимой. Каталитическая активность модифицированного полипептида FVII, содержащего мутацию Q286R, может быть оценена с использованием in vitro тестов, таких как тесты, описанные в примерах 4 и 7. С помощью таких анализов можно определить каталитическую активность модифицированных полипептидов FVII по отношению к субстрату, такому как фактор X, в присутствии или в отсутствие тканевого фактора. Модифицированные полипептиды FVII, содержащие мутацию Q286R, могут обладать каталитической активностью, повышенной приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более в присутствии и/или в отсутствие тканевого фактора по сравнению с каталитической активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Например, как показано в примере 4, полипептид FVIIa с мутацией Q286R (Q143R по нумерации химотрипсина) в качестве единственной модификации может обладать каталитической активностью по отношению к FX в присутствии или в отсутствие ТФ, которая приблизительно в два-четыре раза больше, чем каталитическая активность FVII дикого типа. В других примерах полипептид FVIIa с мутациями Q286R и M298Q может обладать каталитической активностью по отношению к FX в присутствии ТФ, которая приблизительно в три-четыре раза больше, чем каталитическая активность FVII дикого типа, и может обладать каталитической активностью по отношению к FX в отсутствие ТФ, которая приблизительно в семь-двадцать шесть раз больше, чем каталитическая активность FVII дикого типа.
Неограничивающие примеры модифицированных полипептидов FVII, содержащих две или более модификации, где одна модификация представляет собой замещение аминокислоты Q286R (по нумерации зрелого FVII), а модифицированный полипептид FVII проявляет увеличенную каталитическую активность по отношению к FX в присутствии и/или в отсутствие тканевого фактора по сравнению с немодифицированным полипептидом FVII, приведены в табл. 5 и в примере 4 ниже.
В настоящем документе приведен идентификатор последовательностей (SEQ ID NO), в рамках которого приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII. Как описано более подробно в разделе D.6 ниже, модификация "замена Gla из FIX" включает удаление эндогенного домена Gla белка FVII, т.е. удаление аминокислотных остатков с A1 по Y44 (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), и вставку 45 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y45 домена Gla белка FIX, приведенным в SEQ ID NO: 83. В некоторых примерах гетерологичный домен Gla FIX в модифицированных "заменой Gla из FIX" полипептидах FVII содержит одну или несколько аминокислотных замен в положениях, соответствующих М9, Е40, K43 и/или Q44 в последовательности домена Gla белка FIX, приведенной в SEQ ID NO: 83. Такие замены обозначаются фигурными скобками (например, {замена Gla из FIX/Q44S}). В случаях, когда модифицированные аминокислотные позиции не имеют соответствующего номера по химотрипсину (т.е. если позиция не относится к аминокислотным позициям с 153 до 406 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, и не указана в табл. 1 выше), позиция обозначается в скобках с использованием нумерации зрелого FVII. Например, T158N не имеет соответствующего номера по химотрипсину и приводится в виде T[158]N, когда речь идет о нумерации химотрипсина.
Таблица 5
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
Замена Gla из FIX/Q286R
Замена Gla из FIX/Q143R
131
Q286R/H257A
H117A/Q143R
132
S222A/Q286R
S82A/Q143R
133
Q286R/S222A/H257A
S82A/H117A/Q143R
134
Замена Gla из FIX /S222A/Q286R
S82A/3aMeHa Gla из FIX/Q143R
135
Замена Gla из FIX/H257A/Q286R
HI 17А/Замена Gla из FIX/Q143R
136
Замена Gla из FIX /S222A/H257A/Q286R
Q143R/S82A/H117А/Замена Gla из FIX
137
Q286R/M298Q
Q143R/M156Q
138
Q286R/M298Q/K341Q
Q143R/M156Q/K192Q
139
Q286R/M298Q/K199E
Q143R/M156Q/K60cE
140
S222A/H257A/Q286R/M298Q
S82A/H117A/Q143R/M156Q
150
A175S/Q286R/Q366V
A39S/Q143R/Q217V
144
S222A/Q286R/Q366V
S82A/Q143R/Q217V
145
H257S/Q286R
H117S/Q143R
146
H257S/Q286R/Q366V
H117S/Q143R/Q217V
147
S222A/H257A/Q286R/Q366V
S82A/H117A/Q143R/Q217V
148
Q286R/H373A
Q143R/H224A
149
Q286R/K341D
Q143R/K192D
151
Q286R/Q366D
Q143R/Q217D
152
Q286R/Q366N
Q143R/Q217N
153
Q286R/M298Q/Q366N
Q143R/M156Q/Q217N
155
Q286R/H373F
Q143R/H224F
156
Q286R/M298Q/H373F
Q143R/M156Q/H224F
157
Q286R/M298Q
Q143R/M156Q
138
T128N/P129A/Q286R
T[128]N/P[129]A/Q143R
279
Замена Gla из FIX/T128N/P129A/ S222A/Q286R
Замена Gla из FIX/ T[128]N/P[129]A/ S82A/Q143R
285
Замена Gla из FIX/ S52A/S60A/S222A/Q286R
Замена Gla из FIX/ S[52]A/S[60]A/S82A/Q143R
292
Замена Gla из FIX/ Q286R/M298Q
Замена Gla из FIX/ Q143R/M156Q
141
T128N/P129A/Q286R/ M298Q
T[128]N/P[129]A/Q143R/ M156Q
280
Замена Gla из
FIX/T128N/P129A/Q286R/M298Q
Замена Gla из
FIX/T[128]N/P[129]A/Q143R/ M156Q
286
{Замена Gla из FIX/E40L}/ Q286R/M298Q
{Замена Gla из FLX/E[40]L}/ Q143R/M156Q
274
{Замена Gla из FIX/K43I}/ Q286R/M298Q
{Замена Gla из FIX/K[43]I}/ Q143R/M156Q
275
{Замена Gla из FIX/Q44S}/ Q286R/M298Q
{Замена Gla из FIX/Q[44]S}/ Q143R/M156Q
276
{Замена Gla из FIX/MI9К}/ Q286R/M298Q
{Замена Gla из FIX/M[19]K}/ Q143R/M156Q
277
S52A/S60A/Q286R/M298Q
S [52] A/S[60] A/Q143R/M156Q
293
T128N/P129A/S222A/H257A/Q286R/ M298Q
T[128]N/P[129]A/S82A/H117A/Q143R /M156Q
287
S52A/S60A/S222A/H257A/Q286R/ M298Q
S[52]A/S[60]A/S82A/H117A/Q143R /M156Q
298
T128N/P129A/ Q286R/H373F
T[128]N/P[129]A/Q143R/H224F
281
S52A/S60A/ Q286R/H373F
S[52]A/S[60]A/Q143R/H224F
296
T128N/P129A/Q286R/M298Q/H373F
T[128]N/P[129]A/Q143R/M156Q/ H224F
288
S52A/S60A/Q286R/M298Q/H373F
S [52] A/S [60] A/Q 143R/M156Q/H224F
297
V21D/Q143 R/E154 V/M156Q
V21 D/Q 143 R/E 154 V/M 156Q
282
Замена Gla из FIX /S222A/T239V/Q286R
Замена Gla из FIX /S82A/T99V/ Q143R
301
T239V/Q286R/M298Q
T99V/Q143R/M156Q
302
Замена Gla из FIX/ T239V/Q286R/M298Q
Замена Gla из FIX/ T99V/Q143R/ M156Q
304
S222A/T239V/H257A/Q286R/M298Q
S82A/T99V/H117A/Q143R/M156Q
303
T239V/Q286R/H373F
T99V/Q143R/H224F
305
T239V/Q286R/M298Q/H373F
T99 V/Q143R/M15 6Q/H224F
306
T239I/Q286R
T99I/Q143R
308
GlaSwapFIX/S222A/T239I/Q286R
Замена Gla из FIX /S82A/T99I/Q143R
310
T239I/Q286R/M298Q
T99I/Q143R/M156Q
311
Замена Gla из FIX /T239I/Q286R/M298Q
Замена Gla из FIX /T99I/Q143R/ M156Q
313
S222A/T239I/H257A/Q286R/M298Q
S82A/T99I/H117A/Q143R/M156Q
312
T239I/Q286R/H373F
T99I/Q143R/H224F
314
T239V/Q286R
T99V/Q143R
299
T239I/Q286R/M298Q/ H373F
T99I/Q143RM156Q/H224F
315
H257S/Q286R/M298Q
H117S/Q143R/M156Q
322
Замена Gla из FIX /Q286R/S222A/H257S
Замена Gla из FIX /Q143R/S82A/ H117S
321
S222A/H257S/Q286R/ M298Q
S82A/H117S/Q143R/M156Q
324
H257S/Q286R/M298Q/ H373F
H117S/Q143R/M15 6Q/H224F
325
S222A/Q286R/M298Q/ H373F
S82A/Q143R/M156Q/H224F
326
Замена Gla из FIX/S222A/Q286R/M298Q/ H373F
Замена Gla из FIX
S82A/Q143R/M156Q/H224F
318
S222A/Q286R/M298Q
S82A/Q143R/M156Q
328
Замена Gla из FIX/S222A/Q286R/M298Q
Замена Gla из FIX S82A/Q143R/M156Q
317
Замена Gla из FIX/ S222A/Q286R/H373F
Замена Gla из FIX/ S82A/Q143R/H224F
316
H257A/Q286R/M298Q
H117A/Q143R/M156Q
321
T128N/P129A/A175S/Q286R/M298Q
T[128]N/P[129]A/A39S/Q143R/M15 6Q
337
A122N/G124S/A175 S/Q286R/M298Q
A[122]N/G[124]S/A39S/Q143R/M15 6Q
338
T128N/P129A/A175S/S222A/H257A/ Q286R/ M298Q
T[128]N/P[129]A/A39S/S82A/H117 A/Q143R/M156Q
339
A122N/G124S/A175 S/S222A/H25 7A/Q28 6RJ M298Q
A[122]N/G[124]S/A39S/S82A/H117 A/Q143R/M156Q
340
T128N/P129A/A175S/Q286R/M298Q/H37 3F
T[128]N/P[129]A/A39S/Q143R/M15 6Q/H224F
341
A122N/G124S/A175 S/Q286R/M298Q/H3 7 3F
A[ 122]N/G[ 124] S/A39S/Q143R/M1 56Q/H224F
342
V158D/Q286R/E296V/M298Q/H373F
V21 D/Q 143R/E154V/M15 6Q/H224F
320
{Замена Gla из FIX /K43I}/T128N/P129A/Q286R/M298Q
{Замена Gla из FIX /K[43]I}/ T[128]N/P[129]A/Q143R/M156Q
355
Tl 28N/P129A/Q286R/M298Q/Q366N
T[128]N/P[129]A/Q143R/M156Q/ Q217N
356
{Замена Gla из FIX /K43I}/Q286R/M298Q/Q366N
{Замена Gla из FIX /K[43]I}/Q143R/M156QQ217N
357
{Замена Gla из FIX /К431}/ T128N/P129A/Q286R/M298Q/Q366N
{Замена Gla из FIX /K[43]I}/
T[128]N/P[129]A/Q143R/M156QQ2
17N
358
VI58D/Q286R/E296V/M298Q
V21D/Q143R/E154V/M156Q
360
T128N/P129A/Q286R/M298Q/Q366N/H3 73F
T[128]N/P[129]A/Q143R/M156Q/Q 217N/H224F
364
T239V/Q286R/M298Q/Q366N
T99 V/Q 143R/M15 6Q/Q217N
365
T239I/Q286R/M298Q/Q366N
T99I/Q143R/M156Q/Q217N
366
T128N/P129A/T239V/Q286R/M298Q
T[128]N/P[129]A/T99V/Q143R/M1 56Q
367
T128N/P129A/S222A/T239V/H257A/Q28 6R/M298Q
T[128]N/P[129]A/S82A/T99V/H117 A/Q143R/M156Q
368
Tl 28N/P129A/T239V/Q286R/M298Q/H37 3F
T[128]N/P[129]A/T99V/Q143R/M1 56Q/H224F
369
T128N/P129A/T239I/Q286R/M298Q
T[128]N/P[129]A/T99I/Q143R/M15 6Q
370
T128N/P129A/T239I/Q286R/M298Q/H37 3F
T[128]N/P[129]A/T99I/Q143R/M15 6Q/H224F
371
Полипептид FVII, содержащий мутацию Q286R по нумерации зрелого FVII, также может обладать повышенной устойчивостью к АТ-III. Повышенная устойчивость к АТ-III может быть результатом уменьшенной скорости ингибирования АТ-III или уменьшенным связыванием с АТ-III при определенных условиях, например после инъекции животному или пациенту. Устойчивость к АТ-III может быть продемонстрирована путем измерения константы скорости ингибирования второго порядка полипептида FVIIa дикого типа и варианта полипептида FVIIa. Другие in vitro методы, такие как анализы с помощью BIAcore(r), также могут быть использованы. Модифицированные полипептиды FVII могут обладать повышенной устойчивостью к ингибиторному действию АТ-III по сравнению с немодифицированным полипептидом FVII, устойчивость может быть оценена in vitro с помощью таких анализов, как описано в примере 5.
Модифицированные полипептиды FVII, содержащие мутацию Q286R, могут обладать устойчивостью к АТ-III, повышенной приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с устойчивостью к АТ-III немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Например, как показано в примере 5 ниже, полипептид FVIIa, содержащий мутацию Q286R (Q143R по нумерации химотрипсина), может обладать каталитической активностью по отношению к FX в присутствии АТ-III и в отсутствие ТФ, которая повышена в два-четыре и более раз по сравнению с каталитической активности FVII дикого типа. Таким образом, модифицированный Q286R полипептид FVII может проявлять устойчивость к АТ-III, повышенную приблизительно на 200-400% по сравнению с устойчивостью немодифицированного полипептида FVII.
Увеличенная каталитическая активность и повышенная устойчивость к АТ-III могут проявляться как увеличенная коагулянтная активности в присутствии и/или в отсутствие ТФ. Такая активность может быть оценена in vitro, ex vivo или in vivo, например, при введении человеку или животному. Коагулянт-ная активность модифицированного полипептида FVII, содержащего мутацию Q286R, может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Например, в примере 6.В.2 показано, что полипептид FVIIa с мутацией Q286R (Q143R по нумерации химотрипсина) проявляет большую (примерно в 2 раза) коагулянтную активность в модели кровотечения на мыши, чем коагулянтная активность полипептида FVII дикого типа (например, FVII Novoseven(r)). Полипептид FVIIa, содержащий мутации Q286R и M298Q (Q143R и M156Q, соответственно, по нумерации химотрипсина) обладает еще большей коагулянтной активностью.
II. Другие мутации в положении 286.
Глутамин в положении, соответствующем положению 286 последовательности полипептида FVII, приведенной в SEQ ID NO: 3, может быть заменен другой аминокислотой, не относящейся к основным аминокислотам (т.е. отличной от аргинина, гистидина и лизина). Такие замены могут изменить конфор-мацию оксианионной впадины и, например, привести к конформации, которая увеличит каталитическую активность модифицированного полипептида FVII по сравнению с полипептидом FVII дикого типа. Модифицированные полипептиды FVII с измененной конформацией оксианионной впадины могут обладать каталитической активностью, повышенной приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с каталитической активностью немодифици-рованного полипептида FVII или полипептида FVII дикого типа, измеренной in vivo, ex vivo, или in vitro.
В табл. 6 представлены не ограничивающие примеры аминокислотных замен в положении Q286, кроме замены на аргинин, соответствующие аминокислотным позициям последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. Как уже отмечалось, такие полипептиды FVII обладают измененной конформацией оксианионной впадины на более эффективную конформацию и, следовательно, обладают увеличенной коагулянтной активностью. При описании таких мутаций первая аминокислота (однобуквенная аббревиатура) соответствует аминокислоте, которая заменяется, ее номер соответствует положению аминокислоты в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, а вторая аминокислота (однобуквенная аббревиатура) соответствует выбранной аминокислоте, которая заменяет первую аминокислоту в этом положении. Положения аминокислот для мутаций также обозначаются по нумерации химотрипсина. В табл. 6 ниже приведены номера по идентификатору после
довательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированного полипептида FVII.
Таблица 6
Модификации по нумерации
Модификации по нумерации
SEQ ID NO
зрелого FVII
химотрипсина
Q286N
Q143N
113
Q286E
Q143E
114
Q286D
Q143D
115
Q286S
Q143S
116
Q286T
Q143T
117
Q286A
Q143A
120
Q286V
Q143V
121
Q286M
Q143M
122
Q286L
Q143L
123
Q286Y
Q143Y
124
Q286G
Q143G
125
Q286F
Q143F
126
Q286I
Q143I
127
Q286P
Q143P
128
Q286W
Q143W
130
Модифицированные полипептиды FVII с измененной конформацией оксианионной впадины могут обладать каталитической активностью, повышенной приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с каталитической активностью немодифицированного полипептида FVII или полипептида FVII дикого типа, измеренной in vivo, ex vivo, или in vitro. В некоторых примерах модифицированные полипептиды FVII с измененной конформацией оксианионной впадины также могут обладать повышенной устойчивостью к эндогенным ингибиторам протеаз (т.е. сниженной скоростью ингибирования или уменьшенной аффинностью к ингибиторам), таким как TFPI или АТ-III, примерно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со скоростью ингибирования или аффинностью к эндогенным ингибиторам немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo, ex vivo, или in vitro. Увеличенная каталитическая активность и/или устойчивость к эндогенным ингибиторам, такая как устойчивость к АТ-III, модифицированного полипептида FVII также может проявляться как повышенная коагулянтная активность, повышенная продолжительность коагулянтной активности, ускоренное наступление коагулянтной активности и/или увеличенный терапевтический индекс. Например, коагу-лянтная активность модифицированного полипептида FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo, ex vivo, или in vitro.
2. Повышенная устойчивость к АТ-III.
Антитромбин III (также известный как антитромбин или АТ-III) является важным антикоагулянтом-серпином (ингибитор сериновой протеазы). АТ-III синтезируется в виде белка-предшественника, содержащего 464 аминокислотных остатка (SEQ ID NO: 122). В ходе секреции сигнальный пептид из 32 остатков отщепляется с образованием зрелого антитромбина человека из 432 аминокислот (SEQ ID NO: 123). Гликопротеин АТ-III с молекулярной массой 58 кДа циркулирует в крови и функционирует как ингибитор сериновых протеаз (серпин) и ингибирует большое число сериновых протеаз системы коагуляции. Основными мишенями АТ-III являются тромбин и фактор Ха, хотя было показано, что АТ-III также подавляет активность FIXa, FXIa, FXIIa и, в меньшей степени, FVIIa. Действие АТ-III значительно усиливается гликозаминогликанами, такими как природный гепаран сульфат или различные полученные из ткани гепарины, которые широко используются в качестве антикоагулянтов в клинической практике. АТ-III определенным образом связывает уникальную пентасахаридную последовательность в гепарине, что индуцирует конформационные изменения в петле реакционного центра. В такой конформации петля реакционного центра АТ-III может более эффективно взаимодействовать с реакционном центром сери-новых протеаз и приводить к ингибированию. АТ-III, как правило, не ингибирует свободный FVIIa плазмы даже в присутствии гепарина, вероятно, из-за зимогеноподобной конформации FVIIa, которая препятствует эффективному взаимодействию с АТ-III. Однако ингибирующее действие АТ-III увеличивается при образовании комплекса FVIIa с ТФ. Связывание АТ-III с комплексом ТФ/FVIIa может привести к отделению FVIIa от ТФ, при этом FVIIa остается в неактивном состоянии в комплексе с АТ-III. Повышенная аффинность АТ-III к связавшему ТФ белку FVIIa по сравнению со свободным FVIIa предположительно отражает созревание активного центра FVIIa при образовании комплекса с ТФ, что делает его восприимчивым к связыванию АТ-III (Rao и др., (1993) Blood 81: 2600-2607). Таким образом, влияние АТ-III на FVIIa пропорционально собственной активности молекулы FVIIa, если в полипептид FVIIa не
были введены мутации, опосредующие устойчивость к АТ-III. Если FVIIa сохраняет свою зимогенопо-добную конформацию, АТ-III не оказывает на него большого эффекта. Если, однако, FVIIa изменяет конформацию на более активную, например, путем связывания ТФ или за счет специфичных изменений in vitro, ингибирование АТ-III значительно увеличивается. FVIIa полипептиды, которые были модифицированы для увеличения собственной активности, часто демонстрируют одновременное увеличение восприимчивости к ингибированию АТ-III. Например, модификация одной или нескольких аминокислот в активационном кармане FVIIa, например, путем аминокислотных замен Ю37А, L305V, M298Q, V158D и E296V (по последовательности зрелого FVII, приведенной в SEQ ID NO: 3), приводит к увеличению чувствительности полипептида FVIIa к АТ-III, тем самым подавляя активность FVIIa на 90% (Persson и др., (2001) PNAS 98:13583-13588). В другом примере индукция более зимогеноподобной конформации модификацией аминокислот в а-спирали FVIIa при повышении активности модифицированного белка FVIIa также увеличивает его восприимчивость к АТ-III (Persson и др., ( 2004) Biochem. J. 379:497-503). Примеры модификаций для повышения устойчивости к АТ-III.
В полипептид FVII могут быть введены модификации, которые увеличивают его устойчивость к АТ-III. Как правило, такие модифицированные полипептиды FVII сохраняют по меньшей мере одну активность полипептида FVII. Как правило, такие модификации включают одну или несколько аминокислотных замен в любом положении полипептида FVII, которые участвуют во взаимодействии FVIIa с АТ-III. Такие модификации могут, например, привести к снижению связывания модифицированного FVII с АТ-III. Модифицированные полипептиды FVII устойчивы к естественному ингибиторному действию АТ-III в отношении инициации коагуляции. При оценке в соответствующем анализе in vitro или in vivo, например, при введении FVII субъекту в качестве прокоагулянта, модифицированные устойчивые к АТ-III полипептиды FVII проявляют увеличенную коагулянтную активность по сравнению с немодифициро-ванными полипептидами FVII. Как описано здесь ниже, специалист в области техники может эмпирически или рационально сконструировать модифицированные полипептиды FVII, проявляющие повышенную устойчивость к АТ-III. Такие модифицированные полипептиды FVII могут быть исследованы с помощью известных специалисту в области техники подходов на предмет проявления указанными модифицированными полипептидами FVII повышенной устойчивости АТ-III. Например, такие модифицированные полипептиды могут быть проверены на связывание с АТ-III. Как правило, модифицированные полипептиды FVII, которые обладают повышенной устойчивостью к АТ-III, проявляют уменьшенное связывание и/или уменьшенную аффинность к АТ-III. Как правило, указанные исследования проводят на двухцепочечной форме FVII, такой как активированная форма FVII (FVIIa). Кроме того, анализы для определения эффектов АТ-III, как правило, проводят в присутствии гепарина и в присутствии тканевого фактора, хотя такие тесты также могут быть выполнены в отсутствие одного или обоих кофакторов.
В настоящем документе предусмотрены модифицированные полипептиды FVII, обладающие повышенной устойчивостью к АТ-III. Важна устойчивость к ингибированию АТ-III как в присутствии, так и в отсутствие ТФ. Предусмотренные в настоящем документе варианты полипептида FVII включают модификации одной или нескольких аминокислот в позициях 239, 931, 366 и 373 (соответствующих аминокислотным позициям 99, 170i, 217 и 224, соответственно, по нумерации химотрипсина). Эти аминокислотные остатки могут быть модифицированы заменой, удалением или замещением аминокислот. Указанные остатки могут быть заменены или замещены любой другой аминокислотой. Альтернативно, для изменения конформации целевых аминокислотных остатков или структуры белка в непосредственной близости от целевых аминокислотных остатков могут быть использованы вставки аминокислот. Любой аминокислотный остаток может быть заменен на эндогенный аминокислотный остаток в конкретной позиции. Как правило, заменяющую аминокислоту выбирают так, что она препятствует взаимодействию между FVII и АТ-III. В некоторых примерах остаток треонина в положении 239 (соответствует положению 99 по нумерации химотрипсина) заменяют на остаток серина (Ser, S), аспарагина (Asn, N), глутами-на (Gln, Q), валина (Val, V), лейцина (Leu, L), гистидина (His, H) или изолейцина (Ile, I). В других примерах, пролин в позиции 321 (соответствует положению 170i по нумерации химотрипсина) заменяют на лизин (Lys, K), глутаминовую кислоту (Glu, E), серин (Ser, S) или тирозина (Tyr, Y). В дополнительных примерах глутамин в положении 366 (соответствует положению 217 по нумерации химотрипсина) заменяют на аспарагин (Asn, N), аспарагиновую кислоту (Asp, D), глутаминовую кислоту (Glu, E), серин (Ser, S), треонин (Thr, Т), лизин (Lys, K) или валин (Val, V). В других примерах гистидин в положении 373 (соответствует положению 224 по нумерации химотрипсина) заменяют на остаток аспарагиновой кислоты (Asp, D), глутаминовой кислоты (Glu, E), серина (Ser, S), фенилаланина (Phe, F) или аланина (Ala, А). В другом варианте могут быть получены комбинации мутаций. Среди таких комбинаций мутаций есть комбинации, включающие две или более мутаций остатков Т239, Р321, Q366 и Н373 (которые соответствуют остаткам Т99, P170i, Q217 и Н224, соответственно, по нумерации химотрипсина). Например, модифицированный полипептид FVII может обладать аминокислотными заменами в 2, 3, 4 или 5 указанных позициях. Следовательно, модифицированный полипептид может обладать 1, 2, 3, 4 или 5 мутациями, которые могут привести к увеличению устойчивости модифицированного полипептида FVII к ингиби-торному действию АТ-III. Например, полипептид FVII может быть модифицирован в положении 366 и положении 373. В некоторых примерах модификация представляет собой замену аминокислоты, напри
мер замену глутамина в положении 366 на аспарагиновую кислоту и замену гистидина в положении 373 на глутаминовую кислоту. В табл. 7 приведены неограничивающие примеры аминокислотных замен в указанных остатках согласно положениям аминокислот в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. В приведенные примеры включены примеры комбинаций мутаций. Как уже отмечалось, такие полипептиды FVII сконструированы для повышенной устойчивости к АТ-III и, следовательно, увеличенной коагулянтной активности. При описании указанных мутаций первая аминокислота (однобуквенная аббревиатура) соответствует аминокислоте, которую заменяют, ее номер соответствует положению в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, а вторая аминокислота (однобуквенная аббревиатура) соответствует выбранной аминокислоте, которая заменяет первую аминокислоту в этом положении. Аминокислотные позиции для мутирования также обозначаются по нумерации химотрипсина. В табл. 7 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII.
Таблица 7
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
T239S
T99S
159
T239N
T99N
160
T239Q
T99Q
161
T239V
T99V
162
T239L
T99L
163
Т239Н
Т99Н
164
T239I
T99I
165
Р321К
P170iK
166
Р321Е
P170iE
167
P321Y
P170iY
168
P321S
P170iS
169
Q366D
Q217D
170
Q366E
Q217E
171
Q366N
Q217N
172
Q366T
Q217T
173
Q366S
Q217S
174
Q366V
Q217V
175
Q366I
Q217I
176
Q366L
Q217L
177
Q366M
Q217M
178
H373D
H224D
179
Н373Е
H224E
180
H373S
H224S
181
H373F
H224F
182
Н373А
H224A
183
Q366D/H373E
Q217D/ H224E
184
Q366V/H373V
Q217V/ H224V
185
Q366V/H373L
Q217V/ H224L
186
Q366V/H373I
Q217V/ H224I
187
Модифицированные полипептиды FVII с повышенной устойчивостью к АТ-III могут проявлять уменьшенную степень ингибирования при определенных условиях или уменьшенную константу скорости второго порядка для ингибирования АТ-III по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со степенью ингибиро-вания или константой скорости второго порядка для ингибирования немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Таким образом, модифицированные полипептиды FVII могут обладать устойчивостью к АТ-III, повышенной по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с устойчивостью, проявляемой немодифицированным полипептидом FVII. Повышенная устойчивость к АТ-III таких модифицированных полипептидов FVII также может проявляться в виде повышенной коагулянтной активности, увеличенной продолжительности коагулянтной активности и/или увеличенного терапевтического индекса в присутствии АТ-III. Коагулянтная активность АТ-Ш-модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированных полипептидов FVII или полипептидов FVII дикого типа in vivo или in vitro.
3. Повышенная устойчивость к ингибированию Zn2+.
Амидолитическая активность FVIIa регулируется аллостерическими изменениями, индуцируемыми связыванием ионов кальция и тканевого фактора (ТФ). Свободный FVII обычно существует в неактив
ной конформации. Связывание с Са2+ и ТФ индуцирует изменения конформации и увеличение амидоли-тической активности (Pederson и др., (1990) J. Biol. Chem. 265: 16786-16793). Напротив, было показано, что связывания ионов цинка с FVIIa ингибирует активность. Связывание Zn2+ с FVIIa приводит к снижению амидолитической активности и снижению аффинности к ТФ. Исследования показывают, что Ca2+ и Zn2+ конкурируют за связывание с FVIIa, поэтому в присутствии Са2+ ингибиторное действие Zn2+ уменьшается. Кроме того, связавшийся с ТФ белок FVIIa менее восприимчив к ингибированию цинком.
В дополнение к сайтам связывания Zn2+ в домене Gla, связывание Zn2+ с которыми не влияет на амидолитическую активность FVIIa, были найдены два сайта связывания Zn2+ на протеазном домене FVII (Petersen и др., (2000) Protein Sci. 9: 859-866, Bajaj и др., (2006) J. Biol. Chem. 281: 24873-24888). Первый сайт связывания Zn2+ включает в себя боковые цепи аминокислотных остатков Н216, Е220 и S222 (Н76, Е80 и S82 по нумерации химотрипсина), а второй сайт связывания Zn2+ включает в себя боковые цепи аминокислотных остатков Н257, D219 и K161 (H117, D79 и K24 по нумерации химотрипсина).
Zn2+, следовательно, может иметь физиологическую роль в регуляции гомеостаза в качестве ингибитора FVII. Высказывалось предположение, что ингибиторный эффект возникает в результате увеличения концентрации Zn2+ в месте образования сгустка после активации тромбоцитов (Bajaj и др., (2006) J. Biol. Chem. 281:24873-24888). В тромбоцитах в цитоплазме и в а-гранулах, которые высвобождаются при активации тромбоцитов, хранится большое количество Zn2+. Это может привести к увеличению локальной концентрации Zn2+, который, в свою очередь, может ингибировать активность FVIIa и связывание FVIIa с ТФ.
Примеры модификаций для повышения устойчивости к ингибированию Zn2+.
В настоящем документе предусмотрены модифицированные полипептиды FVII, проявляющие повышенную устойчивость к ингибиторному эффекту Zn2+. Это может быть достигнуто, например, за счет мутации одного или нескольких остатков в FVII, вовлеченных во взаимодействие и связывание с Zn2+, что уменьшит или предотвратит такое связывание, что сделает модифицированные полипептиды FVII устойчивыми к ингибированию каталитической активности и связывания ТФ ионами Zn2+. При оценке в соответствующем анализе in vitro или in vivo, например, при введении субъекту в качестве прокоагулян-та модифицированные полипептиды FVII могут проявлять повышенную коагулянтную активность по сравнению с немодифицированным полипептидом FVII.
В настоящем документе предусмотрены модифицированные полипептиды FVII, обладающие одной или несколькими мутациями остатков, которые могут быть вовлечены в связывание Zn2+ протеазным доменом. Такие остатки включают, но не ограничиваются K161, Н216, D219, Е220, S222 и Н257 по нумерации аминокислотной последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3 (соответствуют K24, Н76, D79, Е80, S82 и H117, соответственно, по нумерации химотрипсина). В некоторых примерах один или более аминокислотных остатков Н216, Н257 и S222 (соответствуют Н76, S82 и H117 по нумерации химотрипсина) были модифицированы, например, путем замены или удаления аминокислот. Любой аминокислотный остаток может быть использован для замены эндогенного остатка в указанном положении. Например, в настоящем документе предусмотрены модифицированные полипептиды FVII, в которых остаток гистидина в положении 216 заменен на остаток серина, аланина, лизина и аргинина. В другом примере серин в положении 222 заменен на остаток аланина или лизина или гисти-дин в положении 257 заменен на остаток аланина или серина. В дополнительном варианте лизин в положении 161 заменен на остаток серина, аланина и валина. Модификации также включают вставки аминокислот в положения, которые вовлечены в связывание Zn2+, или вставки аминокислот рядом с указанными положениями. Такие вставки могут нарушить сайт связывания Zn2+, в результате чего модифицированные полипептиды FVII будут обладать сниженным связыванием с Zn2+.
Также могут быть созданы комбинации мутаций, в которых аминокислотные замены затронули более чем один из вышеуказанных остатков в полипептиде FVII. Среди таких комбинаций мутаций присутствуют комбинации, включающие две или более мутации остатков из K161, Н216, D219, Е220, S222 и Н257 (соответствующих остаткам K24, Н76, D79, Е80, S82 и H117, соответственно, по нумерации химот-рипсина). Например, модифицированные полипептиды FVII могут обладать аминокислотными заменами по 2, 3, 4, 5 или 6 указанным позициям. Следовательно, модифицированный полипептид может включать 1, 2, 3, 4, 5 или 6 мутаций, которые могут привести к снижению способности модифицированного полипептида FVII связывать Zn2+. Например, полипептид FVII может быть модифицирован заменой аминокислоты серина в положении 222 на лизин и заменой гистидина в положении 257 на аланин.
Модифицированные полипептиды FVII с повышенной устойчивостью к ингибиторному эффекту Zn2+ могут проявлять устойчивость, повышенную по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с устойчивостью не-модифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Уменьшение связывания с Zn2+ и, следовательно, повышенная устойчивость к ингибиторному эффекту Zn2+ также может проявляться такими модифицированными полипептидами FVII, как повышенная коагулянтная активность в присутствии Zn2+. Коагулянтная активность модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного
полипептида FVII или полипептида FVII дикого типа in vivo или in vitro.
В табл. 8 приведены не ограничивающие примеры аминокислотных замен в указанных остатках согласно положениям в последовательности аминокислот зрелого полипептида FVII, приведенной в SEQ ID NO: 3. Среди них приведены примеры комбинаций мутаций. Как уже отмечалось, такие полипептиды FVII проявляют пониженную способность связывать Zn2+ и, следовательно, проявляют повышенную устойчивость к ингибиторному эффекту Zn2+. Таким образом, модифицированные полипептиды FVII могут проявлять увеличенную коагулянтную активность. При описании таких мутаций первая аминокислота (однобуквенная аббревиатура) соответствует аминокислоте, которая заменяется, ее номер соответствует положению аминокислоты в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, а вторая аминокислота (однобуквенная аббревиатура) соответствует выбранной аминокислоте, которая заменяет первую аминокислоту в этом положении. Аминокислотные позиции для мутирования также обозначаются по нумерации химотрипсина. В табл. 8 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII.
Таблица 8
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
K161S
K24S
188
К161А
К24А
189
K161V
K24V
190
H216S
H76S
191
Н216А
Н76А
192
Н216К
Н76К
193
H216R
H76R
194
S222A
S82A
195
S222K
S82K
196
S222V
S82V
197
S222N
S82N
198
S222E
S82E
199
S222D
S82D
200
Н257А
Н117А
201
H257S
H117S
202
S222K/H257A
S82K/H117A
203
Н216А/Н257А
Н76А/Н117А
204
H216A/S222A
H76A/S82A
205
4. Измененное гликозилирование.
Свойства и активности белка могут быть изменены путем изменения степени, уровня и/или типа гликозилирования. Например, гликозилирование может увеличить время полураспада полипептидов в сыворотке за счет повышения стабильности, растворимости и снижения иммуногенности белков. Глико-зилирование может увеличить стабильность белков за счет уменьшения протеолиза белка и может защитить белок от термической деструкции, воздействия денатурирующих агентов, ущерба от свободных радикалов кислорода, а также изменения рН. Гликозилирование также может позволить целевому белку избежать клиренса, который может включать связывание с другими белками, в том числе рецепторами клеточной поверхности. Углеводные фрагменты, которые содержат остатки сиаловой кислоты, могут повлиять на растворимость белка. Остатки сиаловой кислоты высоко гидрофильны и могут защитить гидрофобные остатки целевого белка. Это уменьшает агрегацию и осаждение целевого белка. Снижение агрегации также помогает предотвратить иммунный ответ против целевого белка. Кроме того, углеводы могут экранировать иммуногенные последовательности от иммунной системы. Объем пространства, занимаемый углеводным фрагментом, может уменьшить площадь поверхности, доступной для иммунной системы. Эти свойства ведут к уменьшению иммуногенности целевого белка.
Сайты гликозилирования представляют собой место прикрепления моносахаридов и олигосахари-дов к полипептиду через гликозидную связь так, что, если полипептид производится в эукариотической клетке, способной к гликозилированию, он гликозилируется. Два основных типа гликозилирования представляют собой N-гликозилирование, где сахара крепятся через амидный азот остатка аспарагина, и О-гликозилирование, где сахара крепятся через гидроксильные группы остатков серина, треонина, гид-роксилизина или гидроксипролина. Другие, минорные формы гликозилирования включают S-связь с ци-стеином и С-связь с триптофаном. N-гликозилирование происходит по остатку аспарагина в консенсус
ной последовательности -Asn-Xaa-Ser/Thr/Cys, где Хаа не представляет собой пролин. Для О-гликозилирования не существует известных мотивов, хотя О-гликозилирование более вероятно для последовательности с высоким содержанием остатков серина, треонина и пролина. Наличие потенциального сайта гликозилирования, однако, не гарантирует, что сайт будет гликозилирован во время посттрансляционной модификации в ЭР. Кроме того, уровень гликозилирования в данном сайте может варьировать, и один сайт может иметь много различных структур гликана. В FVII существуют четыре естественных сайта гликозилирования, два сайта N-гликозилирования в N145 и N322 и два сайта О-гликозилирования в S52 и S60 согласно положениям аминокислотной последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3.
Примеры модификаций для изменения гликозилирования.
В настоящем документе предусмотрены полипептиды FVII, которые были модифицированы путем изменения уровня и/или типа гликозилирования по сравнению с немодифицированным полипептидом FVII. Гликозилирование может быть увеличено или уменьшено по сравнению с немодифицированным FVII. В некоторых случаях уровень гликозилирования увеличивается, в результате чего образуется ги-пергликозилированный полипептид FVII. Это может быть достигнуто, например, введением по меньшей мере одного ненативного сайта гликозилирования, не присутствующего в немодифицированном полипептиде, к которому присоединен углеводный фрагмент. Гипергликозилированный полипептид FVII также может быть получен присоединением углеводного фрагмента по меньшей мере к одному нативно-му сайту гликозилирования, который присутствует в немодифицированном полипептиде FVII, но не гли-козилирован. В других примерах уровень гликозилирования в модифицированном полипептиде FVII уменьшается по сравнению с немодифицированным полипептидом FVII. Это может быть достигнуто путем устранения одного или более нативных сайтов гликозилирования, например, путем замены или удаления аминокислот. Один или несколько аминокислотных остатков в положениях 52, 60, 145 и 322 по нумерации последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, могут быть удалены или могут быть заменены на аминокислоты, которые не могут быть связаны с углеводным фрагментом. Например, остаток серина в положении 52 и/или 60 может быть заменен на остаток алани-на, устранив тем самым один или оба нативных сайта О-гликозилирования. Таким образом, сайты глико-зилирования в полипептиде FVII могут быть введены, изменены, устранены или перемещены.
Полипептид FVII может быть модифицирован по одному или нескольким положениям для изменения гликозилирования полипептида. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, обладающие измененным гликозилированием по сравнению с немодифицирован-ным полипептидом FVII, могут не иметь гликозилирования, могут иметь О-гликозилирование, N-гликозилирование и/или их сочетание. В некоторых примерах модифицированные полипептиды FVII включают 1, 2, 3, 4, 5 или больше углеводных фрагментов, каждый из которых связан со своим сайтом гликозилирования.
Сайты гликозилирования могут быть нативными сайтами гликозилирования и/или ненативными сайтами гликозилирования. В некоторых примерах модифицированные полипептиды FVII гликозилированы более чем по одному ненативному сайту гликозилирования. Например, модифицированные полипептиды FVII могут быть модифицированы введением 1, 2, 3, 4, 5 или более ненативных сайтов гликозилирования. Ненативные сайты гликозилирования могут быть введены с помощью аминокислотных замен.
Сайты О-гликозилирования могут быть созданы, например, путем замены нативной аминокислоты на остатки серина или треонина. Сайты N-гликозилирования могут быть созданы введением мотива Asn-Xaa-Ser/Thr/Cys, где Хаа не представляет собой пролин. Создание указанной консенсусной последовательности аминокислот модификацией аминокислот может включать замену нативного аминокислотного остатка на аспарагин, замену нативного аминокислотного остатка на серин, треонин и цистеин, или замену нативного аминокислотного остатка на аспарагин и замену нативного аминокислотного остатка на серии, треонин и цистеин. Например, для создания нового мотива Asn-Xaa-Ser в домене EGF1 и нового сайта N-гликозилирования в положении 109 лизин в положении 109 (по нумерации последовательности зрелого FVII, приведенной в SEQ ID NO: 3) может быть заменен на аспарагин. В еще одном примере для создания нового мотива Asn-Xaa-Ser и нового сайта N-гликозилирования в положении 292 аланин в положении 292 заменяют на аспарагин и аланин в положении 294 заменяют на серии. В другом примере для создания нового мотива Asn-Xaa-Ser в аминокислотных позициях 173-175 (по нумерации последовательности зрелого FVII, приведенной в SEQ ID NO: 3) и нового сайта N-гликозилирования в положении 173 аланин в положении 175 заменяют на серин. Ненативный сайт гликозилирования может быть создан в любом районе полипептида FVII. Например, один или несколько сайтов гликозилирования могут быть введены в домен EGF1, который соответствует аминокислотным позициям 46-82 зрелого полипептида FVII в SEQ ID NO: 3. В других примерах ненативный сайт гликозилирования вводят в протеазный домен полипептида FVII или в позиции, которые связываются с протеазным доменом после сворачивания белка.
Нативные сайты гликозилирования могут быть модифицированы для предотвращения гликозили-рования или повышения или уменьшения гликозилирования, в то время как другие позиции в полипептиде FVII могут быть изменены для введения ненативного сайта гликозилирования. В некоторых примерах может быть изменен состав углеводов полипептида FVII. Например, могут быть изменены номер
положения, прочность связи, структура и состав углеводных связей (т.е. структура углевода на основе природы гликозидных связей или ветвей углевода) углеводных фрагментов, добавленных к полипептид-
ну FVII.
Предусмотренные в настоящем документе модифицированные полипептиды FVII с измененным гликозилированием сохраняют по меньшей мере одну активность FVII. Как правило, модифицированные полипептиды FVII с измененным гликозилированием, предусмотренные в настоящем документе, обладают повышенной коагулянтной активностью по сравнению с немодифицированным FVII. В некоторых примерах уровень гликозилирования полипептида FVII увеличен. Уровень гликозилирования может быть увеличен по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с уровнем гликозилирования немодифицированного полипептида FVII или полипептида FVII дикого типа. В других примерах уровень гликозилирования уменьшен. Уровень гликозилирования может быть уменьшен по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с уровнем гликозилирования немодифицированного полипептида FVII или полипептида FVII дикого типа. Измененный уровень гликозилирования или измененный тип гликозилирования модифицированного полипептида FVII по сравнению с немодифицированным полипептидом FVII может проявляться как повышенная коагулянтная активность. Коагулянтная активность модифицированного полипептида FVII с измененным гликозилированием может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro.
В табл. 9 приведены не ограничивающие примеры аминокислотных замен (согласно положениям аминокислот последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), введенных в модифицированный полипептид FVII для изменения уровня гликозилирования путем добавления или устранения сайтов гликозилирования. Аминокислотные замены, приведенные в качестве примеров, могут привести к созданию ненативного сайта гликозилирования или устранению нативного сайта гликози-лирования. В некоторых случаях для создания нового сайта гликозилирования необходимы две аминокислотные замены. Кроме того, в табл. 9 приведены примеры комбинаций мутаций, которые приводят более чем к одному новому ненативному сайту гликозилирования в полипептиде FVII. Как отмечалось выше, изменение уровня гликозилирования может привести, например, к увеличению периода полураспада. Таким образом, модифицированные полипептиды FVII могут обладать увеличенной коагулянтной активностью. При описании таких мутаций первая аминокислота (однобуквенная аббревиатура) соответствует аминокислоте, которая заменяется, ее номер соответствует положению аминокислоты в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, а вторая аминокислота (однобук-венная аббревиатура) соответствует выбранной аминокислоте, которая заменяет первую аминокислоту в этом положении. Аминокислотные позиции для мутирования также обозначаются по нумерации химот-рипсина, где это необходимо. В случае, если положение модифицируемой аминокислоты не имеет соответствующего номера по химотрипсину (т.е. положение не относится к положениям с 153 по 406 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, и не указано в табл. 1 выше), положение обозначается в скобках с использованием нумерации зрелого FVII. Например, A51N не имеет соответствующего номера по химотрипсину и приводится в виде A[51]N в контексте нумерации химот-рипсина. В табл. 9 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII. Также в табл. 9 приведены все новые ненативные сайты гликозилирования (сайт гликозилирова-ния), полученные в результате модификаций (модификации).
Таблица 9
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
Ненативный
сайт гликозилиро
-вания (нумерация зрелого FVII)
Ненативный
сайт гликозилирования (нумерация химотрипсина)
SEQ ID NO
S52A
S[52]A
ничего
ничего
206
S60A
S[60]A
ничего
ничего
207
E394N/P395A/R396S
E245N/P246A/R247S
N394
N245
208
R202S
R62S
N200
N60d
209
A292N/A294S
A150N/A152S
N292
N150
210
G318N
G170fN
N318
N170f
211
A175S
A39S
N173
N37
212
K109N
K[109]N
N109
N[109]
213
A122N/G124S
A[122]N/G[124]S
N122
N[122]
214
A51N
A[51]N
N51
N[51]
215
T130N/E132S
T[130]N/E[132]S
N130
N[130]
216
A122N/G124S/ E394N/P395A/R396S
A[122]N/G[124]S/ E245N/P246Am47S
N122 и N394
N[122] и N245
217
A122N/G124S/
E394N/P395A/R396S/
G318N
A[122]N/G[124]S/
E245N/P246A/R247S/
G170fN
N122, N394 и N318
N[122], N245 и N318
218
S52A/S60A
S[52]A/S[60]A
ничего
ничего
219
S52N/P54S
S[52]N/P[54]S
N52
N[52]
220
S119N/L121S
S[119]N/L[121]S
N119
N[119]
221
T128N/P129A
T[128]N/P[129]A
N128
N[128]
222
Q66N/Y68S
Q[66]N/Y[68]S
N66
N[66]
223
S52N/P54S/A122N/G1 24S/E394N/P395A/R39 6S
S[52]N/P[54]S/A[122] N/G[124]S/E245N/P24 6A/R247S
N52, N122 и N397
N[52], N[122] и N245
224
K109N/A292N/A294S
K[109]N/A150N/A152
N109 и N292
N[109] и N150
225
K109N/A175S
K[109]N/A39S
N109 и N173
N[109] и N37
226
S119N/L121S/A175S
S[119]N/L[121]S/A39S
N119H N173
N[119] и N37
271
T128N/P129A/A175S
T[128]N/P[129]A/A39
N128 и N173
N[128] и N37
272
A122N/G124S/A175S
A[122]N/G[124]S/A39
N122 и N173
N[122] и N37
273
5. Увеличение связывания сывороточного альбумина и/или интегрина тромбоцитов aIIbp3.
Рекомбинантный немодифицированный FVII обладает периодом полураспада в сыворотке человека всего 1,5-3 ч. Увеличение периода полураспада полипептида FVII в сыворотке может уменьшить количество и частоту введения, необходимые для терапевтического эффекта. Для увеличения периода полураспада в сыворотке могут быть использованы несколько стратегий, включая, но не ограничиваясь увеличением гликозилирования, увеличением устойчивости к протеазам, пегилированием и конъюгированием или слиянием с более крупными белками, такими как сывороточный альбумин и Fc-фрагмент IgG. Такие изменения могут привести, например, к снижению деградации полипептида FVII протеазами сыворотки, снижению почечного клиренса, снижению печеночного клиренса и снижению нейтрализации или клиренса иммунной системой. Другая стратегия, которая может быть использована для увеличения периода полураспада полипептида FVII в сыворотке, включает перенос связывающей последовательности в не-модифицированный полипептид FVII для создания новых или улучшенных белок-белковых взаимодействий, которые не наблюдаются в немодифицированном полипептиде FVII.
Связывающие последовательности, которые могут быть вставлены в немодифицированный полипептид FVII, могут содержать приблизительно 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30 или более аминокислотных остатков и обеспечивать взаимодействие с другими белками. Связывающие последовательности могут соответствовать связывающим последовательностям, естественным образом присутствующим в нативном белке, или связывающие последовательности могут представлять собой синтетические связывающие последовательности с малой корреляцией или отсутствием корреляции последовательно
сти со связывающей последовательностью, естественным образом присутствующей в нативном белке. Связывающие последовательности, использованные здесь для модификации полипептидов FVII, специфически взаимодействуют с сайтом связывания на другом белке с образованием нековалентных белок-белковых взаимодействий. В некоторых примерах белок, к которому специфична связывающая последовательность, представляет собой сывороточный белок, такой как, например, сывороточный альбумин. Такие последовательности хорошо известны в уровне техники (см., например, US 20030069395, US 20040009534 и US 20070202045). В других примерах распознаваемый связывающей последовательностью белок представляет собой рецептор клеточной поверхности или лиганд, такой как, например, ин-тегрин тромбоцитов aIIbp3 (Smith и др., (1995) J. Biol. Chem. 270:30486-30490). Аффинность связывания модифицированного полипептида FVII с белком сыворотки или рецептором клеточной поверхности, как правило, характеризуется константой диссоциации, Kd, составляющей 1 мкМ, 100, 10, 1 нМ, 100, 10, 1 пМ или меньше. Связывание модифицированного полипептида FVII с белком сыворотки или рецептором клеточной поверхности через связывающую последовательность может уменьшить, например, почечный клиренс или печеночный клиренс модифицированного полипептида FVII по сравнению с немодифици-рованным полипептидом FVII. В некоторых примерах связывание модифицированного полипептида FVII с рецептором клеточной поверхности также может направлять модифицированный полипептид FVII к нужной клетке, типу ткани или району в организме, тем самым "концентрируя" полипептид FVII в определенном месте, например в месте образования сгустка крови. Таким образом, модифицированные полипептиды FVII, содержащие вставленную связывающую последовательность, могут обладать увеличенным периодом полураспада по сравнению с немодифицированным полипептидом FVII.
а. Примеры полипептидов FVII со связывающей сывороточный альбумин последовательностью.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие связывающую сывороточный альбумин последовательность. Модифицированные полипептиды FVII могут связывать сывороточный альбумин in vitro или in vivo, в результате чего увеличивается период полураспада белка. Таким образом, в настоящем документе предусмотрены модифицированные полипептиды FVII с увеличенным периодом полураспада по сравнению с немодифицированным полипептидом FVII. При оценке в соответствующем анализе in vitro или in vivo, например при введении FVII субъекту в качестве прокоагулянта, модифицированные полипептиды FVII могут проявлять увеличенную коагулянт-ную активность по сравнению с немодифицированным полипептидом FVII.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут содержать связывающую сывороточный альбумин последовательность. Связывающая сывороточный альбумин последовательность может быть вставлена в немодифицированный полипептид FVII или может быть связана с С-концом или N-концом полипептида FVII. Например, связывающая сывороточный альбумин последовательность может начинаться от остатка пролина в положении 406 на С-конце полипептида FVII (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). Если связывающая последовательность вставлена в полипептид FVII, вставка осуществляется в такое положение, что полученный модифицированный FVII полипептид сохраняет по меньшей мере один вид активности немодифицированного полипептида FVII. Связывающая последовательность может быть вставлена в полипептид FVII без удаления каких-либо аминокислотных остатков в полипептиде FVII или может заменить один или более аминокислотных остатков в полипептиде FVII. В некоторых примерах для создания модифицированного полипептида FVII связывающая сывороточный альбумин последовательность заменяет аминокислотные остатки с S103 до S111 (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). В других примерах связывающая сывороточный альбумин последовательность заменяет аминокислотные остатки с H115 до S126 или с Т128 до Р134 (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). Примеры связывающих сывороточный альбумин последовательностей приведены в SEQ ID NO: 206-212.
В табл. 10 приведены не ограничивающие примеры модификаций, которые могут быть введены, чтобы вставить в полипептид FVII связывающую сывороточный альбумин последовательность. Как отмечалось выше, введение связывающей сывороточный альбумин последовательности может увеличить период полураспада полипептида FVII. Таким образом, модифицированные полипептиды FVII могут обладать увеличенной коагулянтной активностью. Аминокислотные остатки, по которым вставляют связывающую сывороточный альбумин последовательность в полипептид FVII, и последовательность связывающей последовательности представлены в табл. 10. Например, S103S111 удаление/вставка QRLMEDICLPRWGCLWEDDF указывает, что аминокислотные остатки с S103 до S111 по нумерации немодифицированного полноразмерного полипептида FVII (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) были удалены и заменены связывающей сывороточный альбумин последовательностью аминокислот QRLMEDICLPRWGCLWEDDF (SEQ ID NO: 206). Указание только одной аминокислоты, такой как Р406, означает, что связывающая сывороточный альбумин последовательность вставлена после Р406 и что из полипептида FVII не удаляли аминокислотные остатки. Аминокислоты для мутирования также обозначаются по нумерации химотрипсина, где это необходимо. Если модифицированные аминокислотные положения не имеют соответствующего номера по химотрипсину (т.е. положение не соответствует положениям с 153 до 406 последовательности зрелого
полипептида FVII, приведенной в SEQ ID NO: 3, и не указано в табл. 1 выше), положение обозначается в скобках с использованием нумерации зрелого FVII. Например, S103 не имеет соответствующего номера по химотрипсину и приводится в виде S[103] в контексте нумерации химотрипсина. В табл. 10 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII.
Таблица 10
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
S103 S111 удаление/BCTaBKaQRLMEDI CLPRWGCLWEDDF
S[103]S[111]удаление/вставкаОДЕМ EDICLPRWGCLWEDDF
227
Н115 S126удаление/вставкаОДЬМЕВ ICLPRWGCLWEDDF
H[l 15]8[126]удаление/вставка011ЕМ EDICLPRWGCLWEDDF
228
Т128Р13 4у дал ение/BCTaBKaQRLMEDI CLPRWGCLWEDDF
T[ 128]P[ 13 4] удаление/BCTaBKaQRLM EDICLPRWGCLWEDDF
229
S103 S1111удаление/вставка1Е01СЕР RWGCLWE
S[103]S[111]удаление/вставка1Е01СЕ PRWGCLWE
230
H115 S126yflaneHHe/BCTaBKaIEDICLPR WGCLWE
H [ 115 ] S [ 12 6] удал ение/вставкаШОЮ LPRWGCLWE
231
T128P134ynЈuieHHe/BCTaBKaIEDICLPR WGCLWE
Т[128]Р[134]удаление/вставка1ЕОКХ PRWGCLWE
232
S103S111 удаление/BCTaBKaDICLPRW GCLWED
S[103]S[111]удаление/вставкаОЮЕР RWGCLWED
233
HI 15S126yflaneHHe/BcraBKaDICLPRW GCLWED
H[ 115] S [ 126] удаление/BCTaBKaDICLP RWGCLWED
234
T128P134yflcmeHHe/BCxaBKaDICLPRW GCLWED
T[ 128]P [ 134]удаление/вставка01СЕР RWGCLWED
235
P406BCTaBKaIEDICLPRWGCLW
P257BCTaBKaIEDICLPRWGCLW
236
P406BCTaBKaGGGSIEDICLPRWGCL W
P257BCTaBKaGGGSIEDICLPRWGCL W
237
P406BCTaBKaDICLPRWGCLWED
P257BcraBKaDICLPRWGCL WED
238
P406BCTaBKaGGGSDICLPRWGCLWE D
P257BCTaBKaGGGSDICLPRWGCLWE D
239
Модифицированные полипептиды FVII, содержащие связывающую сывороточный альбумин последовательность, могут обладать способностью связывать сывороточный альбумин, повышенной по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со связыванием сывороточного альбумина немодифицированным полипептидом FVII или полипептидом FVII дикого типа in vivo или in vitro. Модифицированные полипептиды FVII, которые могут связывать сывороточный альбумин, могут обладать увеличенным периодом полураспада в сыворотке по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с периодом полураспада в сыворотке немодифи-цированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Увеличенное связывание сывороточного альбумина и/или увеличенный период полураспада в сыворотке таких модифицированных полипептидов FVII также может проявляться как повышенная коагулянтная активность, повышенная продолжительность коагулянтной активности и/или увеличенный терапевтический индекс. Коагулянтная активность модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro.
b. Примеры полипептидов FVII со связывающей интегрин тромбоцитов aIIbp3 последовательностью.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие связывающую интегрин тромбоцитов aIIbp3 последовательность. Интегрин тромбоцитов aIIbp3 (также называемый гликопротеином (GP) IIb/IIIa) является наиболее распространенным рецептором адгезии тромбоцитов. Он представляет собой кальцийзависимый гетеродимер, который служит рецептором для белков, включающих, но не ограничивающихся, фибриноген, фибронектин, витронектин, фактор Виллебранда и тромбоспондин. Связывание с белком-лигандом может активировать aIIbp3 и индуцировать передачу
сигнала в цитоплазму через внутриклеточный домен белка.
Модифицированные полипептиды FVII, содержащие связывающую интегрин тромбоцитов aIIbp3 последовательность, следовательно, могут связываться с тромбоцитами. Модифицированные полипептиды FVII могут связывать интегрин тромбоцитов aIIbp3 (в активированной и/или не активированной форме) in vitro или in vivo, что приводит к увеличению периода полураспада. Те варианты FVIIa, которые избирательно связывают активированный aIIbp3, могут быть, следовательно, нацелены на активированные тромбоциты и, таким образом, сконцентрированы в месте образования сгустка крови. При избирательном нацеливании FVIIa на образующиеся сгустки крови можно было бы ожидать улучшения терапевтической полезности варианта FVIIa путем повышения эффективности и терапевтического индекса. Таким образом, в настоящем документе предусмотрены модифицированные полипептиды FVII с увеличенным периодом полураспада по сравнению с немодифицированным полипептидом FVII, и варианты полипептида, которые, кроме того, селективно связывают активированные тромбоциты. При оценке в соответствующих анализах in vitro или in vivo, например, при введении субъекту в качестве про-коагулянта, модифицированные полипептиды FVII могут проявлять увеличенную коагулянтную активность по сравнению с немодифицированным полипептидом FVII.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, содержат связывающую интегрин тромбоцитов aIIbp3 последовательность. Связывающая интегрин тромбоцитов aIIbp3 последовательность может быть вставлена в немодифицированный полипептид FVII или может быть связана с С-концом или N-концом полипептида FVII. Например, связывающая aIIbp3 последовательность может начинаться от остатка пролина в положении 406 на С-конце полипептида FVII (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). Если связывающая последовательность вставлена в полипептид FVII, вставка осуществляется в такое положение, что полученный модифицированный FVII полипептид сохраняет, по меньшей мере, один вид активности немодифициро-ванного полипептида FVII. Связывающая последовательность может быть вставлена в полипептид FVII без удаления каких-либо аминокислотных остатков в полипептиде FVII или может заменить один или более аминокислотных остатков в полипептиде FVII. В некоторых примерах для создания модифицированного полипептида FVII связывающая интегрин тромбоцитов aIIbp3 последовательность заменяет аминокислотные остатки с S103 до S111 (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). В других примерах связывающая интегрин тромбоцитов aIIbp3 последовательность заменяет аминокислотные остатки с H115 до S126 или с Т128 до Р134 (согласно последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3). Примеры связывающих интегрин тромбоцитов aIIbp3 последовательностей приведены в SEQ ID NO: 213-215.
В табл. 11 приведены не ограничивающие примеры модификаций, которые могут быть введены, чтобы вставить в полипептид FVII связывающую интегрин тромбоцитов aIIbp3 последовательность. Как отмечалось выше, введение связывающей интегрин тромбоцитов aIIbp3 последовательности может увеличить период полураспада полипептида FVII в сыворотке и/или нацелить белок на образующийся сгусток крови. Таким образом, модифицированные полипептиды FVII могут проявлять увеличенную коагу-лянтную активность. Аминокислотные остатки, по которым вставляют связывающую интегрин тромбоцитов aIIbp3 последовательность в полипептид FVII, и последовательность связывающей последовательности представлены в табл. 11.
Например, H115S126удаление/вставкаSFGRGDIRNV указывает, что аминокислотные остатки с H115 до S126 по нумерации немодифицированного полноразмерного полипептида FVII (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) были удалены и заменены связывающей интегрин тромбоцитов aIIbp3 последовательностью аминокислот SFGRGDIRNV (SEQ ID NO: 213). Указание только одной аминокислоты, такой как Р406, означает, что связывающая интегрин тромбоцитов aIIbp3 последовательность вставлена после Р406 и что из полипептида FVII не удаляли аминокислотные остатки. Аминокислоты для мутирования также обозначаются по нумерации химотрипсина, где это необходимо. Если модифицированные аминокислотные положения не имеют соответствующего номера по химотрипсину (т.е. положение не соответствует положениям с 153 до 406 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, и не указано в табл. 1 выше), положение обозначается в скобках с использованием нумерации зрелого FVII. Например, S103 не имеет соответствующего номера по химотрипсину и приводится в виде S[103] в контексте нумерации химотрипсина. В табл. 11 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примеры аминокислотных последовательностей модифицированных полипептидов FVII.
Таблица 11
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
S103 S111 удаление/BCTaBKaSFGRGDI RNV
S[103]S[11 Цудаление/BCTaBKaSFGRG DIRNV
240
Н115 S126yfl^eHHe/BCTaBKaSFGRGDI RNV
Н[115]S[126]yдaлeниe/вcтaвкaSFGR GDIRNV
241
Т128Р134yдaлeниe/вcтaвкaSFGRGDI RNV
Т[ 128]Р[ 134]yдaлeниe/вcтaвкaSFGRG DIRNV
242
P406BCTaBKaCSFGRGDIRNVC
P257BCTaBKaCSFGRGDIRNVC
243
P406BCTaBKaGGGSCSFGRGDIRNVC
P257BCTaBKaGGGSCSFGRGDIRNVC
244
Модифицированные полипептиды FVII, содержащие связывающую интегрин тромбоцитов aIIbp3 последовательность, могут обладать повышенным связыванием с интегрином тромбоцитов aIIbp3 по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со связыванием с интегрином тромбоцитов aIIbp3 немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo. Модифицированные полипептиды FVII, которые могут связываться с тромбоцитами через интегрин тромбоцитов aIIbp3, могут обладать увеличенным периодом полураспада по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с периодом полураспада немодифи-цированного полипептида FVII или полипептида FVII дикого типа in vitro, in vivo или ex vivo. Увеличение периода полураспада таких модифицированных полипептидов FVII также может проявляться как повышенная коагулянтная активность, увеличенная продолжительность коагулянтной активности и/или увеличенный терапевтический индекс. Например, коагулянтная активность модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro.
6. Модификация введением гетерологичного домена Gla.
Взаимодействие остатков в у-карбоксилированном домене Gla витамин K-зависимых белков плазмы, таких как FVII, FIX, FX, протромбин, белок С и белок S, и отрицательно заряженных фосфолипидов на поверхности мембраны имеет важное значение для гемостаза. Домен Gla витамин K-зависимых белков плазмы обычно содержит около 45 аминокислот, из которых от 9 до 12 остатков глутаминовой кислоты посттрансляционно модифицированы витамин K-зависимым карбоксилированием с образованием у-карбоксиглутамата (Gla). Аминокислоты домена Gla расположены сразу после аминокислот сигнального пептида и пропептидной последовательности белков и, следовательно, находятся на N-конце зрелых белков после процессинга и расщепления полипептидов-предшественников. Например, аминокислоты, образующие домен Gla в FVII, находятся в положениях 39-83 последовательности полипептида-предшественника, приведенной в SEQ ID NO: 1, положениях 61-105 последовательности полипептида-предшественника, приведенной в SEQ ID NO: 2, и положениях 1-45 последовательности зрелого полипептида, приведенной в SEQ ID NO:3. Из них 10 остатков глутаминовой кислоты в положениях Е6, Е7, Е14, Е19, Е20, Е25, Е26, Е29 и Е35 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, модифицируются карбоксилированием с образования остатков у-карбоксиглутамата (Gla). Из-за относительно низкой аффинности к активированным тромбоцитам домен Gla из FVII является мишенью для модификации с целью усиления взаимодействия между модифицированным FVII и фосфолипи-дами мембраны и увеличения коагулянтной активности. Модификация может быть осуществлена путем замещения конкретных аминокислот, которые участвуют в этом взаимодействии (см., например, Shah и др., PNAS 95: 4429-4234, Harvey и др., (2003) J. Biol. Chem. 278:8363-8369). Кроме того, модификация может быть осуществлена заменой всего домена Gla на домен Gla другого витамин K-зависимого белка, т.е. заменой Gla. Этот тип модификации приводит к химерным белкам, таким как белок, который был получен в результате заменены домена Gla белка С доменом Gla из FVII (Geng и др., (1997) Thromb Hae-most 77:926-933). Как правило, такая модификация включает введение, например, путем вставки или замещения гетерологичного домена Gla или его достаточной для осуществления связывания фосфолипи-дов части в домен полипептида FVII с образованием химерного модифицированного полипептида FVII. Как правило, такой химерный полипептид FVII сохраняет хотя бы одну активность FVII. Связывание и/или аффинность Gla-модифицированного полипептида FVII к активированным тромбоцитам может быть увеличено по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению со связыванием и/или аффинностью немодифициро-ванного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Связывание и/или аффинность модифицированного полипептида FVII к активированным тромбоцитам также может проявляться как повышение коагулянтной активности. Коагулянтная активность Gla-модифицированных по
липептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo или in vitro. Домен Gla или его достаточная для осуществления связывания фосфолипидов часть, включающая, например, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% гетерологичного домена Gla или более, содержащаяся в любом полипептиде, может быть использована как источник гетерологичного домена Gla для вставки или замены домена в полипептиде FVII. Как правило, такие гетерологичные домены Gla проявляют аффинность к фосфолипидам, например фосфолипидам, присутствующим на поверхности активированных тромбоцитов. Как правило, выбранный гетерологичный домен Gla проявляет более высокую аффинность к фосфолипидам по сравнению с аффинностью домена Gla из FVII. Конкретный домен Gla или его достаточная часть, используемые в качестве гетерологичного домена для модификации полипептида FVII, могут быть выбраны рационально или эмпирически. Примеры других Gla-содержащих полипептидов включают, но не ограничиваются, FIX, FX, протромбин, белок С, белок S, остеокальцин, белок Gla, Growth-arrest-specific белок 6 (Gas6) и белок Z. Домены Gla этих белков приведены в качестве примеров в любой из последовательностей SEQ ID NO: 83-91. Например, в полипептид FVII может быть введена непрерывная последовательность из 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40 или более аминокислот, или целый домен Gla, или гетерологичный домен Gla. Кроме того, введение домена Gla в полипептид FVII также может включать введение дополнительных аминокислот, не входящих в домен Gla гетерологично-го полипептида, если дополнительные аминокислоты значительно не ослабляют способность введенного домена Gla связывать фосфолипиды.
В некоторых примерах домен Gla вводят в полипептид FVII, причем гетерологичный домен Gla вставляют в эндогенный домен Gla или в другой район или домен полипептида FVII, если модифицированный полипептид FVII сохраняет по меньшей мере одну активность FVII. В таких примерах нативный домен Gla полипептида FVII сохраняется в полипептиде, хотя в некоторых случаях последовательность аминокислот, которая составляет нативный домен Gla, прерывается. В других примерах гетерологичный домен Gla или его достаточную часть вставляют в непосредственной близости от нативного домена Gla на N-конце или С-конце так, что нативный домен Gla не прерывается. В дополнительном примере гете-рологичный домен Gla или его достаточную часть вставляют в другой домен полипептида FVII. Кроме того, в настоящем документе предусмотрены полипептиды FVII с модифицированным доменом Gla, в которых весь эндогенный домен Gla из FVII или его непрерывную часть удаляют и заменяют на гетеро-логичный домен Gla или его достаточную для осуществления связывания фосфолипидов часть, если модифицированный полипептид FVII сохраняет хотя бы одну активность FVII. Такие модификации также называют заменой Gla. Примеры модификаций заменой Gla включают модификации, в которых эндогенный домен Gla заменен доменом Gla или частью домена Gla из FIX (SEQ ID NO: 83), FX (SEQ ID NO:
84), тромбина (SEQ ID NO: 85), белка С (SEQ ID NO: 86) и белка S (SEQ ID NO: 87). Такие модификации
называются "замена Gla из FIX", "замена Gla из FX", "замена Gla из тромбина", "замена Gla из белка С" и "замена Gla из белка S" соответственно. Такие модифицированные полипептиды FVII обладают повышенным связыванием с активированными тромбоцитами, в результате чего увеличивается их коагулянт-ная активность. Модификация "замена Gla из FIX" включает удаление эндогенного домена Gla из FVII, т.е. удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), и вставку 45 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y45 домена Gla из FIX, приведенного в SEQ ID NO: 83. Модификация "замена Gla из FX" включает удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), и вставку 44 аминокислотных остатков, которые соответствуют аминокислотным остаткам с А1 до Y44 домена Gla из FX, приведенного в SEQ ID NO: 84. Модификация "замена Gla из тромбина" включает удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и вставку 44 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y44 из Gla домена тромбина, приведенного в SEQ ID NO: 85. Модификация "замена Gla из белка С" включает удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и вставку 44 аминокислотных остатков, которые соответствуют аминокислотным остаткам с А1 до Н44 из домена Gla белка С, приведенного в SEQ ID NO: 86. Модификация "замена Gla из белка S" включает удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и вставку 44 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y44 из домена Gla белка S, приведенного в SEQ ID NO: 87. В некоторых примерах в гетерологичный домен Gla, который вводят в полипептид FVII, введены модификации, включая, но не ограничиваясь аминокислотными заменами или замещениями, вставками и/или удалениями. Такие модификации могут привести, например, к повышению связывания с активированными тромбоцитами из-за увеличения связывания с фосфолипидами по сравнению со связыванием, проявляемым гетерологичным доменом Gla дикого типа. Например, если Gla домен фактора IX или его связывающую фосфолипиды часть вводят в
полипептид FVII для создания модифицированного полипептида FVII, домен Gla фактора IX может содержать аминокислотные мутации, которые приводят к увеличенному связыванию фосфолипидов по сравнению с Gla доменом фактора IX дикого типа. Гетерологичный домен Gla, содержащийся в модифицированных полипептидах FVII по настоящему документу, может содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более модификаций, таких как аминокислотные замены или замещения, вставки и/или удаления.
В некоторых примерах модификация (модификации) в гетерологичном домене Gla увеличивают связывание фосфолипидов. В других примерах гетерологичный домен Gla может содержать одну или несколько мутаций по сравнению с гетерологичным доменом Gla дикого типа, которые придают гетеро-логичному домену Gla FVII-подобные функции. Например, как отмечалось выше, остаток R36 домена Gla фактора FVII, приведенного в SEQ ID NO: 119, может быть вовлечен во взаимодействие с FX. Следовательно, гетерологичный домен Gla может содержать дополнительные модификации, такие как модификации, необходимые для поддержания функции аргинина в положении 36 последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3, или любые другие модификации, необходимые для поддержания способности модифицированного полипептида FVIIa активировать FX (Ruf и др., (1999) Biochem 38:1957-1966). Таким образом, в некоторых примерах в гетерологичный домен Gla может быть введена соответствующая мутация R36. Соответствующее положение может быть определено специалистом в данной области, например, путем выравнивания аминокислотных последовательностей. В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие модификацию заменой Gla, где домен вводят в полипептид FVII путем замены некоторой части или всего эндогенного домена FVII Gla, где гетерологичный домен Gla или его связывающая фосфолипиды часть содержит одну или несколько мутаций по сравнению с гетерологичным доменом Gla дикого типа. В одном примере модифицированные полипептиды FVII, предусмотренные в настоящем документе, содержат модификацию "замена Gla из FIX", которая, как описано выше, включает в себя удаление эндогенного домена Gla фактора FVII, т.е. удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и вставку 45 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y45 в домене Gla белка FIX, приведенном в SEQ ID NO: 83. Домен Gla белка FIX, используемый для модификации заменой Gla, может содержать одну или несколько мутаций по сравнению с доменом Gla белка FIX дикого типа, приведенным в SEQ ID NO: 83, например, домен Gla может содержать 1, 2, 3, 4, 5 или более мутаций, таких как замены, удаления или вставки аминокислот. Например, гетерологичный домен Gla белка FIX в модифицированных "заменой Gla из FIX" полипептидах FVII может содержать одну или более аминокислотных замен в положениях, соответствующих положениям M19, Е40, K43 и/или Q44 в домене Gla белка
FIX, приведенном в SEQ ID NO: 83.
В одном примере домен Gla белка FIX содержит аминокислотную замену М19^ Такая модификация обозначается {замена Gla из FIX/M19K}, т.е. метионин в положении, соответствующем положению 19 в домене Gla белка FIX, приведенном в SEQ ID NO: 83, заменен на лизин. В другом примере модифицированный гетерологичный домен Gla белка FIX в модифицированном полипептиде FVII содержит аминокислотную замену E40L, что обозначается как {замена Gla из FIX/E40L}, т.е. остаток глутамино-вой кислоты в положении, соответствующем положению 40 в домене Gla белка FIX, приведенном в SEQ ID NO: 83, заменен на лейцин. Кроме того, в настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие замену K43I (обозначается {замена Gla из FIX/K43I}), где лизин в положении, соответствующем положению 43 в домене Gla белка FIX, приведенном в SEQ ID NO: 83, заменен на изолейцин. В другом примере модифицированный гетерологичный домен Gla белка FIX в модифицированном полипептиде FVII содержит аминокислотную замену Q44S, обозначаемую {замена Gla из FIX/Q44S}, где глутамин в положении, соответствующем положению 44 в домене Gla белка FIX, приведенном в SEQ ID NO: 83, заменен на серин. В одном примере гетерологичный домен Gla белка FIX содержит аминокислотные замены M19K/E40L/K43I/Q44S.
Модифицированные полипептиды FVII, содержащие гетерологичные домены Gla, такие как модифицированные гетерологичные домены Gla, могут обладать повышенной коагулянтной активностью при более низких дозах по сравнению с молекулой FVII дикого типа, такой как Novoseven(r), что обусловлено увеличенным связыванием и/или аффинностью к активированным тромбоцитам. Коагулянтная активность Gla-модифицированных полипептидов FVII может быть увеличена по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500% или более по сравнению с коагулянтной активностью немодифицированного полипептида FVII или полипептида FVII дикого типа in vivo, ex vivo или in vitro.
7. Комбинации и дополнительные модификации.
Любая одна или нескольких модификаций, описанных выше, могут быть объединены с любой другой модификацией (модификациями), описанными выше или описанными в уровне техники. Таким образом, в дополнение к модификациям полипептидов FVII для повышения устойчивости к АТ-III, увеличения каталитической активности, повышения устойчивости к ингибированию Zn, изменения гликозили-рования, улучшения фармакокинетических свойств, например увеличения периода полураспада, для увеличения связывания и/или аффинности к сывороточному альбумину, увеличения связывания и/или аф
финности к фосфолипидам или увеличения связывания и/или аффинности к интегрину тромбоцитов aIIbp3, модифицированные полипептиды FVII, предусмотренные в настоящем документе, также включают модификации, которые приводят более чем к одному из отмеченных выше свойств. Как правило, такие дополнительные модификации включают модификации, которые приводят к повышению коагулянт-ной активности модифицированного полипептида и/или повышению стабильности полипептида. Соответственно, полученные модифицированные полипептиды FVII проявляют повышенную коагулянтную активность. Дополнительные модификации могут включать, например, любую аминокислотную замену, удаление или вставку, известную в уровне техники, обычно, такая замена увеличивает коагулянтную активность и/или стабильность полипептида FVII. Любые модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более дополнительных модификаций аминокислот, если полученный модифицированный полипептид FVII сохраняет активность FVII дикого типа или активность немодифицированного полипептида FVII. В одном примере в последовательность полипептида FVII могут быть введены такие дополнительные модификации, что ее взаимодействия с другими факторами, молекулами и белками изменяются. Например, аминокислотные остатки, которые участвуют во взаимодействии с ингибитором пути тканевого фактора (TFPI) можно заменить такими остатками, что аффинность и/или связывание модифицированного полипептида FVII с ТФ уменьшится. Другие модификации включают, но не ограничиваются, модификациями аминокислот, которые участвуют во взаимодействии с фактором X, фактором IX, тканевым фактором (ТФ) и фосфолипидами.
В некоторых примерах, модификации, введенные в последовательность полипептида FVII, включают вставки аминокислот, которые образуют связывающие последовательности, такие как, например, связывающую сывороточный альбумин последовательность или связывающую гликопротеин IIb-IIIa последовательность.
В полипептиды FVII, предусмотренные в настоящем документе, также можно ввести дополнительные модификации, которые изменяют конформацию или фолдинг полипептида. К указанным модификациям относится, например, замена одной или нескольких аминокислот на цистеин, что приводит к образованию новой дисульфидной связи, или к ним относятся модификации, которые стабилизируют кон-формацию a-спирали, тем самым придавая повышенную активность модифицированному полипептиду FVII. Дополнительные модификации также могут быть введены для изменения посттрансляционных модификаций полипептида FVII. Например, полипептид может быть модифицирован введением дополнительных сайтов гликозилирования, что приводит к модифицированному полипептиду FVII с увеличенным гликозилированием по сравнению с немодифицированным полипептидом FVII. Также в полипептид могут быть введены модификации, например, введением аминокислотных остатков, которые могут быть впоследствии связаны с химическим фрагментом, который, например, увеличивает стабильность модифицированного полипептида FVII.
Стабильность полипептидов FVII также может быть изменена модификацией потенциальных про-теолитических сайтов, что увеличивает устойчивость модифицированных полипептидов FVII к протеа-зам.
Кроме того, для увеличения связывания и/или аффинности модифицированных полипептидов FVII к фосфолипидам мембран в эндогенный домен Gla могут быть введены аминокислотные замены, удаления или вставки. Такие модификации могут включать одну аминокислотную замену, удаление и/или вставку или могут включать замену, удаление или вставку нескольких аминокислот. Например, эндогенный домен Gla или его часть можно заменить на гетерологичный домен Gla или часть гетерологичного домена Gla. В других примерах модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут включать делеции или замены в эндогенном домене Gla в положениях, которые в нормальных условиях у-карбоксилируются (US 20070037746).
В следующих разделах описаны не ограничивающие примеры модификаций, описанных в уровне техники, которые повышают стабильность и/или коагулянтную активность полипептида FVII. Как уже говорилось выше, такие модификации также могут быть дополнительно включены в любой предусмотренный в настоящем документе модифицированный полипептид FVII. Аминокислотные позиции, приведенные ниже, соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. Соответствующие мутации могут быть введены и в другие полипептиды FVII, такие как аллельные, видовые варианты или варианты сплайсинга зрелого полипептида FVII, приведенного в SEQ ID NO: 3.
а. Модификации, повышающие устойчивость к TFPI.
В одном примере в модифицированный полипептид FVII, который содержит модификацию в положении 286 по нумерации зрелого FVII, могут быть введены дополнительные модификации, которые приводят к повышенной устойчивости к TFPI. Такая устойчивость к TFPI может быть достигнута, например, в результате мутирования одного или нескольких остатков в FVII, вовлеченных во взаимодействие и связывание TFPI, что уменьшит или предотвратит такое связывание, что приведет к модифицированным полипептидам FVII, устойчивым к естественному ингибиторному эффекту TFPI по отношению к инициации коагуляции. Например, модификации могут быть введены в аминокислотные остатки, вовлечен
ные в контакт FVII/TFPI, или в остатки, находящиеся в непосредственной близости от поверхности контакта.
Примеры дополнительных модификаций, которые могут быть введены в предусмотренные в настоящем документе модифицированные полипептиды FVII для повышения устойчивости к TFPI, включают, но не ограничиваются, модификации, описанные в WO 2004/083361, описанные Neuenschwander и др., (1995) Biochemistry 34: 8701-8707, Chang и др., (1999) Biochemistry 38: 10940-10948, Iakhiaev и др., (2001) Thromb. Haemost. 85:458-463 и описанные в близкой заявке США 12/082662. Не ограничивающие примеры описанных в уровне техники аминокислотных модификаций, которые могут привести к повышенной устойчивости модифицированного полипептида FVII к TFPI, включают одну или более модификаций из Q176, D196K, D196R, D196A, D196Y, D196F, D196W, D196L, D196I, K197Y, K197A, K197E, K197D, K197L, K197M, K197I, K197V, K197F, K197W, K199A, K199D, K199E, G237W, G237T, G237I, G237V, Т239А, R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, K341E, K341R, K341Q, K341N, K341M, K341D, G237Т238вставкаА, G237T238вставкаS, G237Т238вставкаV, G237T238вставкаAS, G237T238вставкаSA, D196К197вставкаK, D196K197вставкаR, D196К197вставкаY, D196К197вставкаW, D196K197вставкаА, D196К197вставкаМ, K197I198вставкаЕ, K197Il98вставкаY, K197I198вставкаА и K197I198вставкаS (где, например, G237T238вставкаAS обозначает модификацию, в которой аланин (А) и серин (S) были вставлены между глицином в положении 237 (G237) и треонином в положении 238).
b. Модификации, увеличивающие собственную активность.
В одном примере в модифицированный полипептид фактора VII, предусмотренный в настоящем документе, могут быть введены дополнительные модификации, которые могут привести к увеличению каталитической активности по отношению к фактору X. Например, могут быть модифицированы аминокислоты, которые участвуют во взаимодействии с кофактором ТФ, в результате чего полученный полипептид FVII обладает повышенной аффинностью к ТФ и проявляет повышенную активность по отношению к FX. Также могут быть введены модификации в активационный карман полипептида FVII, так что собственная активность модифицированного полипептида FVII к FX увеличивается по сравнению с активностью немодифицированного полипептида. Другая стратегия модификации, которая приводит к увеличению активности, предполагает введение модификаций в полипептид FVII, которые изменяют фолдинг и конформацию белка в более активную форму. Например, могут быть введены такие аминокислотные замены, что район с a-спиралью и петлей (соответствующий положениям с 305 до 321 зрелой последовательности, приведенной в SEQ ID NO: 3) протеазного домена стабилизируется и более плотно укладывается с протеазным доменом, что придает более зимогенподобную форму модифицированному полипептиду FVII. Более активный полипептид также может быть получен модификацией аминокислот, содержащихся в p-тяжах полипептида FVII. Например, могут быть введены аминокислотные замены для введения новых цистеиновых пар, которые могут образовывать новые дисульфидные связи, фиксирующие модифицированный полипептид FVII в более активной форме.
Примеры дополнительных модификаций, которые могут быть введены в предусмотренные в настоящем документе модифицированные полипептиды FVII для увеличения собственной активности модифицированных полипептидов FVII, включают, но не ограничиваются модификациями, описанными Persson и др., (2004) Biochem J. 379:497-503, Maun и др., (2005) Prot Sci 14:1171-1180, Persson и др., (2001) PNAS 98:13583-13588, Persson и др., (2002) Eur. J. Biochem. 269:5950-5955, Soejima и др., (2001) J. Biol. Chem. 276:17229-17235, Soejima и др., (2002) J. Biol. Chem. 277:49027-49035, WO 200183725, WO
2002022776, WO 2002038162, WO 2003027147, WO 200338162, WO 2004029090, WO 2004029091, WO
2004108763 и WO 2004111242. He ограничивающие примеры описанных в уровне техники аминокислотных модификаций, которые могут привести к увеличению собственной активности модифицированного полипептида FVII, включают одну или более модификаций из S279C/V302C, L280C/N301C,
V281C/V302C, S282C/V299C, S314E, L39E, L39Q, L39H, I42R, S43Q, S53N, K62E, K62R, K62D, K62N,
K62Q, K62T, L65Q, L65S, F71D, F71Y, F71E, F71Q, F71N, P74S, Р74А, А75Е, A75D, Е77А, E82Q, E82N, T83K, E116D, K157V, K157L, K157I, K157M, K157F, K157W, K157P, K157G, K157S, K157T, K157C,
K157Y, K157N, K157E, K157R, K157H, K157D, K157Q, V158L, V158I, V158M, V158F, V158W, V158P, V158G, V158S , V158T, V158C, V158Y, V158N, V158E, V158R, V158K, V158H, V158D, V158Q, А274М, A274L, A274K, A274R, A274D, A274V, A274I, A274F, A274W, А274Р, A274G, А274Т, А274С, A274Y, A274N , А274Е, А274Н, A274S, A274Q, F275H, E296V, E296L, E296I, Е296М, E296F, E296W, Е296Р, E296G, E296S, Е296Т, Е296С, E296Y, E296N, E296K, E296R, Е296Н, E296D, E296Q, M298Q, M298V, M298L, M298I, M298F, M298W, М298Р, M298G, M298S, М298Т, М298С, M298Y, M298N, M298K, M298R, М298Н, М298Е, M298D, R304Y, R304F, R304L, R304M, L305V, L305Y, L305I, L305F, L305A, L305M, L305W, L305P, L305G, L305S, L305T, L305C, L305N, L305E, L305K, L305R, L305H, L305D, L305Q, M306D, M306N, D309S, D309T, S314A, S314V, S3141, S314M, S314F, S314W, S314P, S314G, S314L, S314T, S314C, S314Y, S314N, S314E, S314K, S314R, S314H, S314D, S314Q, D334G, D334E, D334A, D334V, D334I, D334M, D334F, D334W, D334P, D334L, D334T, D334C, D334Y, D334N, D334K, D334R, D334H, D334S, D334Q, S336G, S336E, S336A, S336V, S336I, S336M, S336F, S336W, S336P,
S336L, S336T, S336C, S336Y, S336N, S336K, S336R, S336H, S336D, S336Q, K337L, K337V, K337I, K337M, K337F, K337W, K337P, K337G, K337S, K337T, K337C, K337Y, K337N, K337E, K337R, K337H, K337D, K337Q, F374P, F374A, F374V, F374I, F374L, F374M, F374W, F374G, F374S, F374T, F374C,
F374Y, F374N, F374E, F374K, F374R, F374H, F374D, F374Q, а также замену положений 300-322, 305-322, 300-312, или 305-312 соответствующими аминокислотами из трипсина, тромбина или FX и замену положений 310-329, 311-322 или 233-329 соответствующими аминокислотами из трипсина.
c. Модификации, повышающие устойчивость к протеазам.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также могут содержать дополнительные модификации, которые приводят к увеличению устойчивости полипептида к протеазам. Например, в белок могут быть введены аминокислотные замены, которые приводят к удалению одного или нескольких потенциальных сайтов протеолитического расщепления. Таким образом, модифицированный полипептид FVII можно сделать более устойчивым к протеазам, увеличивая тем самым стабильность и период полураспада модифицированного полипептида.
Примеры дополнительных модификаций, которые могут быть введены в предусмотренный в настоящем документе модифицированный полипептид FVII для повышения устойчивости к протеазам, включают, но не ограничиваются модификациями, описанными патенте США US5580560 или заявках WO 1988010295 и WO 2002038162. Не ограничивающие примеры описанных в уровне техники модификаций включают модификации, которые могут привести к увеличению устойчивости модифицированного полипептида FVII к ингибиторам и/или протеазам, и включают одну или более модификаций из K32Q,
K32E, K32G, K32H, K32T, K32A, K32S, K38T, K38D, K38L, K38G, K38A, K38S, K38N, K38H, I42N, I42S, I42A, I42Q, Y44N, Y44S, Y44A, Y44Q, F278S, F278A, F278N, F278Q, F278G, R290G, R290A, R290S,
R290T, R290K, R304G, R304T, R304A, R304S, R304N, R315G, R315A, R315S, R315T, R315Q, Y332S, Y332A, Y332N, Y332Q, Y332G, K341E, K341Q, K341G, K341T, K341A и K341S.
d. Модификации, повышающие аффинность к фосфолипидам.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также могут содержать одну или несколько дополнительных модификаций для увеличения аффинности к фосфолипи-дам.
Коагулянтная активность FVII может быть повышена за счет увеличения связывания и/или аффинности полипептида к фосфолипидам, таким как экспонированные на поверхности активированных тромбоцитов фосфолипиды. Это может быть достигнуто, например, модификацией эндогенного домена Gla белка FVII.
Модификация может быть осуществлена аминокислотной заменой по одной или нескольким позициям в домене Gla полипептида FVII, в результате чего модифицированный полипептид FVII приобретает повышенную способность связывать фосфатидилсерин и другие отрицательно заряженные фосфоли-пиды. Примеры дополнительных модификаций для увеличения связывания и/или аффинности к фосфо-липидам, которые могут быть введены в модифицированный полипептид FVII, предусмотренный в настоящем документе и содержащий эндогенный домен Gla, включают, но не ограничиваются, модификации, описанные Harvey и др., (2003) J. Biol. Chem. 278:8363-8369, US 20030100506, US 20040220106, US 20060240526, US 6017882, US 6693075, US 6762286, WO 200393465 и WO 2004111242. Примеры таких модификаций включают одну или несколько модификаций, выбранных из вставки тирозина в положение 4 или одной или нескольких из модификаций P10Q, Р10Е, P10D, P10N, R28F, R28E, K32E, K32D, D33F, D33E, D33K А34Е, A34D, A34I, A34L, А34М, A34V, A34F, A34W, A34Y, R36D, R36E, K38E и K38D.
e. Модификации, изменяющие гликозилирование.
Модификация степени, уровня и/или типа гликозилирования белка описаны в уровне техники как средство уменьшения иммуногенности, повышения стабильности белка, средство для уменьшения частоты введения и/или уменьшения неблагоприятных побочных эффектов, таких как воспаление. Как правило, указанные цели достигают путем увеличения уровня гликозилирования. Сайт гликозилирования представляет собой место прикрепления углеводного фрагмента к полипептиду, такое, что при продукции полипептида в эукариотических клетках, способных к гликозилированию, оно гликозилируется.
В FVII присутствуют четыре нативных сайта гликозилирования, два сайта N-гликозилирования, N145 и N322, и два сайта О-гликозилирования, S52 и S60, согласно положениям в последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3. В одном варианте в предусмотренный в настоящем документе модифицированный полипептид FVII могут быть введены дополнительные модификации, приводящие к нарушению гликозилирования этих сайтов. Это может привести к модифицированному полипептиду FVII с повышенной коагулянтной активностью (см., например, WO 2005123916). Не ограничивающие примеры описанных в уровне техники модификаций, которые могут привести к снижению гликозилирования и повышению активности модифицированных полипептидом FVII по сравнению с немодифицированным полипептидом FVII, включают, но не ограничиваются, S52A, S60A, N145Y, N145G, N145F, N145M, N145S, N145I, N145L, N145T, N145V, N145P, N145K, N145H, N145Q, N145E, N145R, N145W, N145D, N145C, N322Y, N322G, N322F, N322M, N322S, N322I, N322L, N322T, N322V, N322P, N322K, N322H, N322Q, N322E, N322R, N322W и N322C.
В другом варианте в аминокислотную последовательность модифицированного полипептида FVII,
предусмотренного в настоящем документе, могут быть введены дополнительные модификации, такие как введение дополнительных сайтов гликозилирования, что повышает уровень гликозилирования модифицированного полипептида FVII по сравнению с немодифицированным полипептидом FVII. Сайт гликозилирования может представлять собой сайт N-гликозилирования или сайт О-гликозилирования. Примеры модификаций, которые могут быть введены в полипептид FVII для создания одного или нескольких новых сайтов гликозилирования включают, но не ограничиваются, модификации, которые описаны в US 6806063 и WO 200393465. Не ограничивающие примеры описанных в уровне техники модификаций, которые могут привести к увеличению гликозилирования модифицированного полипептида FVII по сравнению с немодифицированным полипептидом FVII, включают, но не ограничиваются, F4S, F4T, P10N, Q21N, W41N, S43N, A51N, G58N, L65N, G59S, G59T, E82S, Е82Т, N95S, N95T, G97S, G97T, Y101N, D104N, T106N, K109N, G117N, G124N, S126N, T128N, A175S, А175Т, G179N, I186S, I186T, V188N, R202S, R202T, I205S, I205T, D212N, E220N, I230N, P231N, P236N, G237N, V253N, E265N,
T267N, E270N, R277N, L280N, G291N, P303S, P303ST, L305N, Q312N, G318N, G331N, D334N, K337N, G342N , H348N, R353N, Y357N, I361N, V376N, R379N, M391N, K32N/A34S, K32N/A34T, F31N/D33S, F31N/D33T, I30N/K32S, I30N/K32T, A34N/R36S, A34N/R36T, K38N/F40S , K38N/F40T, T37N/L39S, T37N/L39T, R36N/K38S, R36N/K38T, L39N/W41S, L39N/W41T, F40N/I42S, F40N/I42T, I42N/Y44S, I42N/Y44T, Y44N/D46S, Y44N/D46T, D46N/D48S, D46N/D48T, G47N/Q49S, G47N/Q49T, S52N/P54S, Q66N/Y68S, S119N/L121S, A122N/G124S, T128N/P129A, T130N/E132S, K143N/N145S, K143N/N145T, E142N/R144S, E142N/R144T, L141N/K143S, L141N/K143T, I140N/E142S/, I140N/E142T, R144N/A146S, R144N/A146T, A146N/K148S, A146N/K148T, S147N/P149S/, S147N/P149T, R290N/A292S, R290N/A292T, A292N/A294S, D289N/G291S, D289N/G291T, L288N/R290S, L288N/R290T, L287N/D289S, L287N/D289T, A292N/A294S, A292N/A294T, T293N/L295S, T293N/L295T, R315N/V317S, R315N/V317T, S314N/K316S, S314N/K316T, Q313N/R315S, Q313N/R315T, K316N/G318S, K316N/G318T, V317N/D319S, V317N/D319T, K341N/D343S, K341N/D343T, S339N/K341S, S339N/K341T, D343N/G345S, D343N/G345T, R392N/E394S, R392N/E394T, L390N/R392S, L390N/R392T, K389N/M391S, K389N/M391T, S393N/P395S, S393N/P395T, E394N/R396S, E394N/R396T, E394N/P395A/R396S, P395N/P397S, P395N/P397T, R396N/G398S, R396N/G398T, P397N/V399S, P397N/V399T, G398N/L400S, G398N/L400T, V399N/L401S, V399N/L401T, L400N/R402S, L400N/R402T, L401N/A403S, L401N/A403T, R402N/P404S, R402N/P404T, A403N/F405S,
A403N/F405T, P404N/P406S и P404N/P406T.
f. Модификации, содействующие связыванию химических групп.
В предусмотренный в настоящем документе модифицированный полипептид FVII также можно ввести дополнительные модификации, содействующие последующему связыванию химических групп. В полипептид могут быть введены одна или несколько аминокислотных замен или вставок, вследствие чего химические группы могут быть связаны с модифицированным полипептидом FVII через замещенные аминокислоты. Например, в модифицированный полипептид FVII может быть введен цистеин, к которому для повышения стабильности и периода полураспада в сыворотке может быть присоединен фрагмент полиэтиленгликоля (ПЭГ). Другие остатки, по которым может быть осуществлено присоединение химических групп, включают лизин, аспарагиновую кислоту и глутаминовую кислоту. В некоторых вариантах аминокислотные остатки заменяют для уменьшения числа потенциальных сайтов присоединения групп. Например, может быть уменьшено количество лизина. Примеры модификаций, которые могут быть введены в аминокислотную последовательность полипептида FVII и которые могут способствовать последующему связыванию химических групп, включают, но не ограничиваются, модификации, описанные в US 20030096338, US 20060019336, US 6806063, WO 200158935 и WO 2002077218. Не ограничивающие примеры модификаций полипептидов FVII, которые могут способствовать последующему связыванию
химических групп, включают, но не ограничиваются, Q250C, R396C, Р406С, I42K, Y44K, L288K, D289K,
R290K, G291K, A292K, T293K, Q313K, S314K, R315K, V317K, L390K, M391K, R392K, S393K, E394K, P395K, R396K, P397K, G398K, V399K, L400K, L401K, R402K, A403K, P404K, F405K, I30C, K32C, D33C, А34С, Т37С, K38C, W41C, Y44C, S45C, D46C, L141C, Е142С, K143C, R144C, L288C, D289C, R290C, G291C, А292С, S314C, R315C, K316C, V317C, L390C, М391С, R392C, S393C, Е394С, Р395С, R396C,
Р397С, G398C, V399C, L401C, R402C, А403С, Р404С, I30D, K32D, A34D, T37D, K38D, W41D, Y44D, S45D, D46C, L141D, E142D, K143D, R144D, L288D, R290D, G291D, A292D, Q313D, S314D, R315D, K316D, V317D, L390D, M391D, R392D, S393D, P395D, R396D, P397D, G398D, V399D, L401D, R402D, A403D, P404D, 130Е, K32E, А34Е, Т37Е, K38E, W41E, Y44E, S45E, D46C, L141E, Е142Е, K143E, R144E, L288E, R290E, G291E, А292Е, Q313E, S314E, R315E, K316E, V317E, L390E, М391Е, R392E, S393E, Р395Е, R396E, Р397Е, G398E, V399E, L401E, R402E, А403Е, Р404Е, K18R, K32R, K38R, K62R, K85R, K109R, K137R, K143R, K148R, K157R, K161R, K197R, K199R, K316R, K337R, K341R, K389R, K18Q, K32Q, K38Q, K62Q, K85Q, K109Q, K137Q, K143Q, K148Q, K157Q, K161Q, K197Q, K199Q, K316Q, K337Q, K341Q, K389Q, K18N, K32N, K38N, K62N, K85N, K109N, K137N, K143N, K148N, K157N,
K161N, K197N, K199N, K316N, K337N, K341N, K389N, K18H, К32Н, K38H, K62H, K85H, K109H, K137H, K143H, K148H, K157H, K161H, K197H, K199H, K316H, K337H, K341H и K389H.
g. Примеры комбинаций мутаций.
В настоящем документе предусмотрены модифицированные полипептиды FVII, включающие две
или более модификаций, которые должны влиять на одно или более свойств или активностей немодифи-цированного полипептида FVII. В некоторых примерах две или более модификации изменяют два или более свойств или активностей полипептида FVII. В полипептиды FVII могут быть введены модификации, изменяющие одно или несколько свойств, выбранных из каталитической активности, устойчивости к АТ-III, устойчивости к TFPI, устойчивости к ингибированию Zn2+, собственной активности, амидоли-тической активности, связывания и/или аффинности к фосфолипидам, гликозилирования, устойчивости к протеазам, периода полураспада и взаимодействия с другими факторами или молекулами, такими как FX, FIX, сывороточный альбумин и интегрин тромбоцитов aIIbp3. Как правило, две или более модификаций комбинируют таким образом, что полученный модифицированный полипептид FVII проявляет увеличенную коагулянтную активность, увеличенную продолжительность коагулянтной активности и/или увеличенный терапевтический индекс по сравнению с немодифицированным полипептидом FVII. Модификации могут включать аминокислотные замены, вставки или удаления. Увеличенная коагулянтная активность, увеличенная продолжительность коагулянтной активности и/или увеличенный терапевтический индекс модифицированного полипептида FVII, содержащего две или более модификаций, могут быть увеличены по меньшей мере приблизительно на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500% или более по сравнению с активностью начального или немодифицированного полипептида FVIIa.
В настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие две или более модификаций, которые вводят в немодифицированный полипептид FVII для изменения двух или более видов активности или свойств. Модифицированные полипептиды FVII могут содержать 2, 3, 4, 5, 6 или более модификаций. Кроме того, каждая модификация может затрагивать один или более аминокислотных остатков. Например, модифицированный полипептид FVII может содержать две модификации, каждая из которых представляет собой замену одной аминокислоты. В другом примере модифицированный полипептид FVII может содержать две модификации, одна из которых представляет собой замену одной аминокислоты, а другая модификация представляет собой удаление более чем одного аминокислотного остатка и последующую вставку более чем одного аминокислотного остатка. Например, модифицированный полипептид FVII, предусмотренный в настоящем документе, может включать замену аминокислоты S222A (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), нарушающую связывание Zn2+, и модификацию заменой Gla из FIX, которая включает удаление эндогенного домена Gla белка FVII, т.е. удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и вставку 45 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y45 домена Gla из FIX, приведенного в SEQ ID NO: 83.
В одном примере модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут включать две или более модификаций, выбранных исключительно из модификаций, приведенных в табл. с 5 до 13. В других примерах модифицированные полипептиды FVII содержат две или более модификаций, где одна или более модификаций выбраны из приведенных в табл. с 5 до 13 модификаций, а одна или нескольких модификаций представляют собой дополнительные модификации, не указанные в табл. с 5 до 13, например, модификации, описанные в уровне техники. В некоторых примерах одна или несколько дополнительных модификаций могут быть выбраны из модификаций, приведенных в разделах D.6.a-e выше. Например, модифицированные полипептиды FVII могут содержать модификации одного или нескольких аминокислотных остатков из D196, K197, K199, G237, Т239, R290 или K341 по нумерации зрелого FVII, приведенного в SEQ ID NO:3 (соответствуют D60, K60a, K60c, G97, Т99, R147 и K192, соответственно, по нумерации химотрипсина), что может повысить устойчивость к TFPI, и модификации одного или нескольких аминокислотных остатков, которые влияют на собственную активность, например остатков V158 и М298 (V21 и М156, соответственно, по нумерации химотрипсина). Например, модифицированный полипептид FVII может содержать две аминокислотные замены, которые повышают устойчивость к TFPI, такие как K197E и G237V, и одну аминокислотную замену, которая увеличивает собственную активность, такую как M298Q, что приводит к полипептиду FVII с повышенной коагулянт-ной активностью.
Примеры комбинаций модификаций, предусмотренных в настоящем документе, представляют собой комбинации, которые включают мутацию Q286R (нумерация соответствует последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3; соответствует Q143R по нумерации химотрипси-на). Модифицированные полипептиды FVII, содержащие модификацию Q286R, могут содержать 1, 2, 3, 4, 5, 6 или более дополнительных модификаций. Эти дополнительные модификации могут быть включены, например, для изменения каталитической активности, устойчивости к АТ-III, устойчивости к TFPI, устойчивости к ингибированию Zn2+, собственной активности, амидолитической активности, связывания и/или аффинности к фосфолипидам, гликозилирования, устойчивости к протеазам, периода полураспада и взаимодействия с другими факторами или молекулами, такими как FX, FIX, сывороточный альбумин и интегрин тромбоцитов aIIbp3. Обычно модифицированные полипептиды FVII, предусмотренные в настоящем документе, содержащие две или более модификаций, одна из которых представляет собой ами
нокислотную замену Q286R, обладают повышенной коагулянтной активностью по сравнению с полипептидом FVII дикого типа.
В некоторых примерах модифицированные полипептиды FVII, содержащие две или более модификаций, из которых одна представляет собой Q286R, обладают повышенной каталитической активностью и коагулянтной активностью по сравнению с полипептидом дикого типа, а также по сравнению с полипептидом FVII, содержащим любую из мутаций по отдельности. Например, в настоящем документе предусмотрены модифицированные полипептиды FVII, содержащие обе аминокислотные замены Q286R и M289Q (Q286R/M298Q по нумерации зрелого полипептида FVII, приведенного в SEQ ID NO: 3; соответствует Q143R/M156Q по нумерации химотрипсина). FVII с комбинацией мутаций Q286R/M298Q проявляет увеличенную каталитическую активность по отношению к его субстрату, фактору X, по сравнению с FVII дикого типа, по сравнению с FVII с одной мутацией Q286R и FVII с одной мутацией M298Q (см. пример 4 ниже). Например, мутант M298Q в присутствии ТФ проявлял по отношению к FX каталитическую активность, которая была в 1,8-2 раза выше, чем активность полипептида дикого типа, каталитическая активность мутанта Q286R была приблизительно в 2,1 раза выше, чем активность полипептида FVII дикого типа, а мутант Q286R/M298Q проявлял по отношению к FX каталитическую активность, которая была приблизительно в 3,6-4,4 раза выше, чем каталитическая активность полипептида дикого типа по отношению к FX (см. табл. 15 ниже). Не ограничивающие примеры комбинаций модификаций приведены в табл. 12.
Примеры комбинаций модификаций включают две и более модификаций, которые предназначены для изменения двух или более видов активности или свойств полипептида FVII, включая, но не ограничиваясь, устойчивость к TFPI, устойчивость к АТ-III, собственную активность, амидолитическую активность, каталитическую активность, связывание Zn2+, связывание и/или аффинность к фосфолипидам, гликозилированием, устойчивостью к протеазам, периодом полураспада и взаимодействием с другими факторами или молекулами, такими как FX и FIX. Модифицированные полипептиды FVII, содержащие такие комбинации модификаций, могут проявлять увеличенную коагулянтную активность, увеличенную продолжительность коагулянтной активности и/или увеличенный терапевтический индекс. При описании модификаций, приведенных в табл. 12 ниже, используют ту же номенклатуру и системы нумерации, что и в табл. 5-11 выше. Например, модификация "замена Gla из FIX" включает удаление эндогенного домена Gla из FVII, т.е. удаление аминокислотных остатков с А1 до Y44 (остатки соответствуют последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3), и вставку 45 аминокислотных остатков, которые соответствуют аминокислотным остаткам с Y1 до Y45 домена Gla белка FIX, приведенного в SEQ ID NO: 83, как описано выше. В некоторых примерах модификация "замена Gla из FIX" также подразумевает наличие одной или нескольких аминокислотных замен в домене Gla из FIX по сравнению с доменом Gla из FIX дикого типа, как описано выше. Например, модификация "замена Gla из FIX" также может включает аминокислотную замену M19K (нумерация соответствует последовательности домена Gla из FIX, приведенной в SEQ ID NO: 83). Такая модификация обозначается {замена Gla из FIX/M19K}, т.е. модифицированный полипептид FVII содержит гетерологичный домен Gla из FIX, в котором метионин в положении, соответствующем положению 19 в домене Gla из FIX, приведенном в SEQ ID NO: 83, заменен на лизин. Таким образом, модификации, введенные в гетерологичные части домена Gla из FIX, приведены с указанием аминокислотных положений, соответствующих аминокислотным положениям последовательности зрелого полипептида FIX дикого типа или последовательности домена Gla из FIX дикого типа, приведенного в SEQ ID NO: 83. Модификации, введенные в аминокислотные позиции в полипептиде FVII, приводят с указанием аминокислотных позиций, соответствующих аминокислотным позициям в зрелом полипептиде FVII, приведенном в SEQ ID NO: 3, а также обозначают по нумерации химотрипсина. Например, модифицированные полипептиды FVII, содержащие модификацию Q286R (нумерация соответствует последовательности зрелого полипептида FVII, приведенной в SEQ ID NO: 3) и замену домена Gla из FIX, где домен Gla из FIX содержит аминокислотную замену M19K (нумерация соответствует аминокислотным позициям в домене Gla из FIX, приведенном в SEQ ID NO: 83), обозначают как {замена Gla из FIX/M19K}/Q286R. Аналогично, модификация {замена Gla из FIX/Q44S}/Q286R/M298Q означает, что полипептид FVII содержит модификацию "замена Gla из FIX", где глутамин в положении, соответствующем положению 44 в домене Gla из FIX, приведенном в SEQ ID NO: 83, заменен на серин, а полипептид также содержит аминокислотные замены Q286R и M298Q по нумерации зрелого полипептида FVII, приведенного в SEQ ID NO: 3. В табл. 12 ниже приведены номера по идентификатору последовательностей (SEQ ID NO), в котором приведены примера аминокислотных последовательностей модифицированных полипептидов FVII.
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
Замена Gla из FIX/Q286R
Замена Gla из FIX/Q143R
131
Q286R/H257A
H117A/Q143R
132
S222A/Q286R
S82A/Q143R
133
Q286R/S222A/H257A
S82A/H117A/Q143R
134
Замена Gla из FIX /S222A/Q286R
S82А/Замена Gla из FIX/Q143R
135
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
Замена Gla из FIX /H257A/Q286R
HI 17А/Замена Gla из FIX/Q143R
136
Замена Gla из FIX /S222A/H257A/Q286R
Q143R/S82A/H117А/Замена Gla из FIX
137
Q286R/M298Q
Q143R/M156Q
138
0286R/M298Q/K341Q
Q143R/M156Q/K192Q
139
K199E/Q286R/M298Q
K60cE/Q143R/M156Q
140
Замена Gla из FIX /Q286R/M298Q
Замена Gla из FIX/Q143R/M156Q
141
0286R/Q366V
Q143R/Q217V
142
Q286R/A292N/A294S/Q366V
Q143R/A150N/A152S/Q217V
143
A175S/Q286R/Q366V
A39S/Q143R/Q217V
144
S222A/Q286R/Q366V
S82A/Q143R/0217V
145
H257S/Q286R
H117S/Q143R
146
H257S/Q286R/Q366V
H117S/Q143R/Q217V
147
S222A/H257A/Q286R/Q366V
S82A/H117 A/Q 143R/Q217V
148
Q286R/H373A
0143R/H224A
149
S222A/H257A/Q286R/M298Q
S82A/H117A/Q143R/M156Q
150
Q286R/K341D
Q143R/K192D
151
Q286R/Q366D
0143R/Q217D
152
Q286R/Q366N
Q143R/Q217N
153
Q286R/M298Q/Q366D
Q143R/M156Q/Q217D
154
Q286R/M298Q/0366N
Q143R/M156Q/Q217N
155
Q286R/H373F
Q143R/H224F
156
Q286R/M298Q/H373F
Q143R/M156Q/H224F
157
Замена Gla из FIX/S222A
Замена Gla из FIX/S82A
245
Замена Gla из FIX/H257A
Замена Gla из FIX/HI 17А
246
Замена Gla из FIX/S222A/H257A
Замена Gla из FIX/S82A/H117А
247
Таблица 12
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
S222A/M298Q
S82A/M156Q
248
H257A/M298Q
HU7A/M156Q
249
S222A/H257A/M298Q
S82A/H117A/M156Q
250
S222A/A292N/A294S/Q366V
S82A/A150N/A152S/Q217V
251
A175S/S222A/Q366V
A39S/S82A/Q217V
252
S222A/Q366V
S82A/Q217V
253
H257S/Q366V
H117S/Q217V
254
S222A/H373A
S82A/H224A
255
V158T/L287T/M298K
V21T/L144T/M156K
256
V158D/L287T/M298K
V21D/L144T/M156K
257
SI 03 SI 11удаление/вставка1ЕВ1СЬР11 WGCLWE/G237V
S[103]S[111]удаление/вставка1ЕВ1СЬ PRWGCLWE/G97V
258
SI 03 SI 11удаление/вставка01СЬР1Ш GCL WED/G237V
S[103]S[111]удаление/вставкаВ1СЬР RWGCLWED/G97V
259
H115 S126удаление/вставкаС)11ЬМЕВ ICLPRWGCL WEDDF/G23 7V
Н [ 115] S [ 126]удаление/вставкаС^ЬМ EDICLPRWGCLWEDDF/G97V
260
H115 S126удаление/вставка1ЕБ1СЬРК WGCL WE/G237V
Н[115]8[126]удаление/вставка1ЕБ1С LPRWGCLWE/G97V
261
H115 S126удаление/вставкаБ1СЬРК\У GCLWED/G23 7V
Н[115]8[126]удаление/вставкаВ1СЬР RWGCLWED/G97V
262
T128P134удаление/вставкадКЬМЕ01 CLPRWGCL WEDDF/G237V
T[128]P[134]yдaлeниe/вcтaвкaQRLM EDICLPRWGCLWEDDF/G97V
263
Т128Р134удаление/вставка1Е01СЬРК WGCLWE/G237V
Т[128]Р[134]удаление/вставка1Е01СЬ PRWGCLWE/G97V
264
S103S111 удаление/BCTaBKaQRLMEDI CLPRWGCLWEDDF/G237V
S[103]S[11 ^удаление/BCTaBKaQRLM EDICLPRWGCLWEDDF/G97V
265
Т128Р134удаление/вставкаВ1СЬРЯ\? GCLWED/G237V
Т[ 128]Р[ 134]DICLPRWGCLWED/G9 7V
266
S103S111 удаление/BCTaBKaSFGRGDI RNV/G237V
S[103]S[11 l]yn^eHHe/BcraBKaSFGRG DIRNV/G97V
267
Н115 S126yflЈmeHHe/BCTaBKaSFGRGDI RNV/G237V
H[l 15]S[126]yдaлeниe/вcтaвкaSFGR GDIRNV/G97V
268
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
T128P134yzianeHHe/BCTaBKaSFGRGDI RNV/G237V
Т[128]Р[134] удаление/BCTaeicaSFGRG DIRNV/G97V
269
M298Q/H373F
M156Q/H224F
270
S119N/L121S/A175S
S[119]N/L[121]S/A39S
271
T128N/P129A/A175S
T[128]N/P[129]A/A39S
272
A122N/G124S/A175S
A[122]N/G[124]S/A39S
273
{Замена Gla из FIX /E40L}/Q286R/M298Q
{Замена Gla из FIX /E[40]L}/Q143R/M156Q
274
{Замена Gla из FIX /K43I}/Q286R/M298Q
{Замена Gla из FIX /K[43]I}/Q143R/M156Q
275
{Замена Gla из FIX /Q44S}/Q286R/M298Q
{Замена Gla из FIX /Q[44]S}/Q143R/M156Q
276
{Замена Gla из FIX /M19K}/Q286R/M298Q
{Замена Gla из FIX /M[19]K}/Q143R/M156Q
277
{Замена Gla из FIX /M19K/E40L/K43I /Q44S}/Q286R/M298Q
{Замена Gla из FIX/M[19]K/E[40]L/K [43]I/Q[44]S}/Q143R/M156Q
278
T128N/P129A/Q286R
T[128]N/P[129]A/Q143R
279
T128N/P129 A/Q286R/M298Q
T[ 128]N/P [ 129] A/Q 143R/M15 6Q
280
T128N/P129A/Q286R/H373F
T[ 128]N/P[ 129] A/Q 143R/H224F
281
V158D/Q286R/E296V/M298Q
V21 D/Q 143 R/E 154 V/M 156Q
282
Tl 28N/P129A/V158D/E296V/M298Q
T[128]N/P[129]A/V21D/E154V/ M156Q
283
T128N/P129A/S222A
T[128]N/P[129]A/S82A
284
Замена Gla из FIX/128N/P129A/S22 2A/Q286R
Замена Gla из FIX/T[128]N/P[129]A /S82A/Q143R
285
Замена Gla из FIX/T128N/P129A/Q28 6R/M298Q
Замена Gla из FIX/T[128]N/P[129]A /Q143R/M156Q
286
Tl 28N/P129 A/S222A/H257A/Q286R /M298Q
T[128]N/P[129]A/S82A/H117A/Q143R /M156Q
287
T128N/P129A/Q286R/M298Q/H373F
T[128]N/P[129]A/Q143R/M156Q/ H224F
288
S52A/S60A/V158D/E296V/M298Q
S[52]A/S[60]A/V21D/E154V/M156Q
289
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
S52A/S60A/Q286R
S[52]A/S[60]A/Q143R
290
S52A/S60A/S222A
S[52]A/S[60]A/S82A
291
Замена Gla из FLX/S52A/S60A/S222A /Q286R
Замена Gla из FIX/S[52]A/S[60]A/S82 A/Q143R
292
S52A/S60A/Q286R/M298Q
S[52]A/S[60]A/Q143R/M156Q
293
Замена Gla из FIX/S52A/S60A/Q286R /M298Q
Замена Gla из FLX/S[52]A/S[60]A/Q14 3R/M156Q
294
S52A/S60A/S222A/H257A/Q286R/ M298Q
S[52]A/S[60]A/S82A/H117A/Q143R/ M156Q
298
S52A/S60A/Q286R/H373F
S[52]A/S[60]A/Q143R/H224F
296
S52A/S60A/Q286R/M298Q/H373F
S[52]A/S[60]A/Q143R/M156Q/H224F
297
V158D/T239V/E296V/M298Q
V21D/T99V/E154V/M156Q
298
T239V/Q286R
T99V/Q143R
299
S222A/T239V
S82A/T99V
300
Замена Gla из FIX /S222A/T239V/Q286R
Замена Gla из FIX /S82A/T99V/Q143R
301
T239V/Q286R/M298Q
T99V/Q143R/M156Q
302
S222A/T239V/H257A/Q286R/M298Q
S82A/T99V/H117A/Q143R/M156Q
303
Замена Gla из FIX /T239V/Q286R/ M298Q
Замена Gla из FIX/T99V/Q143R/ M156Q
304
T239V/Q286R/H373F
T99V/Q143R/H224F
305
T239V/Q286R/M298Q/H373F
T99V/Q143R/M156Q/H224F
306
V158D/T239I/E296V/M298Q
V21D/T99I/E154 V/M 15 6Q
307
T239I/Q286R
T99I/Q143R
308
S222A/T239I
S82A/T99I
309
Замена Gla из FIX/S222A/T239I/Q28 6R
Замена Gla из FIX/S82A/T99I/Q143R
310
T239I/Q286R/M298Q
T99I/Q143R/M156Q
311
S222A/T239I/H257A/Q286R/M298Q
S82A/T99I/H117A/Q143R/M156Q
312
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
Замена Gla из FIX/T239I/Q286R/M298Q
Замена Gla H3FIX/T99I/Q143R/M15 6Q
313
T239I/Q286R/H373F
T99I/Q143R/H224F
314
T239I/Q286R/M2980/H373F
T99I/Q143R/M156Q/H224F
315
Замена Gla из FIX/S222A/Q286R/ H373F
Замена Gla из FIX/S82A/Q143R/ H224F
316
Замена Gla из FIX/S222A/Q286R/M298Q
Замена Gla из FIX/S82A/Q143R/ M156Q
317
Замена Gla H3FIX/S222A/Q286R/M29 8Q/H373F
Замена Gla из FIX/S82A/Q143R/M156 Q/H224F
318
V158D/E296V/M298Q/H373F
V21D/E154V/M156Q/H224F
319
V158D/Q286R/E296V/M298Q/H373F
V21 D/Q 143 R/E 154 V/M 156Q/H224F
320
H257A/Q286R/M298Q
H117A/Q143R/M1560
321
H257S/Q286R/M298Q
H117S/Q143R/M156Q
322
Замена Gla из FIX/S222A/H257S/Q286R
Замена Gla из FIX/S82A/H117S/ Q143R
323
S222A/H257S/Q286R/M298Q
S82A/H117S/Q143R/M156Q
324
H257S/Q286R/M298Q/H373F
H117S/Q143R/M1560/H224F
325
S222A/Q286R/M298Q/H373F
S82A/Q143R/M156Q/H224F
326
Замена Gla из FIX/Q366V
Замена Gla из FIX/Q217V
327
S222A/Q286R/M298Q
S82A/Q143R/M156Q
328
T128N/P129A/A175S/Q366V
Т[ 128]N/P[ 129] A/A39S/Q217V
329
A122N/G124S/A175S/Q366V
А[ 122]N/G[ 1241S/A3 9S/Q217 V
330
Т128N/P129 А/А 175 S/S222А
T[128]N/P[129]A/A39S/S82A
331
A122N/G124S/A175S/S222A
A[122]N/G[124]S/A39S/S82A
332
T128N/P129A/A175S/Q286R
T[128]N/P[129]A/A39S/Q143R
333
A122N/G124S/A175S/Q286R
A[ 122]N/G[ 124] S/A3 9S/Q143R
334
Замена Gla из FIX /T128N/P129A/A17 5S/S222A/Q286R
Замена Gla из FIX/T[128]N/P[129]A/ A39S/S82A/Q143R
335
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
Замена Gla из FIX/A122N/G124S/ A175S/S222A/Q286R
Замена Gla из FLX/A[122]N/G[124]S/ A39S/S82A/Q143R
336
T128N/P129A/A175S/Q286R/M298Q
Т[ 128]N/P[ 129] A/A39S/Q143R/ M156Q
337
A122N/G124S/A175S/Q286R/M298Q
A[122]N/G[124]S/A39S/Q143R/ M156Q
338
T128N/P129A/A175S/S222A/H257A /Q286R/M298Q
Т[ 128]N/P[ 129] А/АЗ 9S/S82A/H117А/ Q143R/M156Q
339
А122N/G124S/A175 S/S222А/Н257А /Q286R/M298Q
A[122]N/G[124]S/A39S/S82A/H117А/ Q143R/M156Q
340
T128N/P129A/A175S/Q286R/M298Q/ H373F
T[128]N/P[129]A/A39S/Q143R/M156 Q/H224F
341
А122N/G124S/A175 S/Q286R/M298 Q/H373F
A[122]N/G[124]S/A39S/Q143R/ M156Q/H224F
342
T128N/P129A/M298Q
T[128]N/P[129]A/M156Q
354
{Замена Gla из FIX /К431} /T128N/P129A/Q286R/M298Q
{Замена Gla из FIX /К[43]1}/ T[128]N/P[129]A/Q143R/M156Q
355
Т128N/P129A/Q286R/M298Q/Q366N
T[128]N/P[129]A/Q143R/M156Q/ Q217N
356
{Замена Gla из FIX /K43I}/Q286R/M298Q/Q366N
{Замена Gla из FIX /K[43]I}/Q143R/M156QQ217N
357
{Замена Gla из FIX /К431}/ T128N/P129A/Q286R/M298Q/Q366N
{Замена Gla из FIX /K[43]I}/T[128]N/ P[129]A/Q143R/M156QQ217N
358
T128N/P129A/M298Q/H373F
T[128]N/P[129]A/M156Q/H224F
359
V158D/Q286R/E296V/M298Q
V21D/Q143R/E154V/M156Q
360
M298Q/Q366N/H373F
M156Q/Q217N/H224F
361
T239V/M298Q/H373F
T99V/M156Q/H224F
362
T239I/M298Q/H373F
T99I/M156Q/H224F
363
Tl 28N/P129 A/Q286R/M298Q/Q366N/ H373F
T[128]N/P[129]A/Q143R/M156Q/ Q217N/H224F
364
T239V/Q286R/M298Q/Q366N
T99V/Q143R/M156Q/Q217N
365
T239I/Q286R/M298Q/Q366N
T99I/Q143R/M156Q/Q217N
366
Модификации по нумерации зрелого FVII
Модификации по нумерации химотрипсина
SEQ ID NO
T128N/P129A/T239V/Q286R/M298Q
T[128]N/P[129]A/T99V/Q143R/M156
367
Tl 28N/P129 A/S222A/T239V/H257A /Q286R/M298Q
T[128]N/P[129]A/S82/VT99V/H117А/ Q143R/M156Q
368
T128N/P129A/T239V/Q286R/M298Q/ H373F
T[128]N/P[129]A/T99V/Q143R/M156 Q/H224F
369
T128N/P129A/T239I/Q286R/M298Q
T[128]N/P[129]A/T99I/Q143R/M156Q
370
T128N/P129A/T239I/Q286R/M298Q /H373F
T[ 128]N/P [ 129] A/T99I/Q143 R/M156Q /H224F
371
Е. Получение полипептидов FVII.
Полипептиды FVII, в том числе модифицированные полипептиды FVII или их домены или домены других витамин K-зависимых полипептидов, могут быть получены хорошо известными в уровне техники способами очистки белков и экспрессии рекомбинантных белков. Могут быть использованы любые известные специалистам в данной области способы выявления нуклеиновых кислот, которые кодируют желаемые гены. Для получения полноразмерного (т.е. охватывающего весь кодирующий район) клона кДНК или геномной ДНК, кодирующего полипептид FVII или другой витамин K-зависимый полипептид, например, из клеток или ткани, например ткани печени, может быть использован любой способ, доступный в уровне техники. Модифицированные полипептиды FVII могут быть сконструированы, как описано в настоящем документе, например, с помощью сайт-направленного мутагенеза.
FVII можно клонировать или выделить с помощью любых доступных известных в уровне техники способов клонирования и выделения молекул нуклеиновых кислот. Такие способы включают ПЦР-амплификацию нуклеиновых кислот и скрининг библиотек, в том числе скрининг гибридизацией нуклеиновых кислот, скрининг антителами и скрининг по активности.
Для выделения молекул нуклеиновых кислот, кодирующих полипептид FVII, могут быть использованы различные способы амплификации нуклеиновых кислот, включая, например, полимеразную цепную реакцию (ПЦР). Содержащий нуклеиновые кислоты материал может быть использован в качестве исходного материала, из которого могут быть выделены кодирующие FVII молекулы нуклеиновой кислоты. Например, в методах амплификации могут быть использованы препараты ДНК и РНК, клеточные экстракты, экстракты ткани (например, печени), образцы жидкости (например, образцы крови, сыворот
ки, слюны), образцы, взятые у здоровых и/или больных субъектов. Библиотеки нуклеиновых кислот также могут быть использованы как источник исходного материала. Для амплификации кодирующих FVII молекул могут быть разработаны праймеры. Например, праймеры могут быть сконструированы на основе экспрессируемых последовательностей, из которых образуется FVII. Праймеры могут быть сконструированы с помощью обратной трансляции аминокислотной последовательности FVII. Молекулы нуклеиновых кислот, полученные в результате амплификации, могут быть секвенированы, что подтвердит кодирование указанными молекулами полипептида FVII.
С кодирующей FVII молекулой нуклеиновой кислоты могут быть соединены дополнительные нук-леотидные последовательности, в том числе линкерные последовательности, содержащие сайты рестрикции для клонирования синтетического гена в вектор, например вектор экспрессии или вектор, предназначенный для амплификации кодирующей коровый белок последовательности ДНК. Кроме того, с кодирующей FVII молекулой нуклеиновой кислоты могут быть функционально связаны дополнительные нуклеотидные последовательности, представляющие собой функциональные элементы ДНК. Примеры таких последовательностей включают, но не ограничиваются промоторными последовательностями, предназначенными для обеспечения внутриклеточной экспрессии белка, и сигнальными последовательностями, предназначенными для обеспечения секреции белка. Дополнительные нуклеотидные последовательности, такие как последовательности, представляющие собой районы связывания белков, также могут быть связаны с кодирующей FVII молекулой нуклеиновой кислоты. Такие районы, включают, но не ограничиваются, последовательности, содействующие поглощению FVII конкретными клетками-мишенями или, напротив, повышающие фармакокинетику синтетического гена.
Выявленные и выделенные нуклеиновые кислоты могут быть вставлены в соответствующий вектор клонирования. Может быть использовано большое количество известных в уровне техники систем вектор-хозяин. Возможные векторы при условии совместимости векторной системы с используемой клеткой-хозяином включают, но не ограничиваются, плазмиды или модифицированные вирусы. Такие векторы включают, но не ограничиваются, бактериофаги, такие как производные бактериофага лямбда, или плазмиды, такие как pBR322, pUC плазмиды или производные вектора Bluescript (Stratagene, La Jolla, Калифорния). Вставки в вектор клонирования могут быть введены, например, путем лигирования фрагмента ДНК в вектор клонирования, который имеет комплементарные липкие концы. Вставка может быть введена с использованием векторов клонирования ТОРО (Invitrogen, Carlsbad, Калифорния). Если для фрагментации ДНК были использованы комплементарные сайты рестрикции, которых нет в векторе клонирования, концы молекулы ДНК могут быть ферментативно модифицированы. Кроме того, любой желаемый сайт может быть получен путем лигирования нуклеотидных последовательностей (линкеров) на концах ДНК, лигированые линкеры могут содержать специфичные химически синтезированные оли-гонуклеотиды, кодирующие последовательности, распознаваемые эндонуклеазами рестрикции. В альтернативном методе расщепленный вектор и ген белка FVII могут быть модифицированы присоединением гомополимерного концевого фрагмента. Рекомбинантные молекулы могут быть введены в клетку-хозяина, например, с помощью трансформации, трансфекции, инфекции, электропорации и сонопорации, в результате чего образуется множество копий последовательности гена. В конкретных вариантах трансформация клетки-хозяина рекомбинантными молекулами ДНК, которые включают выделенный ген белка FVII, кДНК или синтезированную последовательность ДНК, позволяет получить множество копий гена. Таким образом, ген может быть получен в больших количествах с помощью выращивания трансформантов, выделения рекомбинантных молекул ДНК из трансформантов и, при необходимости, получения вставленного гена из выделенной рекомбинантной ДНК.
1. Векторы и клетки.
Для рекомбинантной экспрессии одного или нескольких белков FVII, нуклеиновые кислоты, содержащие нуклеотидную последовательность, кодирующую белок FVII, или ее часть, могут быть вставлены в соответствующий вектор экспрессии, т.е. вектор, который содержит необходимые элементы для транскрипции и трансляции кодирующей последовательности вставленного белка. Примером такого вектора может быть любой вектор экспрессии млекопитающих, такой как, например, pCMV. Необходимые сигналы транскрипции и трансляции также могут содержаться в нативном промоторе гена FVII и/или его фланкирующих районах.
Кроме того, в настоящем документе предусмотрены векторы, которые содержат нуклеиновые кислоты, кодирующие FVII или модифицированный FVII. Также предусмотрены клетки, содержащие вектор. Клетки включают эукариотические и прокариотические клетки, а векторы представляют собой любые подходящие для использования в настоящем документе векторы.
Предусмотрены прокариотические и эукариотические клетки, в том числе клетки эндотелия, содержащие векторы. Такие клетки включают бактериальные клетки, клетки дрожжей, клетки грибов, ар-хеи, растительные клетки, клетки насекомых и клетки животных. Для получения полипептида FVII или модифицированных полипептидов FVII клетки выращивают в соответствующих условиях, при которых закодированные белки FVII экспрессируются в клетках, после чего извлекают экспрессированный белок FVII. Для целей настоящего изобретения FVII может быть секретирован в среду.
В одном варианте предусмотрен вектор, содержащий последовательность нуклеотидов, кодирую
щую полипептид, обладающий активностью FVII и включающий полипептид FVII или его часть, или несколько копий указанной последовательности. Могут быть выбраны векторы для экспрессии полипептида FVII или модифицированных полипептидов FVII в клетке или для секреции экспрессированного белка FVII. Нуклеиновая кислота, с которой экспрессируют FVII, может быть связана с нуклеиновой кислотой, кодирующей сигнал секреции, такой как сигнальная последовательность фактора а-спаривания Saccharomyces cerevisiae или его часть, или нативная сигнальная последовательность.
Для экспрессии кодирующей последовательности белка могут быть использованы различные системы хозяин-вектор. Они включают, но не ограничиваются системами клеток млекопитающих, инфицированных вирусом (например, вирусом осповакцины, аденовирусом и другими вирусами); системами клеток насекомых, инфицированных вирусом (например, бакуловирусом); микроорганизмами, такими как дрожжи, содержащие дрожжевые векторы, или бактерии, трансформированные бактериофагом, ДНК, плазмидной ДНК или космидной ДНК. Экспрессионные элементы векторов варьируют по силе и специфичности. В зависимости от используемой системы хозяин-вектор может быть использован любой подходящий транскрипционный и трансляционный элемент.
Для конструирования векторов экспрессии, содержащих химерный ген, включающий соответствующие сигналы контроля транскрипции/трансляции и кодирующие белок последовательности, могут быть использованы любые методы вставки фрагментов ДНК в вектор, известные специалистам в данной области. Эти методы могут включать рекомбинацию и синтез ДНК in vitro или рекомбинацию in vivo (генетическую рекомбинацию). Экспрессию последовательности нуклеиновой кислоты, кодирующей полипептид FVII, модифицированный полипептид FVII или его домен, производное, фрагмент или гомолог, можно регулировать с использованием второй последовательности нуклеиновой кислоты, что приводит к экспрессии генов или их фрагментов в трансформированном молекулой (молекулами) рекомби-нантной ДНК хозяине. Например, экспрессией белков можно управлять с помощью любого промото-ра/энхансера, известного в уровне техники. В одном варианте промотор не является нативным для генов белка FVII. Промоторы, которые могут быть использованы, включают, но не ограничиваются ранним промотором SV40 (Bernoist и Chambon, Nature 290: 304-310 (1981)), промотором, содержащимся в 3'-длинном концевом повторе вируса саркомы Рауса (Yamamoto и др., Cell 22:781-791 (1980)), промотором тимидинкиназы герпеса (Wagner и др., Proc. Natl. Acad. Sci USA 75:1441-1445 (1981)), регуляторными последовательностями гена металлотионеина (Brвставкаter и др., Nature 296:39-42 (1982)); промоторами прокариотических векторов экспрессии, включающими промотор р-лактамазы (Jay и др., (1981). Proc. Natl. Acad. Sci USA 75: 5543) или ТАС промотор (DeBoer и др., Proc. Natl. Acad. Sci USA 80:21-25 (1983)), см. также "Useful Proteвставка from Recombinant Bacteria" в журнале Scientific American 242:7994 (1980); векторы экспрессии растений включают промотор нопалин-синтетазы (Herrar-Estrella и др., Nature 305:209-213 (1984)), промотор 35S РНК вируса мозаики цветной капусты (Garder и др., Nucleic Acids Res. 9:2871 (1981)) и промотор фермента фотосинтеза рибулозобисфосфаткарбоксилазы (Herrera-Estrella и др., Nature 310: 115-120 (1984)); промоторные элементы дрожжей и других грибов включают промотор Gal4, промотор алкогольдегидрогеназы, промотор фосфоглицеролкиназы, промотор щелочной фосфатазы; районы контроля транскрипции животных, которые проявляют тканеспецифичность и которые были использованы в трансгенных животных, включают контролирующий район гена эластазы I, который активен в ацинарных клетках поджелудочной железы (Swift и др., Cell 35:639-646 (1984); Ornitz и др., Cold Spring Harbor Symp. Quant. Biol 50:399-409 (1986); MacDonald, Hepatology 7:425-515 (1987)); контролирующий район гена инсулина, активный в р-клетках поджелудочной железы (Hanahan и др., Nature 315: 115-122 (1985)), контролирующий район генов иммуноглобулинов, который активен в лим-фоидных клетках (Grosschedl и др., Cell 35:647-658 (1984); Adams и др., Nature 318:533-538 (1985);. Alexander и др., Mol. Cell Biol. 7:1436-1444 (1987)), контролирующий район вируса опухоли молочной железы мыши, активный в яичках, молочной железе, лимфоидных и тучных клетках (Leder и др., Cell 45:485-495 (1986)), контролирующий район гена альбумина (Pinckert и др., Genes and Devel 7:268-276 (1987)), активный в печени, контролирующий район гена а-фетобелка, активный в печени (Krumlauf и др., Mol. Cell Biol. 5: 1639-1648 (1985); Hammer и др., Science 235: 53-58 1987)), контролирующий район гена а-1-антитрипсина, активный в печени (Kelsey и др., Genes and Devel 7: 161-171 (1987)), контролирующий район гена р-глобина, активный в миелоидных клетках (Mogram и др., Nature 375:338-340 (1985); Kollias и др., Cell 46:89-94 (1986)), контролирующий район гена основного белка миелина, активный в олиго-дендроцитах мозга (Readhead и др., Cell 45:703-712 (1987)), контролирующий район гена легкой цепи-2 миозина, активный в скелетных мышцах (Shani, Nature 374:283-286 (1985)) и контролирующий район гена гонадотропного рилизинг-гормона, активный в гонадотропоцитах гипоталамуса (Mason и др., Science 234: 1372-1378 (1986)).
В конкретном варианте используют вектор, который содержит промотор, функционально связанный с нуклеиновой кислотой, кодирующей полипептид FVII или модифицированный полипептид FVII, или его домен, фрагмент, производное или гомолог, вектор также содержит одну или несколько точек начала репликации и, по желанию, один или более селективных маркеров (например, ген устойчивости к антибиотику). Векторы и системы экспрессии полипептидов FVII включают известные векторы Pichia
(доступные, например, от Invitrogen, San Diego, Калифорния), в частности векторы, предназначенные для секреции закодированных белков. Примеры плазмидных векторов для экспрессии в клетках млекопитающих включают, например, pCMV. Примеры плазмидных векторов для трансформации клеток E.coli включают, например, векторы экспрессия pQE (доступные от Qiagen, Valencia, Калифорния, см. также литературу, опубликованную Qiagen для описания системы). pQE вектор включает промотор фага Т5 (распознается РНК полимеразой E.coli), двойной участок репрессии в Lac-операторе для жестко регулируемой высокой экспрессии рекомбинантных белков в E.coli, синтетический сайт связывания рибосом (RBS II) для эффективной трансляции, последовательность, кодирующую 6xHis метку, t0 и Т1 терминаторы транскрипции, точку начала репликации CoIE1 и ген р-лактамазы для устойчивости к ампициллину. pQE вектор позволяет присоединять 6xHis метку на N-конце или С-конце рекомбинантного белка. Такие плазмиды включают pQE 32, pQE 30 и 31 pQE, которые включают сайты множественного клонирования для всех трех рамок считывания и обеспечивают экспрессию белков с N-концевой 6xHis меткой. Другие примеры плазмидных векторов для трансформации клеток E.coli включают, например, векторы экспрессии рЕТ (см., патент США 4952496; вектор доступен Novagen, Madison, Висконсин, см., также опубликованную Novagen литературу с описанием системы). Такие плазмиды включают рЕТ11а, которая содержит промотор Т7^, Т7 терминатор, индуцируемый lac-оператор E.coli, и ген lac-репрессора; рЕТ12а-с содержит промотор Т7, терминатор Т7 и сигнал секреции ompT из E.coli; pET15b и pET19b (Novagen, Madison, Висконсин) содержат лидерную последовательность His-Tag(tm) для очистки на His колонке и сайт расщепления тромбином, который позволяет осуществить расщепление после очистки на колонке, Т7-^ промоторный район и Т7 терминатор. 2. Системы экспрессии.
Полипептиды FVII (модифицированные и немодифицированные) могут быть получены любыми известными в уровне техники способами получения белка, включая in vitro и in vivo способы, такие как, например, введение молекул нуклеиновых кислот, кодирующих FVII, в клетку-хозяина, животное-хозяина, и экспрессию молекул нуклеиновых кислот, кодирующих FVII, in vitro. FVII и модифицированные полипептиды FVII могут быть экспрессированы в любом организме, подходящем для получения необходимого количества полипептида FVII и необходимой формы FVII, требуемых для введения и лечения. Хозяева в системах экспрессии включают прокариотические и эукариотические организмы, такие как Е. coli, дрожжи, растения, клетки насекомых, клетки млекопитающих, в том числе клеточные линии человека, и трансгенные животные. Хозяева систем экспрессии могут отличаться уровнями экспрессии белка, а также типом пост-трансляционных модификаций, которые присутствуют на экспрессированных белках. Выбор хозяина системы экспрессии может быть сделан на основе перечисленных и других факторов, таких как нормативные ограничения и соображения безопасности, издержки производства и необходимость очистки, и способы очистки.
Экспрессия в эукариотических хозяевах может включать экспрессию в дрожжах, таких как Sac-charomyces cerevisiae и Pichia pastoria, клетках насекомых, таких как клетки дрозофилы и клетки чешуекрылых, экспрессию в растениях и растительных клетках, таких как табак, кукуруза, рис, водоросли и ряска. Эукариотические клетки для экспрессии также включают линии клеток млекопитающих, такие как клетки яичников китайского хомячка (СНО) или клетки почки детеныша хомяка (ВНК).
Эукариотические хозяева экспрессии также включают трансгенных животных, например, включая получение трансгена в сыворотке крови, молоке и яйцах. Трансгенные животные для получения полипептидов FVII дикого типа известны в уровне техники (патентные публикации США №№ 20020166130 и 20040133930) и могут быть адаптированы для получения предусмотренных модифицированных полипептидов FVII.
Для экспрессии FVII доступно и известно специалистам в данной области множество векторов экспрессии. Выбор вектора экспрессии зависит от выбора хозяина системы экспрессии. Такой выбор находится в сфере компетенции специалиста. В общем, вектор экспрессии может включать транскрипционный промотор и, необязательно, энхансер, сигналы трансляции и сигналы терминации транскрипции и трансляции. Векторы экспрессии, которые используются для стабильной трансформации, обычно обладают селективным маркером, который позволяет отобрать и поддерживать трансформированные клетки. В некоторых случаях ориджин репликации может быть использован для амплификации числа копий вектора в клетках. Полипептиды FVII или модифицированные полипептиды FVII также могут быть использованы или экспрессированы как гибридные белки. Например, гибридный белок может быть получен добавлением дополнительного функционального полипептида. Примеры гибридных белков включают гибридные белки с сигнальной последовательностью, такой как метка для локализации, например, His6 метка или myc метка, или такой как метка для очистки, например, слитая последовательность GST, примеры также включают белки, слитые с последовательностью для направления секреции белков и/или ассоциации с мембраной, но не ограничиваются указанными примерами.
В одном из вариантов полипептид FVII или модифицированные полипептиды FVII могут быть экс-прессированы в активной форме, где активация достигается за счет самоактивации полипептида после секреции. В другом варианте протеазы экспрессируются в неактивной, зимогенной форме. Способы по
лучения полипептидов FVII могут включать коэкспрессию одного или нескольких дополнительных гете-рологичных полипептидов, которые могут помочь в получении полипептидов FVII. Например, такие полипептиды могут способствовать посттрансляционной модификации полипептидов FVII. Примеры полипептидов включают, но не ограничиваются, пептидазы, которые помогают отщеплять последовательности от предшественника FVII, такие как пропептидная последовательность, и ферменты, которые участвуют в модификации полипептида FVII, например, путем гликозилирования, гидроксилирования, кар-боксилирования или фосфорилирования. Пример пептидазы, которая может быть коэкспрессирована с FVII, представляет собой РАСЕ/фурин (или PACE-SOL), которая способствует отщеплению пропептид-ной последовательности FVII. Пример белка, который способствует карбоксилированию полипептида FVII, представляет собой варфарин-чувствительный фермент витамин-K-2,3-эпоксидредуктазу (VKOR), который восстанавливает витамин K для использования в качестве кофактора в витамин K-зависимом у-карбоксилировании (Wajih и др., J. Biol. Chem. 280 (36) 31603-31607). Субъединица этого фермента, VKORC1, может быть коэкспрессирована с модифицированным полипептидом FVII для усиления у-карбоксилирования. Один или несколько дополнительных полипептидов могут быть экспрессированы с того же вектора экспрессии, что и полипептид FVII, или с другого вектора.
a. Экспрессия в прокариотах.
Прокариоты, особенно Е. coli, представляют собой системы для получения большого количества FVII (см., например, Platis и др., (2003) Protein Exp. Purif. 31(2): 222-30; и Khalilzadeh и др., (2004) J. Ind Microbiol Biotechnol 31 (2): 63-69). Трансформация Е. coli представляет собой простой и быстрый метод, хорошо известный специалистам в данной области. Векторы экспрессии Е. coli могут содержать индуци-бельный промотор, полезный для стимулирования высоких уровней экспрессии белка и для экспрессии белков, которые проявляют токсичность для клеток-хозяев. Примеры индуцибельных промоторов включают lac-промотор, trp-промотор, гибридный tac-промотор, Т7 и SP6 РНК промоторы и термочувствительный XPL промотор.
FVII может быть экспрессирован в цитоплазматической среде Е. coli. Цитоплазма представляет собой восстановительную среду, и для некоторых молекул это может привести к образованию нерастворимых телец включения. Для ресолюбилизации белков могут быть использованы восстанавливающие агенты, такие как дитиотреитол и р-меркаптоэтанол и денатурирующие агенты (например, гуанидин-HCl и мочевина). Альтернативный подход состоит в экспрессии FVII в периплазматическом пространстве бактерий, которое предоставляет окислительную среду, шаперонинподобные белки и дисульфидизомеразы, что приводит к образованию растворимого белка. Как правило, с экспрессируемым белком сливают ли-дерную последовательность, которая направляет белок в периплазму. Затем лидерная последовательность удаляется сигнальной пептидазой внутри периплазмы. Примеры лидерных последовательностей, направляющих белки в периплазму, включают лидерную последовательность pelB гена пектатлиазы и лидерную последовательность гена щелочной фосфатазы. В некоторых случаях периплазматическая экспрессия приводит к утечке экспрессированного белка в культуральную среду. Секреция белков позволяет быстро и просто очистить белки от культурального супернатанта. Не секретируемые белки могут быть получены из периплазмы с помощью осмотического лизиса. Как и при цитоплазматической экспрессии, в некоторых случаях белки могут стать нерастворимыми и для облегчения растворения и рефолдинга белков могут быть использованы денатурирующие агенты и восстановители. Температуры индукции и культивирования также могут влиять на уровень экспрессии и растворимость белков. Как правило, используются температуры между 25 и 37°С. Для увеличения растворимости экспрессированного белка также могут быть использованы мутации. Как правило, бактерии производят агликозилированные белки. Таким образом, если для функционирования белки требуют гликозилирования, то гликозилирование может быть осуществлено in vitro после очистки из клетки-хозяина.
b. Дрожжи.
Дрожжи, такие как Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluy-veromyces lactis и Pichia pastoris, являются полезными хозяевами систем экспрессии для FVII (см., например, Skoko и др., (2003) Biotechnol. Appl. Biochem. 38 (Pt3):257-65). Дрожжи могут быть трансформированы эписомными репликативными векторами или путем стабильной интеграции в хромосомы гомологичной рекомбинацией. Как правило, для регулирования экспрессии генов используются индуцируемые промоторы. Примеры таких промоторов включают промоторы GAL1, GAL7, GAL5 и металлотио-неиновые промоторы, такие как CUP1. Для отбора и поддержания трансформированной ДНК векторы экспрессии часто включают селективные маркеры, такие как LEU2, TRP1, HIS3 и URA3. Экспрессируе-мые в дрожжах белки часто являются растворимыми, а коэкспрессия с шаперонинами, такими как Bip и протеиндисульфидизомераза, может повысить уровень экспрессии и растворимость белка. Кроме того, экспрессируемые в дрожжах белки могут быть направлены для секреции с использованием слитого сигнального пептида секреции, такого как сигнал секреции фактора альфа-типа спаривания дрожжей из Sac-charomyces cerevisiae, и слитого сигнального пептида белков поверхности клетки дрожжей, таких как адгезивный рецептор спаривания Aga2p или глюкоамилаза Arxula adeninivorans. Для удаления слитой последовательности из полипептидов после секреции может быть введен сайт расщепления протеазой
(например, протеазой Кех-2). Дрожжи также способны к гликозилированию мотива Asn-X-Ser/Thr.
c. Насекомые и клетки насекомых.
Насекомые и клетки насекомых, в частности, при использовании системы бакуловирусной экспрессии полезны для экспрессии полипептидов, таких как FVII или его модифицированные формы (см., например, Muneta и др., (2003) J. Vet. Med. Sci. 65 (2):219-23). Клетки насекомых и личинки насекомых экспрессируют высокие уровни белка, в том числе экспрессируют в гемолимфе, и способны осуществлять большинство посттрансляционных модификаций высших эукариот. Бакуловирусы имеют ограниченный диапазон хозяев, что повышает безопасность и снижает нормативные ограничения, присущие системам эукариотической экспрессии. Как правило, в векторах экспрессии для высокого уровня экспрессии белка используют промотор полиэдрина бакуловируса. Обычно используемые бакуловирусные системы включают такие бакуловирусы, как вирус ядерного полиэдроза Autographa californica (AcNPV) и вирус ядерного полиэдроза Bombyx mori (BmNPV), и линии клеток насекомых, такие как Sf9, полученные из Spodoptera frugiperda, Pseudaletia unipuncta (A7S) и Danaus plexippus (DpN1). Для достижения высокого уровня экспрессии нуклеотидную последовательность молекулы, которая будет экспрессирована, сливают непосредственно после инициаторного кодона полиэдрина вируса.
Сигналы секреции млекопитающих точно процессируются в клетках насекомых и могут быть использованы для секреции экспрессированного белка в культуральную среду. Кроме того, клеточные линии Pseudaletia unipuncta (A7S) и Danaus plexippus (DpNl) производят белки, гликозилирование которых похоже на гликозилирование в клеточных системах млекопитающих. Альтернативной системой экспрессии в клетках насекомых является использование стабильно трансформированных клеток. Для экспрессии могут быть использованы такие клеточные линии, как Schnieder 2 (S2) и Kc клетки (Drosophila mela-nogaster) и С7 клетки (Aedes albopictus). Для достижения высокого уровня экспрессии в присутствии тяжелых металлов может быть использован промотор металлотионеина дрозофилы с индукцией кадмием и медью. Векторы экспрессии, как правило, поддерживают за счет использования селективных маркеров, таких как неомицин и гигромицин.
d. Клетки млекопитающих.
Для экспрессии полипептидов FVII могут быть использованы системы экспрессии млекопитающих. Экспрессионные конструкции могут быть введены в клетки млекопитающих посредством вирусной инфекции, например, с помощью аденовируса, или путем прямого переноса ДНК, например, с помощью липосом, фосфата кальция, ДЭАЭ-декстрана и физических методов, таких как электропорация и микроинъекция. Векторы экспрессии для клеток млекопитающих обычно включают сайт кэпирования мРНК, ТАТА-бокс, последовательность инициации трансляции (консенсусную последовательность Козака) и элементы полиаденилирования. Такие векторы для достижения высокого уровня экспрессии часто включают промоторы и энхансеры транскрипции, например промотор-энхансер SV40, промотор цитомегало-вируса человека (CMV) и длинный концевой повтор вируса саркомы Рауса (RSV). Указанные промото-ры-энхансеры действуют во многих типах клеток. Также для экспрессии могут быть использованы тка-неспецифичные и специфичные к определенным типам клеток промоторные и энхансерные районы. Примеры промоторных/энхансерных районов включают, но не ограничиваются, районы из таких генов, как ген эластазы I, ген инсулина, гены иммуноглобулинов, промоторный/энхансерный район вируса опухоли молочной железы мыши, геном альбумина, геном а-фетобелка, а-1-антитрипсина, р-глобина, основного белка миелина, легкой цепи-2 миозина и гонадотропного рилизинг-гормона. Для отбора и поддержания клеток с экспрессионными конструкциями могут быть использованы селективные маркеры. Примеры селективных маркеров включают, но не ограничиваются, гены гигромицинфосфотрансферазы, аденозиндезаминазы, ксантин-гуанинфосфорибозилтрансферазы, аминогликозидфосфотрансферазы, ди-гидрофолатредуктазы и тимидинкиназы. Гибридные белки с сигнальными молекулами клеточной поверхности, такими как TCR-Z и FcJRI-у, могут непосредственно экспрессироваться в активном состоянии на поверхность клеток.
Для экспрессии в млекопитающих доступны многие клеточные линии, включая клетки мыши, крысы, человека, обезьяны, курицы и хомяка. Примеры линий клеток включают, но не ограничиваются ВНК (т.е. клетками ВНК-21), 293-F, СНО, Balb/3Т3, HeLa, MT2, мышиными NSO (не секретирующие) и другими клеточными линиями миеломы, гибридомными и гетерогибридомными клеточными линиями, лимфоцитами, фибробластами, SP2/0, COS, NIH3T3, HEK293, 293S, 293Т, 2В8 и HKB клетками. Также доступны адаптированные к бессывороточной среде клеточные линии, что облегчает очистку секретируе-мых белков из культуральной среды. Одним из таких примеров является бессывороточная линия клеток EBNA-I (Pham и др., (2003) Biotechnol Bioeng. 84:332-42).
Экспрессия рекомбинантных полипептидов FVII, имеющих одинаковую структуру и посттрансляционные модификации с FVII плазмы, известна в уровне техники (см., например, Jurlander и др., (2003) Semin Throm Hemost). Также известны способы оптимизации экспрессии витамин K-зависимых белков. Например, добавление витамина K в культуральную среду или коэкспрессия витамин K-зависимой у-карбоксилазы (Wajih и др., J. Biol. Chem. 280 (36) 31603-31607) могут способствовать посттрансляционным модификациям витамин K-зависимых белков, таких как полипептиды FVII.
е. Растения.
Трансгенные клетки растений и растения могут быть использованы для экспрессии FVII. Экспрес-сионные конструкции, как правило, переносят в растения с использованием прямого переноса ДНК, такого как бомбардировка микрочастицами и PEG-опосредованный перенос в протопласты, или с использованием агробактериальной трансформации. Векторы экспрессии могут включать промоторные и эн-хансерные последовательности, элементы терминации транскрипции и элементы контроля трансляции. Векторы экспрессии и методы трансформации, как правило, отличаются для двудольных хозяев, таких как арабидопсис и табак, и однодольных хозяев, таких как кукуруза и рис. Примеры промоторов растений, используемых для экспрессии, включают промотор вируса мозаики цветной капусты, промотор но-палинсинтазы, промотор рибулозобисфосфаткарбоксилазы и промотор убиквитина и UBQ3. Для облегчения отбора и поддержания трансформированных клеток часто используют селективные маркеры, такие как гигромицин, фосфоманнозоизомераза и неомицинфосфотрансфераза. Трансформированные клетки растений можно поддерживать в культуре в виде клеток, агрегатов (каллусной ткани) или регенерировать в целые растения. Поскольку растения обладают другими формами гликозилирования, чем клетки млекопитающих, это может повлиять на выбор этих хозяев для производства FVII. Трансгенные клетки растений также могут включать генетически модифицированные водоросли, предназначенные для производства белков (см., например, Mayfield и др., (2003) PNAS 100:438-442).
2. Способы очистки.
Способы очистки полипептидов FVII из клетки-хозяина зависят от выбранной клетки-хозяина и системы экспрессии. В случае секреции белки, в общем, являются очищенными из культуральной среды после удаления клеток. В случае внутриклеточной экспрессии клетки могут быть лизированы, и белки очищают из экстракта. Если для экспрессии используют трансгенные организмы, такие как трансгенные растения и животные, в качестве исходного материала для получения экстракта лизированных клеток могут быть использованы ткани или органы. Кроме того, получение белков в трансгенных животных может включать получение полипептидов в молоке или яйцах, которые могут быть собраны, и затем при необходимости белки могут быть выделены и очищены с использованием стандартных способов, известных в уровне техники.
FVII может быть очищен с использованием стандартных способов очистки белков, известных в уровне техники, включая, но не ограничиваясь SDS-PAGE, эксклюзионной хроматографией и хроматографией по размеру, осаждением сульфатом аммония, хелатной хроматографией и ионообменной хроматографией. Например, полипептиды FVII могут быть очищены анионообменной хроматографией. Примером способа очистки полипептида FVII является использование ионообменной колонки, которая позволяет связать любой полипептид, который имеет функциональный домен Gla, и последующее элюиро-вание в присутствии кальция (см., пример 2). Для повышения выхода и чистоты препаратов также могут быть использованы методы аффинной очистки. Например, для аффинной очистки могут быть использованы антитела, рецепторы и другие молекулы, которые связывают FVII. В другом примере очистка также может быть улучшена при использовании аффинной колонки с растворимым ТФ (рТФ) (Maun и др., (2005). Prot. Sci. 14:1171-1180). В экспрессионных конструкциях к белку может быть добавлена аффинная метка, такая как myc эпитоп, слитая последовательность GST или His6, и аффинная очистка может быть проведена с помощью myc антител, смолы с глутатионом и Ni-смолы соответственно. Чистота может быть оценена любым способом, известным в уровне техники, включая гель-электрофорез, окрашивание и спектрофотометрические методы.
Протеаза FVII может быть экспрессирована и очищена в неактивной форме (зимогенной форме) либо экспрессированная протеаза может быть очищена в активной форме, например, после автокатализа. Например, in vitro могут быть получены полипептиды FVII, которые были активированы через протео-литическое расщепление Arg152-Ile153 (т.е. FVIIa, двухцепочечная форма). Полипептиды FVII могут быть получены по любому из способов, описанных в настоящем документе, включая, но не ограничиваясь получением в клетках млекопитающих с последующей очисткой. Расщепление полипептидов FVII с образованием активной формы протеазы FVIIa может быть выполнено несколькими способами. Например, при инкубации с фосфолипидными везикулами в присутствии кальция в течение 45 мин может быть достигнута самоактивация (Nelsestuen и др., (2001) J. Biol. Chem. 276:39825-31). Полипептиды FVII также могут быть полностью активированы посредством инкубации с фактором Ха, фактором ХПа или ТФ в присутствии кальция, в присутствии или в отсутствие фосфолипидов (см. пример 2 и Broze и др., (1980) J. Biol. Chem. 255:1242-1247, Higashi и др., (1996) J. Biol. Chem. 271:26569-26574, Harvey и др., J. Biol.
Chem. 278:8363-8369).
3. Гибридные белки.
Также предусмотрены гибридные белки, содержащие модифицированный полипептид FVII и один или нескольких других полипептидов. Предусмотрены фармацевтические композиции, содержащие такие гибридные белки, составленные для введения подходящим путем. Гибридные белки получают соединением в любом порядке модифицированного полипептида FVII и агента, такого как антитело или его фрагмент, фактор роста, рецептор, лиганд и другие подобные агенты для облегчения очистки полипептида FVII, изменения фармакодинамических свойств полипептида FVII, для направления полипепти
да FVII, например, направления полипептида в целевые клетки или ткани и/или для увеличения экспрессии или секреции полипептида FVII. Как правило, любой гибридный белок FVII сохраняет по меньшей мере приблизительно 30, 40, 50, 60, 70, 80, 90 или 95% коагулянтной активности по сравнению с не гибридным полипептидом FVII, в том числе 96, 97, 98, 99% или более коагулянтной активности по сравнению с не гибридным полипептидом.
Связь полипептида FVII с другим полипептидом может быть осуществлена непосредственно или через линкер. В одном примере связь может представлять собой химическую связь, например связь через гетеробифункциональный агент, тиоловую связь или другую такую связь. Гибридные белки также могут быть получены с помощью рекомбинантной методики. Слитый с полипептидом FVII другой полипептид может быть присоединен на N-конце или С-конце полипептида FVII. Не ограничивающие примеры полипептидов, которые могут быть использованы для получения гибридных белков с полипептидом FVII по настоящему изобретению, включают, например, полипептид GST (глутатион S-трансферазу), Fc домен иммуноглобулина G или гетерологичную сигнальную последовательность. Гибридные белки могут содержать дополнительные компоненты, такие как связывающий мальтозу белок Е. coli (МВР), которые способствуют поглощению белка клетками (см., международную заявку РСТ WO 01/32711).
Гибридный белок может быть получен стандартными рекомбинантными методами. Например, фрагменты ДНК, кодирующие различные последовательности полипептидов, могут быть лигированы друг с другом с совпадением рамки считывания в соответствии с обычными способами, например с использованием тупых или липких концов для лигирования, расщепления эндонуклеазой рестрикции для обеспечения соответствующих концов, заполнения липких концов в соответствующих случаях, обработки щелочной фосфатазой для избежания нежелательного лигирования и ферментативного лигирования. В другом варианте гибридные гены могут быть синтезированы обычными способами, включая автоматизированный синтез ДНК. Кроме того, ПЦР-амплификация фрагментов генов может осуществляться с использованием праймеров, которые приводят к комплементарным одноцепочечным участкам между двумя последовательными фрагментами гена, которые затем могут быть отожжены и реамплифицирова-ны для создания последовательности химерного гена (см., например, Ausubel и др., Current Protocols In Molecular Biology, (изд.) John Wiley & Sons, 1992). Кроме того, доступны многие векторы экспрессии, которые уже кодируют гибридный фрагмент (например, полипептид GST). Кодирующая FVII нуклеиновая кислота может быть клонирована в таком векторе экспрессии, причем гибридный фрагмент может быть связан с протеазой с совпадением рамки считывания.
4. Модификации полипептидов.
Модифицированные полипептиды FVII могут быть получены в виде посттрансляционно немоди-фицированных полипептидных цепей или в виде комплекса. Для некоторых целей может быть предпочтительным получение модифицированного FVII в посттрансляционно немодифицированном виде без посттрансляционных или других химических модификаций. Немодифицированные посттрансляционно полипептидные цепи могут быть получены в подходящих хозяевах, которые не осуществляют посттрансляционную модификацию FVII. Такие полипептиды также могут быть получены в in vitro системах и с использованием химического синтеза полипептидов. Для других целей могут быть желательны специфические модификации, включая пегилирование, альбуминирование, гликозилирование, карбокси-лирование, гидроксилирование, фосфорилирование или другие известные модификации. Модификации могут быть введены in vitro или, например, при получении модифицированных FVII в подходящем хозяине, который производит такие модификации.
5. Нуклеотидные последовательности.
В настоящем документе предусмотрены молекулы нуклеиновых кислот, кодирующие FVII или модифицированные полипептиды FVII. Молекулы нуклеиновых кислот включают аллельные варианты или варианты сплайсинга любого закодированного полипептида FVII. Примеры предусмотренных здесь молекул нуклеиновых кислот включают любые молекулы, которые кодируют модифицированные полипептиды FVII по настоящему документу, такие как любые молекулы, кодирующие полипептиды, приведенные в любой из SEQ ID NO: 113-273. В одном из вариантов, молекулы нуклеиновой кислоты, предусмотренные в настоящем документе, по меньшей мере на 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95 или 99% идентичны по последовательности любой нуклеиновой кислоте, кодирующей полипептид FVII, предусмотренный в настоящем документе, или гибридизуются в условиях средней или высокой жесткости по меньшей мере на 70% полной длины с любой нуклеиновой кислотой, кодирующей полипептид FVII, предусмотренный в настоящем документе. В другом варианте молекулы нуклеиновой кислоты могут включать молекулы с вырожденными кодонами, кодирующие любой из предусмотренных полипептидов FVII.
F. Оценка активности модифицированных полипептидов FVII.
Активности и свойства полипептидов FVII можно оценить in vitro и/или in vivo. Анализы для такой оценки известны специалистам в данной области, а также известна корреляция измеренной активности и терапевтического результата и in vivo активности. В одном примере варианты FVII могут быть оценены по сравнению с немодифицированным FVII и/или FVII дикого типа. В другом примере активность модифицированного полипептида FVII может быть оценена после экспозиции in vitro или in vivo с АТ-III и
сравнена с активностью модифицированного полипептида FVII, который не был подвержен действию АТ-III. Такие анализы могут быть выполнены в присутствии или в отсутствие ТФ. In vitro анализы включают любые лабораторные анализы, известные специалистам в данной области, такие как, например, анализы с использованием клеток, в том числе анализы на коагуляцию, анализы на связывание, белковые анализы и молекулярно-биологические анализы. In vivo анализы включают тестирование FVII на животных моделях, а также введение FVII человеку. В некоторых случаях активность FVII in vivo может быть определена на основе оценки крови, сыворотки или других жидкостей организма. Варианты FVII также могут быть исследованы in vivo для оценки их активности или свойств, таких как терапевтический эффект.
Как правило, анализы, описанные здесь, проводят на двухцепочечной активированной форме FVII, т.е. FVIIa. Такие анализы также могут быть выполнены на одноцепоченой форме в качестве отрицательного контроля, поскольку такая форма, как правило, не обладает протеолитической или каталитической активностью, необходимой для коагулянтной активности FVII. Кроме того, такие анализы также могут быть выполнены в присутствии кофакторов, таких как ТФ, которые в некоторых случаях увеличивают активность FVII.
1. In vitro анализы.
Примеры in vitro анализов включают анализы для оценки модификаций и активности полипептидов. Модификации могут быть оценены с помощью in vitro анализов для оценки у-карбоксилирования и других посттрансляционных модификаций, белковых анализов и конформационных анализов, известных в уровне техники. Анализы для определения активности включают, но не ограничиваются оценкой взаимодействия FVII с другими факторами свертывания, такими как ТФ, фактор X и фактор IX, протеолити-ческими анализами для определения протеолитической активности полипептидов FVII, анализами для определения связывания и/или аффинности полипептидов FVII к фосфатидилсерину и другим фосфоли-пидам и анализами с использованием клеток для определения влияния полипептидов FVII на коагуляцию.
Концентрации модифицированных полипептидов FVII могут быть оценены хорошо известными в уровне техники способами, включая, но не ограничиваясь, иммуноферментный анализ (ИФА), SDS-PAGE, методы Брэдфорда, Лоури, ВСА (бицинхониновая кислота); измерение УФ-поглощения, а также другие методы количественного мечения белка, включая, но не ограничиваясь, иммунологические методы, связанные с радиоактивностью методы, флуоресцентные и связанные с ними методы.
Оценка продуктов расщепления протеолитических реакций, в том числе оценка расщепления полипептидов FVII или оценка содержания продуктов протеолитической активности FVII, может быть выполнена с использованием способов, включающих, но не ограничивающихся расщеплением хромогенно-го субстрата, ВЭЖХ, SDS-анализом, ИФА, иммуноблоттингом, иммуногистохимическим анализом, им-мунопреципитацией, определением последовательности с №г[2-конца и мечением белка. Также могут быть оценены структурные свойства модифицированных полипептидов FVII. Например, для оценки трехмерной структуры полипептидов FVII и/или других свойств полипептидов FVII, таких как связывание Са2+ или кофактора, могут быть использованы рентгеновская кристаллография, ядерный магнитный резонанс (ЯМР) и криоэлектронная микроскопия (крио-ЭМ) модифицированных полипептидов FVII. Кроме того, наличие и степень деградации FVII может быть измерена с помощью стандартных способов, таких как электрофорез полиакриламидном геле в присутствии додецилсульфата натрия (SDS-PAGE) и иммуноблоттинг подвергнутых электрофорезу FVII-содержащих образцов. В полипептидах FVII, которые подверглись воздействию протеазы, может быть также определена последовательность с N-конца для определения местонахождения сайтов расщепления или изменения в сайтах расщепления в модифицированных полипептидах FVII.
а. Посттрансляционные модификации.
Полипептиды FVII также могут быть оценены на наличие посттрансляционных модификаций. Такие анализы известны в уровне техники и включают анализы для оценки гликозилирования, гидроксили-рования и карбоксилирования. Например, для анализа гликозилирования может быть выполнен анализ углеводов, например, совместно с SDS-PAGE анализом полипептидов FVII, подвергнутых гидразинолизу или обработанных эндогликозидазой. Гидразинолиз при инкубации белка с безводным гидразином приводит к отделению N- и О-связанных гликанов от гликопротеина, а обработка эндогликозидазой ПНГа-зой F приводит к отделению большей части N-гликанов из гликопротеина. Гидразинолиз или обработка эндогликозидазой полипептидов FVII приводит к образованию восстанавливающего конца, который может быть помечен флуорофорной или хромофорной меткой. Меченые полипептиды FVII могут быть проанализированы флуорофорным электрофорезом углеводов (FACE). Флуоресцентное мечение глика-нов также может быть использовано при анализе моносахаридов, профилировании или анализе особенностей структуры сложных паттернов гликозилирования с помощью ВЭЖХ. Примеры ВЭЖХ включают гидрофильную хроматографию, хроматографию электронного взаимодействия, ионообменную, гидрофобную хроматографию и гель-хроматографию. Примеры меток для гликанов включают, но не ограничиваются 3-(ацетиламино)-6-аминоакридином (АА-АС) и 2-аминобензойной кислотой (2-АА). Углеводные фрагменты также могут быть обнаружены с использованием специфических антител, которые рас
познают гликозилированный полипептид FVII.
Пример анализа для оценки р-гидроксилирования включает обратнофазный ВЭЖХ анализ полипептидов FVII, которые были подвергнуты щелочному гидролизу (Przysiecki и др., (1987) 84:7856-7860
PNAS).
Карбоксилирование и у-карбоксилирование полипептидов FVII может быть оценено с использованием масс-спектрометрии с матричной лазерной десорбционной ионизацией и определением времени пролета (MALDI-TOF), как описано в уровне техники (см., например, Harvey и др., J. Biol. Chem. 278: 8363-8369, Maun и др., Prot Sci 14:1171-0 1180). Также может быть оценено взаимодействие полипептидов FVII, содержащих пропептидную последовательность (про-FVII), с карбоксилазой, ответственной за посттрансляционное у-карбоксилирование. Константа диссоциации (Kd) может быть измерена после инкубации карбоксилазы с флуоресцеин-меченым npo-FVII полипептидом путем определения количества связанной карбоксилазы по анизотропии (Lin и др. (2004) J. Biol. Chem. 279: 6560-6566).
b. Протеолитическая активность.
Модифицированные полипептиды FVII могут быть оценены на протеолитическую активность. Протеолитическая активность FVII может быть измерена с помощью хромогенных субстратов, таких как
Chromozym t-PA (MeSO2-D-Phe-Gly-Arg-pNA), S-2288 (H-D-Ile-Pro-Arg-pNA), S-2266 (H-D-Val-Leu-Arg-
pNA), S-2765 (Z-D-Arg-Gly-Arg-pNA), Spectrozyme FXa и Spectrozyme FVIIa (CH3SO2-D-CHA-But-Arg-pNA). Полипептиды FVII в присутствии ТФ или в отсутствие ТФ инкубировали с различными концентрациями хромогенного субстрата. Расщепление субстрата можно контролировать по оптическому поглощению, а скорость гидролиза субстрата можно определить линейной регрессией с использованием доступного программного обеспечения. Активация полипептидом FVII субстратов факторов свертывания, таких как FX, также может быть оценена. FVII полипептиды, предварительно инкубированные с ТФ или не инкубированные с ТФ, инкубировали с очищенным FX (коммерчески доступен). Количество активного FXa, полученного в результате инкубации с полипептидом FVII, определяется как активность FXa по отношению к хромогенному субстрату, такому как S-2222 или Spectrafluor FXa (CH3SO2-D-CHA-Gly-ATg-AMC.AcOH), которую измеряли по изменению абсорбции (Harvey и др., J. Biol. Chem. 278:8363-8369, см. также пример 4 ниже). Также при инкубации FVII и FX может быть включен источник фосфолипидов (Nelsestuen и др., (2001) J. Biol. Chem. 276:39825-31).
c. Коагулянтная активность.
Коагулянтная активность полипептидов FVII может быть оценена с помощью известных в уровне техники анализов. Примеры анализов включают, но не ограничиваются двухэтапным анализом свертывания (Liebman и др., (1985) 82:3879-3883 PNAS); анализом протромбинового времени (ПВ, которое может быть показателем ТФ-зависимой активности FVIIa во внешнем пути); модификациями анализа ПВ; активированным частичным тромбопластиновым временем (АЧТВ, которое может быть показателем ТФ-независимой активности FVIIa); активированным временем свертывания (ABC); рекальцифициро-ванным активированным временем свертывания; временем свертывания Ли-Уайта или тромбоэластогра-фией (ТЭГ) (Pusateri и др., (2005) Critical Care 9: S15-S24.). Например, коагулянтная активность модифицированного полипептида FVII может быть определена с помощью анализа ПВ, в котором FVII разводят в FVII-дефицитной плазме и смешивают с реагентом для определения протромбинового времени (реком-бинантный ТФ с фосфолипидами и кальцием), например, доступным под названием Innovin(tm) от Dade Behring. Образование сгустка определяют оптически, находят требующееся для образования сгустка время и сравнивают его с временем для FVII-дефицитной плазмы.
d. Связывание и/или ингибирование другими белками и молекулами.
Для измерения устойчивости модифицированных полипептидов FVII к ингибиторам FVII, таким как, например, АТ-III и TFPI, или молекулам, таким как Zn2+, могут быть использованы анализы ингиби-рования. Также может быть проведена оценка ингибирования другими ингибиторами, которые включают, но не ограничиваются другими ингибиторами сериновых протеаз и FVII-специфическими антителами. Ингибирование может быть оценено, например, после инкубации АТ-III, TFPI или Zn2+ с полипептидами FVII, которые предварительно инкубировали с ТФ и/или без ТФ. Активность FVII может быть измерена с помощью одного или нескольких анализов активности или анализов коагуляции, описанных выше, и ингибирование АТ-III, TFPI, или Zn2+ можно оценить путем сравнения активности полипептидов FVII, которые инкубировали с ингибитором, с активностью полипептидов FVII, которые не инкубировали с ингибитором.
Полипептиды FVII могут быть оценены на связывание с другими факторами коагуляции и ингибиторами. Например, прямое и непрямое взаимодействие FVII с кофакторами, такими как ТФ, субстратами, такими как FX и FIX, и ингибиторами, такими как антитромбин III, TFPI и гепарин, может быть оценено с использованием каких-либо анализов связывания, известных в уровне техники, включая, но не ограничиваясь иммунопреципитацией, колоночной очисткой, невосстанавливающим SDS-PAGE, анализами BIAcore(r), поверхностным плазмонным резонансом (SPR), флуоресцентным резонансным переносом энергии (FRET), поляризацией флуоресценции (FP), изотермическим калориметрическим титрованием (ITC), круговым дихроизмом (КД), анализом на комплементацию фрагментов белка (PCA), ядерным
магнитным резонансом (ЯМР), рассеянием света, седиментационным равновесием, гель-фильтрацией с малыми зонами, торможением в геле, фар-вестерн блоттингом, поляризацией флуоресценции, гидроксил-радикальным футпринтингом белка, фаговым дисплеем, а также различными двухгибридными системами. В одном примере связывание Zn оценивают с помощью равновесного анализа (Petersen и др., (2000)
Prot Sci 9:859-866).
e. Аффинность к фосфолипидам.
Связывание и/или аффинность модифицированных полипептидов FVII к фосфатидилсерину (ФС) и другим фосфолипидам могут быть определены с помощью хорошо известных в уровне техники анализов. Высокочистые фосфолипиды (например, ФС крупного рогатого скота в известной концентрации и яичный фосфатидилхолин (ФХ)), которые являются коммерчески доступными, например, от Sigma, и растворены в органическом растворителе, могут быть использованы для получения малых однослойных фосфолипидных везикул. Связывание полипептида FVII с этими ФС/ФХ везикулами может быть оценено по относительному рассеянию света под углом 90° к падающему свету. Для определения константы диссоциации измеряют интенсивности рассеяния света на ФС/ФХ везикулах и на ФС/ФХ/FVII везикулах (Harvey и др., J. Biol. Chem. 278:8363-8369). Поверхностный плазмонный резонанс, например, измеренный на биосенсоре BIAcore, также может быть использован для измерения сродства полипептидов FVII к фосфолипидам мембран (Sun и др., Blood 101: 2277-2284).
2. Модели на животных, не включающих человека.
Модели на животных, не включающих человека, могут быть использованы для оценки активности, эффективности и безопасности модифицированных полипептидов FVII. Например, животные, не включающие человека, могут быть использованы для моделирования заболевания или состояния. Животные, не включающие человека, могут быть инъецированы веществом, вызывающим заболевание и/или индуцирующим фенотип, затем животному может быть введен вариант FVII, такой как любой вариант FVII, приведенный в любом из SEQ ID NO: 113-273, и может быть проведен мониторинг воздействия полипептида на развитие заболевания. Генетические модели также являются полезными. Могут быть получены животные, такие как мыши, которые в результате гиперэкспрессии, недостаточной экспрессии или нокаута одного или нескольких генов имитируют заболевания или состояния, например, могут быть получены мыши с нокаутом фактора VIII, которые проявляют гемофилию A (Bi и др., (1995) Nat Gen 10: 119-121). Такие животные могут быть получены согласно технологии получения трансгенных животных, хорошо известной в уровне техники, или с использованием природных или индуцированных мутантных штаммов. Примеры полезных моделей заболеваний, связанных с FVII, на животных, не включающих человека, включают, но не ограничиваются моделями нарушений свертываемости крови, в частности, моделями гемофилии или тромбоза. Модели травмы на животных, не включающих человека, также могут быть использованы для оценки активности полипептидов FVII, такой как коагулянтная активность. Указанные модели на животных, не включающих человека, могут быть использованы для мониторинга активности вариантов FVII по сравнению с полипептидом FVII дикого типа. Модели на животных также могут быть использованы для мониторинга стабильности, периода полураспада и клиренса модифицированных полипептидов FVII. Такие анализы полезны для сравнения модифицированных полипептидов FVII и для расчета доз и режима дозирования для дальнейших исследований на животных и человеке. Например, модифицированный полипептид FVII, такой как любой вариант FVII, предусмотренный в настоящем документе, в том числе, например, любой полипептид, приведенный в любой из последовательностей SEQ ID NO: 113-273, может быть введен в хвостовую вену мыши. Затем через определенные интервалы времени после инъекции могут быть отобраны образцы крови (например, через минуты, часы и дни после введения), и в образцах, включающих, но не ограничивающихся сывороткой или плазмой, через определенные интервалы времени после введения может быть определен уровень модифицированных полипептидов FVII, например, с помощью ИФА или радиоиммуноанализа. Образцы крови, отобранные через определенные интервалы времени после инъекции полипептидов FVII, также могут быть исследованы на коагулянтную активность с использованием различных способов, таких как описанные в примере 9. Указанные фармакокинетические исследования могут предоставить информацию о полураспаде, клиренсе и стабильности полипептидов FVII, которая может помочь в определении подходящих доз для введения прокоагулянта.
Модифицированный полипептид FVII, такой как любой полипептид, приведенный в любой из последовательностей SEQ ID NO: 113-273, может быть проверен на терапевтическую эффективность в моделях на животных для гемофилии. В одном не ограничивающем примере могут быть использованы модели на животных, таких как мыши. Мышиные модели гемофилии, имеющиеся в уровне техники, могут быть использованы для тестирования модифицированных полипептидов FVII. Например, мышиная модель гемофилии, получаемая путем инъекции анти-FVIII антител, может быть использована для оценки коагулянтной активности полипептида FVII (см. пример 6 и Tranholm и др., Blood (2003) 102:3615-3620). Мышиная модель гемофилии В также может быть использована для тестирования полипептидов FVII (Margaritis и др., (2004). J. Clin. Invest 113:1025-1031). Также существуют не мышиные модели нарушений свертываемости крови. Активность полипептида FVII может быть оценена на крысах с индуцированным варфарином кровотечением или индуцированным мелатраном кровотечением (Diness и др.,
(1992) Thromb Res 67:233-241, Elg и др., (2001) Thromb Res 101:145-157) и на кроликах с индуцированным гепарином кровотечением (Chen и др., (2003) J. Thromb. Haemost 1: 760-765). Инбредные собаки с гемофилией А, гемофилией В и болезнью Виллебранда, которые проявляют сильные кровотечения, также могут быть использованы в исследованиях полипептида FVII (Brinkhous и др., (1989) 86:1382-1386 PNAS). Активность полипептидов FVII также может быть оценена в модели кровотечения на кролике с тромбоцитопенией, индуцированной сочетанием у-облучения и использования антител против тромбоцитов (Tranholm и др., (2003) Thromb Res 109: 217-223).
В дополнение к животным с генерализованными нарушениями свертываемости крови для оценки активности полипептидов FVII, их безопасности и эффективности в качестве терапевтических коагулянтов также могут быть использованы модели ранения и травмы. Не ограничивающие примеры таких моделей включают модель коронарного стеноза на кролике (Fatorutto и др., (2004). Can. J. Anaesth 51: 672679), модель травмы печени V класса у свиней (Lynn и др., (2002) J. Trauma 52:703-707), модель травмы печени V класса у свиней (Martinowitz и др., (2001) J. Trauma 50: 721-729) и модель аортотомии у свиней (Sondeen и др., (2004) Shock 22: 163-168).
3. Клинические анализы.
Для оценки активности FVII для клинического использования доступно множество анализов. Такие анализы могут включать оценку коагуляции, стабильности белков и периода полураспада in vivo и фено-типические анализы. Фенотипические анализы и тесты для оценки терапевтического эффекта лечения фактором FVII включают оценку уровня FVII в крови (например, измерение уровня FVII в сыворотке до введения и через определенные интервалы времени после введения, в том числе после первого введения, непосредственно после последнего введения и в определенные моменты времени между ними с поправкой на индекс массы тела (ИМТ)), оценку свертывания крови после лечения FVII in vitro с использованием способов, описанных выше (например, ПВ анализ), и фенотипический ответ на лечение FVII, включая улучшение симптомов во времени по сравнению с субъектами, которым вводили немодифицированный FVII и/или FVII дикого типа или плацебо. У пациентов, получавших полипептид FVII, можно оценить потерю крови, потребность в переливании и уровень гемоглобина. Пациенты могут наблюдаться регулярно в течение определенного периода времени при регулярных или повторных введениях или после введения в ответ на острую необходимость, такую как кровотечение, травма или хирургическое вмешательство.
G. Композиции и введение.
В настоящем документе предусмотрены композиции для использования в лечении нарушений свертываемости крови. Такие композиции содержат терапевтически эффективное количество полипептида фактора VII, как описано здесь. Эффективные концентрации полипептида FVII или его фармацевтически приемлемого производного смешивают с подходящим фармацевтическим носителем или средой для системного, местного или локального введения.
Количество соединения эффективно для лечения выбранного расстройства. Концентрация активного вещества в композиции зависит от поглощения, инактивации, экскреции активного соединения, графика дозирования и количества ведений, а также от других факторов, известных специалистам в данной области. Фармацевтические носители или среды, пригодные для применения соединений, предусмотренных в настоящем документе, включают носители, известные специалистам в данной области, подходящие для определенного способа введения. Фармацевтические композиции, которые включают терапевтически эффективное количество полипептида FVII, описанного в настоящем документе, также могут быть предусмотрены в виде лиофилизированного порошка, который может быть восстановлен, например, стерильной водой, непосредственно перед введением.
1. Композиции.
Фармацевтические композиции, содержащие модифицированный FVII, могут быть составлены любым обычным способом путем смешивания выбранного количества полипептида с одним или несколькими физиологически приемлемыми носителями или наполнителями. Выбор носителя или наполнителя находится в пределах компетенции специалиста в данной области и может зависеть от целого ряда параметров. К ним относятся, например, способ введения (например, системный, оральный, назальный, легочный, местный, локальный или любой другой способ) и подвергаемое лечению расстройство. Фармацевтические композиции, предусмотренные в настоящем документе, могут быть составлены для введения одной дозой (непосредственно) или для разведения или других модификаций. Концентрации соединений в композиции являются эффективными для доставки такого количества соединения, которое после введения является эффективным для предусмотренного лечения. Как правило, композиции составлены для введения одной дозой. Для получения композиции навеску, рассчитанную как массовая доля соединений или их смеси, растворяют, суспендируют, диспергируют или иным образом смешивают в выбранном носителе в эффективной концентрации, такой, что подвергающееся лечению состояние улучшается или уменьшается. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть включены в композицию для введения субъекту в виде двухцепочечного белка FVIIa. Модифицированные полипептиды FVII могут быть активированы до включения в композицию любым способом, известным в уровне техники. Например, FVII может пройти самоактивацию в процессе очистки с
помощью ионообменной хроматографии (Jurlander и др., (2001) Semin Thromb Hemost 27:373-384). Модифицированные полипептиды FVII также могут быть активированы путем инкубации с иммобилизованным на шариках FXa (Kemball-Cook и др., (1998) J. Biol. Chem. 273:8516-8521) или любыми другими способами, известными в уровне техники (см. также пример 2 ниже). Введение кальция в среду при этих процессах обеспечивает полную активацию и правильный фолдинг модифицированного белка FVIIa. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, также могут быть введены в композицию для введения в виде одноцепоченого белка. Одноцепочечные полипептиды FVII могут быть очищены таким образом, чтобы предотвратить расщепление (см., например, US6677440). Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть введены в композицию с соответствующей селективной средой, предотвращающей или контролирующей самоактивацию, так что одноцепоченая и двухцепочечная формы содержатся в фармацевтической композиции в любом соотношении. Соединение может быть суспендировано в микронизированной или другой подходящей форме или может быть изменено для получения более растворимого активного продукта. Форма полученной смеси зависит от ряда факторов, в том числе предусмотренного способа введения и растворимости соединения в выбранном носителе или среде. Полученные смеси представляют собой растворы, суспензии, эмульсии и другие подобные смеси, а также могут быть получены в виде неводной или водной смеси, крема, геля, мази, эмульсии, раствора, эликсира, лосьона, суспензии, настойки, пасты, пены, аэрозоля, состава для промывания, спрея, свечей, бинтов или любой другой композиции, подходящей для системного, местного или локального введения. Для местного внутреннего введения, такого как внутримышечное, парентеральное или внутрисуставное введение, полипептиды могут быть введены в композицию в виде раствора, суспензии в среде на водной основе, такой как изотоничный буферный раствор, или введены в композицию в сочетании с биосовместимым носителем или биоадгезивным материалом, предназначенным для внутреннего введения. Эффективная концентрация достаточна для улучшения состояния, на которое направлено лечение, и может быть определена эмпирически. Для составления композиции навеску соединения растворяют, суспендируют, диспергируют или иным образом смешивают с выбранным носителем с достижением эффективной концентрации, такой, что выбранное состояние улучшается или уменьшается.
Как правило, фармацевтически приемлемые композиции получают в соответствии с требованиями регулирующего органа или получают в соответствии с общепризнанной фармакопеей для использования на животных и для человека. Фармацевтические композиции могут включать в себя вспомогательные вещества, такие как разбавитель, адъювант, наполнитель или носитель, с которыми вводят изоформу. Такие фармацевтические носители могут представлять собой стерильную жидкость, такую как вода и масло, в том числе масло нефтяного, животного, растительного или синтетического происхождения, такое как арахисовое масло, соевое масло, минеральное масло и кунжутное масло. Вода является типичным носителем, если фармацевтическую композицию вводят внутривенно. Солевые растворы и водные растворы декстрозы и глицерина также могут быть использованы в качестве жидкого носителя, особенно в качестве раствора для инъекций. Композиции наряду с активным ингредиентом могут содержать разбавитель, такой как лактоза, сахароза, дикальция фосфат или карбоксиметилцеллюлоза; смазку, такую как стеарат магния, стеарат кальция, тальк и связующее, такое как крахмал, натуральные смолы, такие как камедь, гуммиарабик, желатин, глюкоза, патока, поливинилпирролидон, целлюлоза и ее производные, повидон, кроссповидоны и другие подобные связующие, известные специалистам в данной области. Подходящие фармацевтические наполнители представляют собой крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рисовую муку, мел, силикагель, стеарат натрия, моностеарат глицерина, тальк, хлорид натрия, сухое обезжиренное молоко, глицерин, пропилен гликоль, воду и этанол. Композиция, по желанию, также может содержать небольшие количества смачивателя или эмульгатора, или буферных агентов, например, ацетата, цитрата натрия, производных циклодекстрина, сорбитанмонолаурата, ацетата натрия, триэтаноламина, триэтаноламинолеата и других подобных агентов. Эти композиции могут быть в форме раствора, суспензии, эмульсии, таблетки, пилюли, капсулы, порошка и в форме с устойчивым высвобождением препарата. Могут быть изготовлены капсулы и картриджи, например, из желатина для использования в ингаляторе или инсуффляторе, содержащие порошок, представляющий собой смесь терапевтического соединения и подходящей порошковой основы, такой как лактоза или крахмал. Композиция может быть приготовлена в виде свечей с обычными связующим и носителем, такими как тригли-цериды. Оральная композиция может включать стандартные носители, такие как маннит, лактозу, крахмал, стеарат магния, сахарин натрия, целлюлозу, карбонат магния фармацевтической чистоты и другие подобные агенты. Рецептура для орального введения также может содержать ингибиторы протеаз, такие как ингибитор Боумена-Бирка, конъюгированный ингибитор Боумена-Бирка, апротинин и камостат. Примеры подходящих фармацевтических носителей описаны в "Remington's Pharmaceutical Sciences" E.W. Martin. Такие композиции будут содержать терапевтически эффективное количество соединения, обычно, в очищенном виде вместе с подходящим количеством носителя для обеспечения надлежащей формы введения субъекту или пациенту.
Композиция должна соответствовать способу введения. Например, модифицированные FVII могут быть введены в композицию для парентерального введения путем инъекции (например, путем болюсной
инъекции или непрерывной инфузии). Инъекционные составы могут иметь форму суспензии, раствора или эмульсии в масляном или водном носителе. Стерильные инъекционные рецептуры также могут представлять собой стерильные инъекционные растворы или суспензии в нетоксичном парентерально-приемлемом разбавителе или растворителе, например могут представлять собой раствор в 1,4-бутандиоле. Стерильные жирные масла обычно применяют в качестве растворителя или среды суспен-дирования. Для этой цели может быть использовано любое мягкое жирное масло, включая, но не ограничиваясь, синтетические моно- или диглицериды, жирные кислоты (в том числе олеиновая кислота), естественные растительные масла, например кунжутное масло, кокосовое масло, арахисовое масло, хлопковое масло и другие масла, или синтетические жирные носители, такие как этилолеат. Буферы, консерванты, антиоксиданты и подходящие ингредиенты могут быть включены в композицию, если это необходимо, или, наоборот, могут содержать композицию.
Полипептиды могут представлять собой единственный фармацевтически активный ингредиент в композиции или могут быть объединены с другими активными ингредиентами. Доставка полипептидов может быть направленной, например, при конъюгировании с нацеливающим агентом, таким как антитело. Суспензии липосом, в том числе нацеленных на определенную ткань липосом, также могут быть пригодны в качестве фармацевтически приемлемого носителя. Они могут быть получены в соответствии со способами, известными специалистам в данной области. Например, липосомные композиции могут быть получены, как описано в патенте США № 4522811. Липосомная доставка также может включать композиции с медленным высвобождением, в том числе фармацевтические матрицы, такие как коллагеновые гели и липосомы, модифицированные фибронектином (см., например, Weiner и др., (1985) J. Pharm. Sci. 74 (9): 922-5). Композиции, предусмотренные в настоящем документе, дополнительно могут содержать один или несколько адъювантов, которые облегчают доставку, включая, но не ограничиваясь инертными носителями или коллоидными дисперсионными системами. Не ограничивающие примеры таких инертных носителей могут быть выбраны из воды, изопропилового спирта, газообразных фторуглеродов, этилового спирта, поливинилпирролидона, пропиленгликоля, продуцирующих гель материалов, стеарилово-го спирта, стеариновой кислоты, спермацета, сорбитанмоноолеата, метилцеллюлозы, а также из подходящих комбинаций двух или более из них. Активное соединение включено в фармацевтически приемлемый носитель в количестве, достаточном для оказания терапевтического эффекта в отсутствие нежелательных побочных эффектов у субъекта, подвергающегося лечению. Терапевтически эффективная концентрация может быть определена эмпирически путем тестирования соединений в известных in vitro системах и естественных системах, например, предусмотренных в настоящем документе.
а. Дозировки.
Точное количество или доза вводимого лекарственного средства зависит от конкретного полипептида FVII, пути введения и других соображений, таких как тяжесть заболевания, вес и общее состояние субъекта. Местное введение терапевтического агента, как правило, требует меньших доз, чем любой режим системного введения, хотя локальная концентрация терапевтического агента может, в некоторых случаях, быть выше после местного введения, чем концентрация, которая может быть достигнута при безопасном системном введении. При необходимости конкретная дозировка, протокол и продолжительность лечения могут быть эмпирически определены или экстраполированы. Примеры доз рекомбинант-ных полипептидов и нативного FVII могут быть использованы в качестве отправной точки для определения нужных дозировок. Например, рекомбинантный полипептид FVII (rFVIIa), который был активирован с образованием rFVIIa, Novoseven(r), вводили пациентам с гемофилией А или гемофилией В при кровотечении в дозе 90 мкг/кг болюсной инфузией от 2 до 5 мин, достигая эффективного уровня в крови не менее 2 мкг/мл. Введение повторяли каждые 2 ч до достижения гемостаза. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть эффективны при меньшем количестве и/или частоте введений по сравнению с указанным рекомбинантным FVII. Например, модифицированные полипептиды FVII, предусмотренные в настоящем документе, можно вводить в дозе 80, 70, 60, 50, 40, 30, 20, 15 мкг/кг или менее. В некоторых вариантах дозы могут быть выше и составлять, например, 100, 110, 120 мкг/кг или более. Длительность лечения и интервал между инъекциями может меняться в зависимости от тяжести кровотечения и реакции пациента на лечение и может быть скорректирован соответствующим образом. При определении доз могут быть приняты во внимание такие факторы как уровень активности и период полураспада модифицированного FVII по сравнению с немодифицированным FVII. Конкретные дозы и режимы введения могут быть определены эмпирически.
В другом примере, рекомбинантный полипептид FVII (rFVIIa), который был активирован с образованием rFVIIa, Novoseven(r), вводили пациентам с врожденным дефицитом FVII при кровотечении в дозе 15-30 мкг/кг болюсной инфузией от 2 до 5 мин. Введение повторяли каждые 4-6 ч до достижения гемостаза. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть эффективны при пониженных дозах и/или частоте введений по сравнению с указанным рекомбинантным FVII. Например, модифицированные полипептиды FVII, предусмотренные в настоящем документе, можно вводить в дозе 20, 15, 10, 5, 3 мкг/кг или менее. В некоторых примерах дозы могут быть выше и составлять, например, 35, 40, 45 мкг/кг или более. Длительность лечения и интервал между инъекциями
может меняться в зависимости от тяжести кровотечения и реакции пациента на лечение и может быть скорректирован соответствующим образом. При определении доз могут быть приняты во внимание такие факторы как уровень активности и период полураспада модифицированного FVII по сравнению с немодифицированным FVII. Например, модифицированный полипептид FVII, который обладает более длительным периодом полураспада, чем немодифицированный полипептид FVII, может вводиться в более низких дозах и/или менее часто, чем немодифицированный полипептид FVII. Аналогично, необходимый для достижения терапевтического эффекта модифицированный полипептид FVII, который проявляет увеличенную коагулянтную активность по сравнению с немодифицированным полипептидом FVII, могут вводиться реже и в меньшем количестве. Конкретные дозы и режимы введения могут быть определены эмпирически специалистом в области техники. b. Дозированные формы.
Фармацевтические терапевтически активные соединения и их производные, как правило, включают в композиции и вводят в единичных дозированных формах или множественных дозированных формах. Могут быть предусмотрены композиции для введения людям и животным в лекарственных формах, которые включают, но не ограничиваются таблетками, капсулами, пилюлями, порошками, гранулами, стерильными парентеральными растворами или суспензиями, пероральными растворами или суспензиями и водно-масляными эмульсиями, содержащими приемлемые количества соединений или их фармацевтически приемлемых производных. Каждая единичная доза содержит определенное количество терапевтически активного соединения, достаточное для получения желаемого терапевтического эффекта, в сочетании с необходимым фармацевтическим носителем, средой или растворителем. Примеры единичных дозированных форм включают ампулы и шприцы, и индивидуально упакованные таблетки или капсулы. В некоторых примерах единичные дозы предусмотрены в виде лиофилизированного порошка, который восстанавливают до введения. Например, полипептид FVII может быть предусмотрен в виде лиофилизи-рованного порошка, который восстанавливают подходящим раствором и получают раствор единичной дозы для инъекций. В некоторых вариантах лиофилизированный порошок может содержать полипептид FVII и дополнительные компоненты, такие как соли, такие что восстановление стерильной дистиллированной водой приводит к раствору полипептида FVII в буфере или физиологическом растворе. Единичные дозированные формы могут быть введены частями, или может быть введено сразу несколько единичных дозированных форм. Множественная дозированная форма представляет собой множество одинаковых единичных дозированных форм, упакованных в один контейнер, которые вводят по отдельности единичными дозированными формами.
Примеры множественных дозированных форм включают флаконы, бутылки с таблетками или капсулами или бутылки с пинтами или галлонами жидкости. Таким образом, множественная дозированная форма представляет собой множество единичных дозированных форм, которые упакованы вместе.
2. Введение модифицированных полипептидов FVII.
Полипептиды FVII, предусмотренные в настоящем документе (т.е. активные соединения), могут быть применены in vitro, ex vivo или in vivo, т.е. смесь, такая как жидкость тела или другой образец ткани, может быть введена в контакт с полипептидом FVII. Например, при применении соединения ex vivo жидкость тела или образец ткани субъекта может быть введен в контакт с полипептидом FVII, который покрывает трубку или фильтр, например трубку или фильтр аппарата искусственного кровообращения. При применении in vivo активные соединения могут быть введены любым приемлемым путем, например орально, назально, легочно, парентерально, внутривенно, внутрикожно, подкожно, внутрисуставно, ин-трацистернально, интраокулярно, интравентрикулярно, интратекально, внутримышечно, внутрибрю-шинно, интратрахеально или местно, а также любой комбинацией любых двух или более путей в жидкой, полужидкой или твердой форме, подходящей для каждого пути введения. Модифицированные полипептиды FVII можно вводить один или более раз, например два раза, три раза, четыре раза или любое количество раз, если это необходимо для достижения терапевтического эффекта. Множественные введения можно осуществить любым путем или комбинацией путей введения, введения можно проводить каждый час, каждые два часа, каждые три часа, каждые четыре часа и более. Наиболее подходящий путь введения будет варьировать в зависимости от подвергающегося лечению состояния, например от места кровотечения. Как правило, полипептиды FVII вводят внутривенным болюсом при времени введения (инфузии) около 2-5 мин. В других примерах желательный уровень FVII в крови, оцениваемый по плазме крови, может поддерживаться непрерывной инфузией активного вещества. Следует отметить, что решение о том, когда следует прекратить, прервать или изменить лечение для снижения дозы из-за токсичности или дисфункции костного мозга, печени или почек, находится в сфере компетенции лечащего врача. Решение о том, как и когда, напротив, следует усилить лечение, если клинический ответ не является адекватным (исключая токсичные побочные эффекты) находится в сфере компетенции лечащего врача. В других примерах местоположение кровотечения может указывать, что композицию FVII необходимо вводить альтернативным путем. Например, может быть осуществлено местное введение, включая введение в мозг (например, интравентрикулярно), если пациент испытывает кровотечения в этом районе. Аналогично, для лечения кровотечения в суставах может быть использовано местное введение путем введения терапевтических агентов в сустав (т.е. внутрисуставно, внутривенно или подкожно). В других при
мерах местное введение лекарственного средства на кожу, например, в виде крема, геля или мази или введение в легкие ингаляцией или интратрахеально может быть целесообразно, если кровотечение локализовано в этих областях. Если модифицированные полипептиды FVII включены в композицию в виде депо, композиции длительного действия могут быть введены с помощью имплантации (например, подкожно или внутримышечно) или в виде внутримышечной инъекции. Так, например, терапевтические соединения могут быть включены в композицию с подходящим полимерным или гидрофобным материалом (например, в виде эмульсии в приемлемом масле), или ионообменной смолой, или в виде умеренно растворимых производных, например умеренно растворимых солей.
Композиции, при желании, могут быть предусмотрены в упаковке, в комплекте или дозирующем устройстве, которые могут содержать одну или несколько единичных дозированных форм с активным ингредиентом. Упаковка, например, содержит металлические или пластиковые пленки, например блистерную упаковку. Упаковка или дозирующее устройство может сопровождаться инструкцией для введения. Композиции, содержащие активные вещества, могут быть упакованы в виде изделия, содержащего упаковочный материал, агент по настоящему изобретению и этикетку, в которой указано расстройство, для лечения которого агент предназначен.
3. Введение нуклеиновых кислот, кодирующих модифицированные полипептиды FVII (генная терапия).
Также в настоящем документе предусмотрены композиции молекул нуклеиновых кислот, кодирующих модифицированные полипептиды FVII, и векторов экспрессии, кодирующих модифицированные полипептиды FVII, подходящие для генной терапии. Вместо введения белков могут быть введены нуклеиновые кислоты, например, in vivo, системно или другим путем, или ex vivo, например, путем изъятия клеток, в том числе лимфоцитов, введения в них нуклеиновых кислот и реинтродукции клеток в хозяина или совместимого реципиента. Модифицированные полипептиды FVII могут быть доставлены в клетки и ткани путем экспрессии молекул нуклеиновых кислот. Модифицированные полипептиды FVII могут быть введены как молекулы нуклеиновой кислоты, кодирующие модифицированные полипептиды FVII, включая ех vivo методику и прямую in vivo экспрессию. Нуклеиновые кислоты могут быть доставлены в клетки и ткани любым способом, известным специалистам в данной области. Выделенные последовательности нуклеиновых кислот могут быть включены в векторы для дальнейших манипуляций. В настоящем документе вектор (или плазмида) относится к дискретному элементу, который используется для введения гетерологичной ДНК в клетки для ее экспрессии или репликации. Выбор и использование таких средств находится в пределах компетенции специалистов в данной области.
Способы введения модифицированных полипептидов FVII экспрессией кодирующих молекул нуклеиновой кислоты включают введение рекомбинантных векторов. Вектор может быть сконструирован для сохранения в эписомном состоянии, например, путем включения точки начала репликации, или может быть предназначен для интеграции в хромосому клетки. Модифицированные полипептиды FVII также могут быть использованы в ex vivo терапии при экспрессии генов с использованием невирусных векторов. Например, могут быть созданы клетки, которые экспрессируют модифицированный полипептид FVII, например, путем интеграции кодирующей модифицированный полипептид FVII нуклеиновой кислоты в геном, причем кодирующая последовательность функционально связана с регуляторной последовательностью или помещена под контроль регуляторных последовательностей в геноме. Затем такие клетки могут быть введены локально или системно субъекту, например, пациенту, нуждающемуся в лечении. Для генной терапии могут быть использованы вирусные векторы, включающие, например, аденовирусы, адено-ассоциированные вирусы (AAV), поксвирусы, вирусы герпеса, ретровирусы и другие вирусы. Векторы могут оставаться эписомными или могут интегрироваться в хромосомы субъекта. Модифицированные полипептиды FVII могут быть экспрессированы с помощью вируса, который вводят субъекту, нуждающемуся в лечении. Подходящие для генной терапии вирусные векторы включают аденовирусы, адено-ассоциированные вирусы (AAV), ретровирусы, лентивирусы, вирус осповакцины и другие вирусы, указанные выше. Например, технология экспрессии с помощью аденовируса известна в уровне техники, и получение аденовируса и способы его введения также хорошо известны. Серотипы аденовируса доступны, например, из Американской коллекции типовых культур (АТСС, Rockville, Мэриленд). Аденовирус может быть использован ex vivo, например, при выделении клеток из пациентов, нуждающихся в лечении, и их трансдукции экспрессирующим модифицированный полипептид FVII аденовирусным вектором. После соответствующего периода культивирования трансдуцированные клетки вводят субъекту локально и/или системно. Альтернативно, экспрессирующие модифицированные полипептиды FVII аденовирусные частицы выделяют и смешивают с фармацевтически приемлемым носителем для доставки терапевтически эффективного количества для профилактики, лечения или улучшения симптомов заболевания или состояния у субъекта. Как правило, аденовирусные частицы вводят в дозе от 1 до 1014 частиц на 1 кг веса субъекта, как правило, от 106 или 108 частиц до 1012 частиц на 1 кг веса субъекта. В некоторых ситуациях предпочтителен источник нуклеиновой кислоты с нацеливающим на определенные клетки агентом, таким как антитело, специфичное к поверхностному белку клеточной мембраны клетки-мишени, или таким как лиганд рецептора клетки-мишени. FVII также может быть нацелен на доставку в специфические типы клеток. Например, аденовирусные векторы, кодирующие поли
пептиды FVII, могут быть использованы для стабильной экспрессии в неделящихся клетках, таких как клетки печени (Margaritis и др., (2004). J. Clin. Invest 1 13:1025-1031). В другом примере вирусный или невирусный вектор, кодирующий полипептиды FVII, может быть трансдуцирован в выделенные клетки для последующей доставки. Дополнительные типы клеток для экспрессии и доставки FVII включают, но не ограничиваются, фибробласты и эндотелиальные клетки.
Молекулы нуклеиновых кислот могут быть введены в искусственные хромосомы и другие не вирусные векторы. Искусственные хромосомы, такие как ACES (см. Lindenbaum и др., (2004) Nucleic Acid Res. 32 (21):е172) могут быть сконструированы для кодирования и экспрессии изоформы белка. Искусственные хромосомы млекопитающих (MAC) представляют собой средство введения большого количества полезной генетической информации в клетку при автономной репликации и отсутствии интеграции. В отличие от других MAC система экспрессии с помощью искусственных хромосом млекопитающих на основе сателлитной ДНК (АСЕ) может быть получена de novo в клеточных линиях различных видов и искусственные хромосомы могут быть легко очищены от хромосом клеток хозяина. Очищенные АСЕ млекопитающих могут быть вновь введены в различные реципиентные клеточные линии, где они стабильно поддерживаются в течение длительного периода в отсутствие селективного давления. С использованием этого подхода в LMTK(-) и СНО клетки были введены один или два целевых гена. Другой способ введения кодирующей модифицированные полипептиды FVII нуклеиновой кислоты представляет собой двухстадийную технологию замены генов в дрожжах, требующей полный геном аденовируса (Ad2; Ketner и др., (1994) PNAS 91: 6186-6190), клонированный в искусственной хромосоме дрожжей (YAC), и плазмиду, содержащую аденовирусные последовательности, нацеленные на конкретной район в клоне YAC, экспрессионную кассету для интересующего гена и положительные и отрицательные селективные маркеры. YAC представляют особый интерес, поскольку они позволяют включать в себя большие гены. Этот подход может быть использован для конструирования аденовирусных векторов, несущих нуклеиновые кислоты, кодирующие любой из описанных модифицированных полипептидов FVII, предназначенных для переноса генов в клетки млекопитающих или переноса в животных.
Нуклеиновые кислоты могут быть инкапсулированы в переносчик, такой как липосому, или включены в клетки, такие как бактериальные клетки, особенно ослабленные бактерии, или введены в вирусный вектор. Например, при использовании липосом для нацеливания и/или для облегчения захвата могут быть использованы белки, которые связываются с белками клеточной мембраны, и белки, связанные с эндоцитозом, например, капсидные белки или их фрагменты, связывающиеся с определенным типом клеток, антитела к белкам, подвергающимся интернализации, и белки, которые определяют внутриклеточную локализацию и увеличивают период полураспада внутри клеток.
В ex vivo и in vivo методах молекулы нуклеиновых кислот, кодирующие модифицированные полипептиды FVII вводят в клетки, взятые от подходящего донора или от субъекта, подлежащего лечению. Клетки, в которые для терапевтических целей могут быть введены нуклеиновые кислоты, включают, например, любой доступный предпочтительный тип клеток, подходящий для подлежащего лечению заболевания или состояния, включая, но не ограничиваясь, эпителиальные клетки, эндотелиальные клетки, кератиноциты, фибробласты, мышечные клетки, гепатоциты, клетки крови, такие как Т-лимфоциты, В-лимфоциты, моноциты, макрофаги, нейтрофилы, эозинофилы, мегакариоциты, гранулоциты, различные стволовые клетки или клетки-предшественники, включая гемопоэтические стволовые клетки-предшественники или, например, стволовые клетки, полученные из костного мозга, пуповинной крови, периферической крови, печени плода, а также других их источников.
Для лечения ex vivo выделяют клетки донора, совместимого с подлежащим лечению субъектом, или клетки самого подлежащего лечению субъекта, в указанные выделенные клетки вводят нуклеиновые кислоты, и модифицированные клетки вводят субъекту.
Лечение включает прямое введение клеток, например, инкапсулированных в пористые мембраны, которые имплантируют в организм пациента (см., например, патенты США №№ 4892538 и 5283187, каждый из которых приведен здесь в качестве ссылки в полном объеме). Способы, пригодные для in vitro переноса нуклеиновых кислот в клетки млекопитающих, включают использование липосом и катионных липидов (например, DOTMA, DOPE и DC-Choi), электропорацию, микроинъекцию, слияние клеток, использование ДЭАЭ-декстрана и осаждения с фосфатом кальция. Способы доставки ДНК могут быть использованы для экспрессии модифицированных полипептидов FVII in vivo. Такие способы включают доставку нуклеиновых кислот в липосомах и доставку голой ДНК, в том числе местную и системную доставку, например, при использовании электропорации, ультразвука и кальций-фосфатной доставки. Другие способы включают микроинъекцию, слияние клеток, перенос генов в хромосомах, перенос генов в микроклетках и слияние сферопластов.
In vivo экспрессия модифицированных полипептидов FVII может быть связана с экспрессией дополнительных молекул. Например, экспрессии модифицированных полипептидов FVII может быть связана с экспрессией цитотоксического продукта, такого как модифицированный вирус, или полипептид может экспрессироваться в составе цитотоксического вируса. Такие вирусы могут быть ориентированы на конкретный тип клеток, который является мишенью для терапевтического воздействия. Экспрессия модифицированных полипептидов FVII может быть использована для повышения цитотоксичности вируса.
In vivo экспрессия модифицированных полипептидов FVII может включать функциональное связывание кодирующей модифицированный полипептид FVII молекулы нуклеиновой кислоты со специфичной регуляторной последовательностью, такой как специфичный для клеток или тканеспецифичный промотор. Модифицированные полипептиды FVII также могут быть экспрессированы в векторах, которые специфически заражают и/или реплицируются в клетках-мишенях и/или тканях. Для селективной регуляции экспрессии модифицированного полипептида FVII можно использовать индуцибельный промотор. Пример системы регулируемой экспрессии представляет собой доксициклин-индуцибельная система экспрессии генов, которая была использована для регулируемой экспрессии рекомбинантного FVII (Srour и др., (2003) Thromb Haemost 90 (3):398-405). Молекулы нуклеиновой кислоты, такие как голые нуклеиновые кислоты или векторы, искусственные хромосомы, липосомы и другие переносчики, могут быть введены субъекту путем системного введения, локального, местного и других способов введения. При системном введении in vivo молекулы нуклеиновой кислоты или переносчик, содержащий молекулы нуклеиновой кислоты, могут быть нацелены на определенные клетки.
Введение также может быть прямым, таким как введение вектора или клеток, которые обычно нацелены на клетки или ткани. Например, опухолевые клетки и пролиферирующие клетки могут представлять собой клетки-мишени для in vivo экспрессии модифицированных полипептидов FVII. Используемые для in vivo экспрессии модифицированных полипептидов FVII клетки также включают клетки, ау-тологичные для пациента. Такие клетки могут быть изъяты у пациента, в них могут быть введены нуклеиновые кислоты для экспрессии модифицированных полипептидов FVII, а затем клетки могут быть введены пациенту, например, путем инъекции или пересадки.
Н. Терапевтическое применение.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения любых состояний, для которых может применяться рекомбинантный FVII. Как правило, такое лечение усиливает коагуляцию, например, усиливает гемостатический ответ. Модифицированные полипептиды FVII обладают терапевтической активностью отдельно или в комбинации с другими агентами. Модифицированные полипептиды, предусмотренные в настоящем документе, при сохранении терапевтической активности проявляют модифицированные свойства, в частности, повышенную устойчивость к АТ-III и увеличенную каталитическую активность. Модифицированные полипептиды, предусмотренные в настоящем документе, также могут обладать повышенной устойчивостью к TFPI, повышенной устойчивостью к ингибиторному действию Zn2+, улучшенными фармакокинетическими свойствами, такими как период полураспада в сыворотке, увеличенным связыванием и/или аффинностью к активированным тромбоцитам, увеличенным связыванием и/или аффинностью к сывороточному альбумину и/или увеличенным связыванием и/или аффинностью к интегрину тромбоцитов aIIbp3. Такое изменение свойств, например, может повысить терапевтическую эффективность полипептидов вследствие увеличения коагулянтной активности модифицированных полипептидов FVII. В этом разделе приведены примеры применения и способы введения полипептидов. Описание способов лечения приведено в качестве примера и не ограничивает применение модифицированных полипептидов FVII.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы в различных способах лечения, а также диагностики, в которых может быть применен FVII. Такие способы включают, но не ограничиваются, способы лечения физиологических и медицинских состояний, описанных и перечисленные ниже. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут проявлять увеличенную активность in vivo и увеличенный терапевтический эффект по сравнению с FVII дикого типа, например для достижения того же эффекта могут требоваться более низкие дозы, модифицированные полипептиды FVII могут проявлять другие улучшения для введения и лечения, например, может требоваться введение меньших количеств и/или более редкое введение, могут быть уменьшены побочные эффекты и повышен терапевтический эффект. Хотя модифицированные полипептиды FVII могут быть введены в виде зимогена FVII (т.е. в одноцепочечной форме), как правило, предусмотренные здесь модифицированные полипептиды FVII вводят в активированной двух-цепочечной форме, например, после самоактивации или активации другими факторами свертывания крови, например, во время очистки. В частности, модифицированные полипептиды FVII предназначены для использования в способах лечения, в которых для лечения используют FVII. Такие способы включают, но не ограничиваются способами лечения заболеваний и расстройств, включающих, но не ограничивающихся нарушениями свертывания крови, гематологическими расстройствами, геморрагическими расстройствами, гемофилиями, такими как гемофилия А, гемофилия В и дефицит фактора VII, и приобретенными заболеваниями крови, такими как приобретенный дефицит фактора VII, вызванный заболеваниями печени. Модифицированные полипептиды FVII также могут быть использованы для лечения других заболеваний и нарушений свертывания крови, включая, но не ограничиваясь тромбоцитопенией (например, связанной с химиотерапией тромбоцитопенией), болезнью Виллебранда, наследственными нарушениями функций тромбоцитов (например, заболеваниями дефицита хранения, такими как синдром Чедиака-Хигаси и синдром Германски-Пудлака, дисфункция тромбоксана А2, тромбастения Гланцманна и синдром Бернар-Сулье), гемолитическим уремическим синдромом, наследственной геморрагической телеангиоэкстазией, также известной как синдром Ренду-Ослера-Вебера, аллергической пурпурой (пур
пура Шенлейна-Генох) и диссеминированным внутрисосудистым свертыванием.
В некоторых вариантах подвергающиеся лечению полипептидами FVII кровотечения происходят в таких органах как мозг, внутреннее ухо, глаз, печень, легкие, опухолевая ткань, желудочно-кишечный тракт. В других вариантах кровотечение является диффузным, таким как геморрагический гастрит и обильное маточное кровотечение. Пациенты с нарушениями свертываемости крови, например с гемофилией А и В, часто подвергаются риску кровотечения во время операции или травмы. Такие кровотечения могут проявляться в виде острого гемартроза (кровотечения в суставе), хронической гемофильной арт-ропатии, гематом, (например, мышечной, забрюшинной, сублингвальной и заглоточной), гематурии (кровотечение из почечного тракта), кровотечения в центральной нервной системе, желудочно-кишечных кровотечений (например, кровотечения в верхнем пищеварительном тракте) и кровоизлияния в мозг, которые также можно лечить с помощью модифицированных полипептидов FVII. Кроме того, любые кровотечения, связанные с хирургическим вмешательством (например, резекцией печени) или удалением зубов, можно лечить с помощью модифицированных полипептидов FVII. В одном из вариантов, модифицированные полипептиды FVII могут быть использованы для лечения кровотечений у субъекта, вызванных травмой или операцией, или снижением количества или активности тромбоцитов. Примеры способов лечения пациентов, перенесших операцию, включают лечение для предотвращения кровотечения и другие процедуры до, во время или после операции, включая, но не ограничиваясь операцией на сердце, ангиопластикой, операцией на легких, абдоминальной операцией, операцией на позвоночнике, операцией на головном мозге, операцией на сосудах, стоматологической операцией или трансплантацией органов, в том числе трансплантацией костного мозга, сердца, легких, поджелудочной железы или печени. Лечение заболеваний и состояний модифицированными полипептидами FVII может быть осуществлено с помощью любого подходящего способа введения с использованием подходящей композиции, как описано в настоящем документе, включая, но не ограничиваясь инъекцией, легочным, оральным и трансдермальным введением. Лечение обычно осуществляют путем внутривенного болюсного введения. При необходимости конкретная дозировка, продолжительность и протокол лечения могут быть эмпирически определены или экстраполированы. Примеры доз рекомбинантного полипептида и натив-ного FVII могут быть использованы в качестве отправной точки для определения нужных дозировок. Например, рекомбинантный полипептид FVII (rFVIIa), который был активирован с образованием rFVIIa, Novoseven(r), вводили пациентам с гемофилией А или гемофилией В при кровотечении в дозе 90 мкг/кг болюсной инфузией в течение от 2 до 5 мин, достигая эффективного уровня в крови не менее 2 мкг/мл со средним периодом полураспада 2,7 ч. Введение повторяли каждые 2 ч до достижения гемостаза. Модифицированные полипептиды FVII, которые обладают повышенной коагулянтной активностью, вследствие, например, повышенной устойчивости к АТ-III, увеличенной каталитической активностью, повышенной устойчивостью к ингибиторному действию Zn2+, повышенной устойчивостью к TFPI, улучшенных фармакокинетических свойств, таких как увеличенный период полураспада в сыворотке, увеличенного связывания и/или аффинности к активированным тромбоцитам, увеличенного связывания и/или аффинности к сывороточному альбумину и/или увеличенного связывания и/или аффинности к интегрину тромбоцитов aIIbp3, могут быть эффективны при уменьшенных дозах и/или уменьшенной частоте введения по сравнению с рекомбинантным FVII. Дозы FVII дикого типа или немодифицированного полипептида FVII могут быть использованы в качестве ориентиров для определения доз модифицированных полипептидов FVII. Такие факторы, как уровень активности и период полураспада модифицированного FVII по сравнению с немодифицированным FVII, могут быть использованы при принятии таких решений. Конкретные дозы и режимы введения могут быть определены эмпирически.
Дозировки и режимы введения могут быть определены, исходя из известных дозировок и режимов, и, при необходимости, могут быть экстраполированы на основе изменений свойств модифицированных полипептидов и/или могут быть определены эмпирически на основе целого ряда факторов. К таким факторам относятся масса тела человека, общее состояния здоровья, возраст, активность конкретного используемого соединения, пол, диета, время введения, скорость выделения, комбинация лекарств, тяжесть и течение заболевания, предрасположение пациента к заболеванию и решение лечащего врача. Активный ингредиент, полипептид, как правило, комбинирован с фармацевтически эффективным носителем. Количество активного ингредиента, которое может быть объединено с носителем для получения единичной дозированной формы или множественной дозированной формы может варьировать в зависимости от принимающего лечение субъекта и способа введения.
Влияние полипептидов FVII на время свертывания крови можно контролировать с помощью любого из анализов коагуляции, известных в уровне техники, включая, но не ограничиваясь полным протром-биновым временем крови (ПВ), активированным частичным тромбопластиновым временем (АЧТВ), активированным временем свертывания (ABC), рекальсифицированным активированным временем свертывания крови или временем свертывания крови Ли-Уайта.
После улучшения состояния пациента, если это необходимо, может быть введена поддерживающая доза соединения или композиции; и дозировка, дозированная форма или частота приема или их сочетание могут быть изменены. В некоторых случаях субъекту может потребоваться долгосрочное прерыви
стое лечение при повторении симптомов заболевания или на основе запланированных введений. В других случаях дополнительные введения могут быть необходимы в ответ на острую потребность, такую как кровотечение, травма или хирургическое вмешательство.
Ниже приведены некоторые примеры состояний, при которых FVII (вводили в виде FVIIa) был использован в качестве терапевтического агента отдельно или в комбинации с другими агентами.
1. Врожденные нарушения, связанные с кровотечениями.
а. Гемофилия.
Врожденная гемофилия представляет собой рецессивное заболевание крови, при котором наблюдается снижение уровня факторов свертывания в плазме, что приводит к нарушению свертывания и увеличению времени свертывания. Гемофилия А, на долю которой приходится около 85% всех случаев гемофилии, является результатом мутации (мутаций) в гене фактора VIII в Х-хромосоме, что приводит к недостаточности или дисфункции белка FVIII. Гемофилия В вызвана недостаточностью или дисфункцией фактора свертывания FIX, как правило, в результате точечных мутаций или делеции в гене FIX в Х-хромосоме. Заболеваемость гемофилией А в мире составляет примерно 1 случай на 5000 мужчин и заболеваемость гемофилией В - 1 случай на 25000 мужчин. Гемофилия А и В классифицируется на легкую, среднюю и тяжелую гемофилию. Уровень 5-25% нормально функционирующего фактора VIII или IX в плазме крови классифицируют как легкую, 1-5% как умеренную и менее 1% как тяжелую гемофилию. Гемофилия С, часто называемая дефицитом FIX, является относительно мягким и редким заболеванием, затрагивающим приблизительно 1 из 100000 человек и наследующимся по аутосомно-рецессивному типу.
Гемофилии А и В клинически проявляются различными путями. Малые порезы и ссадины не приводят к чрезмерному кровотечению, в отличие от травм и операций. У пациента также будут наблюдаться многочисленные кровотечения в суставах и мышцах и легкие кровоподтеки. Гемартроз или кровотечение в суставах является одним из серьезных осложнений при гемофилии и может происходить спонтанно или в ответ на травму. Чаще всего страдают блоковидные суставы, такие как колено, локоть и лодыжка. Бедреный и плечевой суставы страдают гораздо реже, так как вокруг шарового и шарнирного сустава находится больше мышц, что больше защищает их от травмы. Кровотечение может привести к тяжелой острой боли, ограничить движение и привести к вторичным осложнениям, включая синовиальную гипертрофию. Кроме того, повторяющиеся кровоизлияния в суставы могут вызвать хронический синовит, который может вызвать повреждения суставов, разрушение синовиальной оболочки, хрящей и кости. Субъекты с гемофилией также страдают опасными для жизни кровотечениями, например внутричерепными кровоизлияниями и кровотечениями в центральной нервной системе. Внутричерепные кровоизлияния происходят приблизительно у 10% пациентов с гемофилией, что приводит к 30% смертности. Напротив, гемофилия С является более мягкой. Спонтанные кровотечения редки, и кровоизлияния в суставы, мягкие ткани и мышцы также происходят редко. Кровотечение обычно лечат переливанием свежезамороженной плазмы (СЗП), заместительной терапией FXI, или, для местного лечения, например, лечения внешних ран или при удалении зубов, фибриновым клеем.
Наиболее распространенным способом лечения гемофилии А или В является заместительная терапия, при которой пациенту вводят FVIII или FIX. Коммерчески доступны композиции с очищенными из плазмы или рекомбинантными продуктами, рекомбинантные белки в настоящее время являются самым популярным лекарственным средством у ранее не леченных пациентов. Хотя эти способы могут быть очень успешными, если у пациента образуются ингибиторы к вводимым фактору VIII или фактору IX, то возникают осложнения. Ингибиторы представляют собой антитела IgG, в основном подкласса IgG4, которые взаимодействуют с FVIII или FIX и ингибируют прокоагулянтную активность. Ингибиторы присутствуют приблизительно у 1 из 5 больных с тяжелой формой гемофилии А. У большинства субъектов ингибиторы появляются вскоре после первой инфузии фактора VIII, которая зачастую происходит в раннем детстве, хотя субъекты вырабатывают ингибиторы позже. Ингибиторы также присутствуют приблизительно у 1 из 15 человек с легкой или умеренной гемофилией А. Ингибиторы обычно вырабатываются во взрослом возрасте и разрушают не только введенный экзогенный фактор VIII, но и эндогенный фактор VIII. В результате этого легкая и средняя гемофилии становятся тяжелой гемофилией. Клинически пациентов с гемофилией, вырабатывающих ингибиторы, делят на пациентов с высокой и низкой реакцией в соответствии с силой их анамнестического ответа при повторном применении FVIII. Ингибиторы присутствуют приблизительно у 1 из 100 пациентов с гемофилией В. У большинства субъектов ингибиторы появляются после первых инфузий фактора IX и могут сопровождаться аллергическими реакциями.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения больных гемофилией, в частности больных гемофилией с ингибиторами. Реком-бинантный продукт FVIIa (Novoseven, "Ново Нордиск") был одобрен и лицензирован для лечения кровотечений при гемофилии А и В у пациентов с ингибиторами фактора VIII или FIX и для профилактики кровотечений при хирургических вмешательствах или инвазивных процедурах у пациентов с гемофилией А или В с ингибиторами фактора VIII или FIX. Лечение rFVIIa усиливает образование тромбина в обход потребности в FVIIIa и/или FIXa. Коагуляция начинается в месте повреждения в результате взаимодействия rFVIIa с ТФ, что приводит к начальной активации FX, образованию тромбина и активации тромбоцитов. Полная коагуляция с помощью rFVIIa может быть достигнута по ТФ-зависимому и ТФ
независимому механизму, в котором часть образовавшегося тромбина может быть образована фактором FX, напрямую активированным rFVIIa на активированных тромбоцитах, который сам связывает активированные тромбоциты за счет низкоаффинных взаимодействий с фосфолипидами мембран.
Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения гемофилии, в том числе для лечения кровотечений и профилактики кровотечений при хирургических вмешательствах или инвазивных процедурах. Модифицированные полипептиды FVII по настоящему документу могут обладать повышенной устойчивостью к АТ-III, увеличенной каталитической активностью, повышенной устойчивостью к ингибиторному действию Zn2+, повышенной устойчивостью к TFPI, улучшенными фармакокинетическими свойствами, такими как период полураспада в сыворотке, увеличенным связыванием и/или аффинностью к активированным тромбоцитам, увеличенным связыванием и/или аффинностью к сывороточному альбумину и/или увеличенным связыванием и/или аффинностью к интегрину тромбоцитов aIIbp3. Поэтому полипептиды FVII проявляют повышенную коагулянтную активность в присутствии ТФ (например, вследствие повышения устойчивости к TFPI) и/или в отсутствие ТФ (например, вследствие увеличения связывания и/или аффинности к активированным тромбоцитам). Таким образом, модифицированные полипептиды FVII могут быть использованы для более активной терапии гемофилии. Примеры улучшений при лечении с использованием модифицированных полипептидов FVII включают, но не ограничиваются, например, более низкие дозы, меньшее и/или более редкое введение, уменьшение побочных эффектов и повышение терапевтического эффекта.
Модифицированные полипептиды FVII, обычно, вводят в виде активированных полипептидов FVII (FVIIa). Модифицированные полипептиды FVII могут быть проверены на терапевтическую эффективность, например, с использованием моделей на животных. Например, модифицированные полипептиды FVII можно применять к мышам с индуцированной антителами гемофилией или испытывать на любой другой известной модели гемофилии. Для оценки последствий модификации полипептидов FVII можно оценивать прогрессирование симптомов заболевания и фенотипы. Модифицированные полипептиды FVII также могут быть введены субъектам при клинических исследованиях для оценки эффективности in vivo по сравнению с контролем плацебо и/или введением немодифицированных FVII.
b. Дефицит фактора FVII.
Дефицит фактора VII представляет собой аутосомно-рецессивное нарушения свертывания крови, которое встречается приблизительно у 1 из 500000 человек. Дефицит FVII может проявляться в клинически легкой, средней или тяжелой форме, причем мягкая и умеренная недостаточность характеризуется повышенной кровоточивостью при операциях и травмах. Пациенты с тяжелой недостаточностью FVII (менее 1% активности FVII) проявляют аналогичные гемофилии симптомы. Например, FVII-дефицитные субъекты склонны к кровоизлияниям в суставы, спонтанным кровотечениям из носа, желудочно-кишечным кровотечениям, кровотечениям из мочевых путей. Также наблюдаются внутримозговые кровоизлияния и кровотечения в мышцах, в то время как женщины могут столкнуться с тяжелой менорраги-ей (тяжелые менструальные кровотечения). Лечение может быть осуществлено путем заместительной терапии. Рекомбинантный продукт FVIIa (Novoseven(r), "Ново Нордиск") был одобрен и лицензирован для лечения кровотечений у больных с врожденным дефицитом FVII и для профилактики кровотечений при хирургических вмешательствах или инвазивных процедурах у пациентов с врожденным дефицитом FVII. Следовательно, предусмотренные здесь модифицированные полипептиды FVII могут быть использованы аналогичным образом. Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы для лечения кровотечений и профилактики кровотечений при хирургических вмешательствах или инвазивных процедурах у FVII-дефицитных пациентов. Например, новорожденному пациенту с тяжелой недостаточностью FVII с внутричерепным кровоизлиянием для стимулирования коагуляции и поддержания гемостаза могут быть введены модифицированные полипептиды FVII внутривенным болюсом. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
c. Другое.
Другие нарушения свертываемости крови можно лечить с помощью полипептидов FVII, предусмотренных в настоящем документе для содействия коагуляции. Врожденные недостатки факторов V и X также приводят к увеличенному времени свертывания крови и могут подвергаться лечению введением терапевтических доз FVII. Например, пациенту с дефицитом фактора X для остановки кровотечения, связанного со спленэктомией, может быть введен rFVIIa (Boggio и др., (2001) Br. J. Haematol. 112:10741075). Спонтанные и вызванные операцией кровотечения при болезни Виллебранда (БВ) также можно лечить с помощью предусмотренных в настоящем документе модифицированных полипептидов FVII. БВ является нарушением свертывания крови, вызванным дефектом или дефицитом белка свертывания крови, фактора Виллебранда (vWF), которое, по оценкам, встречается у 1-2% населения. У пациентов с болезнью Виллебранда легко появляются гематомы, имеют место периодические кровотечения из носа, кровотечения после удаления зубов, тонзиллэктомии или других операций, у женщин-пациентов могут увеличиваться менструальные кровотечения. Модифицированные полипептиды FVII могут быть исполь
зованы для облегчения спонтанных и связанных с операцией кровотечений у пациентов с БВ (von Depka и др., (2006) Blood Coagul Fibrin 17:311-316). Другие связанные с тромбоцитами нарушения свертывания крови, такие как, например, тромбастения Гланцманна и синдром Германски-Пудлака, также связаны со снижением эндогенной коагулянтной активности. Случаи спонтанного или связанного с операцией кровотечения у пациентов со связанными с тромбоцитами нарушения свертывания крови также можно лечить с помощью терапевтических доз модифицированных полипептидов FVII. Например, пациенту с тромбастенией Гланцманна, перенесшему операцию, для предотвращения большой потери крови можно вводить модифицированные полипептиды FVII до, во время и/или после операции (Van Buuren и др., (2002) Dig Dis Sci 47:2134-2136). Обычно, модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
2. Приобретенные нарушения свертываемости крови.
a. Тромбоцитопения вследствие химиотерапии.
Нарушения свертываемости крови также могут быть приобретенными, а не врожденными. Например, химиотерапия при лейкемии и других раковых заболеваниях может привести к тромбоцитопении. Тромбоцитопения, вероятно, развивается из-за потери тромбоцитов в костном мозге больных, получающих химиотерапию, и обычно наступает через 6-10 дней после лечения. Лечение приобретенной тромбо-цитопении, как правило, состоит в переливании тромбоцитов, эритроцитов или плазмы, что служит для предотвращения любых ненормальных спонтанных кровотечений, которые могут быть результатом дефицита тромбоцитов. Кровотечения у пациентов с вызванной химиотерапией тромбоцитопенией или у пациентов с любой другой приобретенной или врожденной тромбоцитопенией также можно лечить введением терапевтических количеств модифицированных полипептидов FVII, предусмотренных в настоящем документе. Например, пациенту с тромбоцитопенией при неконтролируемом кровотечении, например, в желудочно-кишечном тракте для остановки кровотечения может быть введен внутривенный болюс терапевтического количества полипептида FVII (Gerotziafas и др., (2002) Am.. J. Hematol. 69: 219222). Обычно, модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII
(FVIIa).
b. Другие коагулопатии.
Другие приобретенные коагулопатии также можно лечить с помощью модифицированных полипептидов FVII, предусмотренных в настоящем документе. Коагулопатии могут быть следствием состояний, включающих, но не ограничивающихся молниеносной печеночной недостаточностью (FHF, например, вызванной гепатотоксичными лекарствами, токсинами, нарушениями метаболизма, инфекционными заболеваниями и ишемией), другими заболеваниями печени, включая цирроз и заболевания, связанные с болезнью Вильсона, дефицитом витамина K (например, вызванным лечением антибиотиками или диетой), гемолитическим уремическим синдромом, тромботической тромбоцитопенией (ТТЦ) и диссемини-рованным внутрисосудистым свертыванием (ДВС). Обычные методы лечения, как правило, включают переливание плазмы, красных кровяных телец (эритроцитов) или тромбоцитов, но могут быть неудачными. В одном из вариантов модифицированные полипептиды FVII для предотвращения кровотечения можно вводить пациенту с FHF, перенесшему инвазивную процедуру. Обычное лечение свежезамороженной плазмой (СЗП) часто не приносит эффекта и может потребовать большого количества плазмы, что приведет к перегрузке и анасарке (генерализованной инфильтрации подкожной соединительной ткани отечной жидкостью). Лечение терапевтическими количествами модифицированных полипептидов FVII внутривенным болюсом во время, до и/или после хирургического вмешательства, такого как, например, биопсия печени или трансплантация печени, может предотвратить кровотечение и установить гемостаз у больных с FHF. Для определения эффективности лечения у пациента может контролироваться ПВ крови (Shami и др., (2003) Liver Transpl 9:138-143). В другом варианте FVII можно вводить пациенту с тяжелым кровотечением при коагулопатии, таким как, например, тяжелое внутрибрюшное кровотечение после кесарева сечения, связанное с нарушением функции печени и ДВС, которое не поддается лечению обычными переливаниями (Moscardo и др., (2001) Br. J. Haematol. 113: 174-176). Кроме того, модифицированные полипептиды FVII могут быть использованы для лечения коагулопатии у новорожденных и детей. В конкретном варианте новорожденные и дети не реагируют на традиционное лечение, такое как вливание красных кровяных телец и тромбоцитов. Например, новорожденным с тяжелым легочным кровотечением с увеличенным ПВ, которые не отвечают на переливание красных кровяных телец и тромбоцитов, для уменьшения ПВ и установления гемостаза могут быть введены модифицированные полипептиды FVII (Olomu и др., (2002) J. Perinatol 22:672-674). Модифицированные полипептиды FVII, предусмотренные в настоящем документе, проявляют повышенную коагулянтную активность по сравнению с немодифицированными полипептидами FVII и поэтому могут быть введены, например, в более низких дозах, реже и с меньшим количеством побочных эффектов. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
c. Кровотечения при трансплантации.
Тяжелые кровотечения после трансплантации костного мозга (ТКМ) и трансплантации стволовых клеток (ТСК) являются относительно распространенными и опасными для жизни осложнениями, связанными с этими процедурами, возникающими из-за уменьшения количества тромбоцитов. Например, диф
фузное альвеолярное кровотечение (ДАГ) является легочным осложнением ТКМ, затрагивающим 1-21% пациентов при трансплантации, при этом смертность достигает 60-100%. Обычное лечение таких кровотечений включает лечение кортикостероидами и переливание плазмы, тромбоцитов и/или эритроцитов, хотя такое лечение является в значительной степени неудачным с общей смертностью примерно 50% (Hicks и др., (2002) Bone Marrow Transpl 30:975-978). Для лечения ДАГ и установления гемостаза может быть выполнено введение FVII внутривенным болюсом при одновременном лечении кортикостероидами и/или инфузии тромбоцитов или без них (Hicks и др., (2002) Bone Marrow Transpl 30:975-978). Модифицированные полипептиды FVII, предусмотренные в настоящем документе, проявляют повышенную коа-гулянтную активность по сравнению с немодифицированными полипептидами FVII и поэтому могут быть введены, например, в более низких дозах, реже, при более коротком сроке лечения и с меньшим количеством побочных реакций при той же биологической активности и эффективности. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
d. Кровотечения, вызванные антикоагулянтной терапией.
У пациентов, проходящих антикоагулянтную терапию для лечения таких состояний, как тромбоэмболия, могут проявляться кровотечения при остром введении антикоагулянтов, таких как варфарин, гепарин и фондапаринукс, или развиваться геморрагические нарушения в результате долгосрочного использования таких способов лечения. Лечение кровотечений обычно включает введение прокоагулянтов, таких как витамин K, плазмы, экзогенного FIX и протаминов для нейтрализации гепарина. Для нейтрализации действия антикоагулянтов, повышения ПВ, АЧТВ, и/или других маркеров коагуляции и установления гемостаза также может быть введен экзогенный FVII (Deveras и др., (2002) Ann Inten Med 137:884888). Модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы в терапии для остановки кровотечений у пациентов с приобретенными в связи с антикоагу-лянтой терапией нарушениями свертываемости крови. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
e. Приобретенная гемофилия.
Ингибиторы фактора VIII могут спонтанно образоваться у здоровых субъектов, что приводит к состоянию, известному как "приобретенная гемофилия". Приобретенная гемофилия представляет собой редкое состояние с ежегодной встречаемостью 0,2-1,0 случаев на миллион населения. Аутоантитела в основном представляют собой IgG4 антитела, которые при связывании с FVIII ингибируют его активность, препятствуя расщеплению тромбина, взаимодействию с фактором Виллебранда и/или связыванию фосфолипидов. Это приводит к опасным для жизни кровоизлияниям у приблизительно 87% пациентов. Обычные места кровотечения включают кожу, слизистые оболочки, мышцы и забрюшинное пространство в отличие от пациентов с наследственной гемофилией, у которых кровотечения локализованы преимущественно в суставах и мышцах. Приобретенную гемофилию можно лечить с помощью концентрата активированного протромбинового комплекса или рекомбинантного активированного фактора VII (No-voseven(r), "Ново Нордиск"). Модифицированные полипептиды FVII, предусмотренные в настоящем документе, проявляют повышенную коагулянтную активность по сравнению с немодифицированными полипептидами FVI, и поэтому могут быть введены, например, в более низких дозах, реже, при более коротком сроке лечения и с меньшим количеством побочных реакций при той же биологической активности и эффективности. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
3. Кровотечение при травмах и хирургическом вмешательстве.
Полипептиды FVII могут быть использованы в качестве терапии для лечения кровотечений, связанных с периоперационной и травматической потерей крови у субъектов с нормальной системой коагуляции. Например, полипептиды FVII можно вводить пациенту для содействия свертыванию крови и уменьшения потерь, связанных с операцией и, кроме того, для уменьшения потребности в переливании крови. В одном из вариантов, полипептиды FVII могут быть введены субъекту, подвергающемуся поза-дилонной простатэктомии. Позадилонная простатэктомия часто сопровождается большой потерей крови и последующей необходимостью в переливании. Субъектам, подвергающимся такой или подобной операции, для уменьшения периоперационной кровопотери путем повышения свертывания в месте операции можно ввести внутривенный болюс с терапевтическим количеством FVII на раннем этапе операции. Достигнутое уменьшение потери крови устраняет необходимость в переливании крови у этих больных (Friedrich и др., (2003) Lancet 361: 201-205). Полипептиды FVII могут быть введены пациентам с нормальной коагуляцией для достижения быстрого гемостаза и предотвращения потери крови при других видах хирургии. Не ограничивающие примеры хирургических процедур, при которых для уменьшения периоперационного кровотечения может быть введен FVII, как правило, в активированной форме (т.е. FVIIa), включают, но не ограничиваются, операции на сердечных клапанах (Al Douri и др., (2000), Blood Coag Fibrinol 11: 121-127), замену аортального клапана (Kastrup и др., (2002) Ann Thorac Surg 74:910912), резекцию периодической гемангиоперицитомы (Gerlach и др., (2002). J. Neurosurg 96:946-948), резекцию рака груди (Sajdak и др., (2002). Eur. J. Gynaecol Oncol. 23: 325-326) и операциями на двенадцатиперстной кишке (Vlot и др., (2000) Am. J. Med. 108:421-423). Лечение FVII может способствовать установлению гемостаза в месте операции и уменьшить или предотвратить потерю крови, тем самым умень
шая или упраздняя необходимость переливания крови. Предусмотренные здесь модифицированные полипептиды FVII проявляют повышенную коагулянтную активность по сравнению с немодифицирован-ным полипептидом FVII и поэтому могут быть введены, например, в более низких дозах, реже и с меньшим количеством побочных реакций.
Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII
(FVIIa).
Полипептиды фактора VII также могут быть использованы для содействия коагуляции и предотвращения потери крови у пациентов с травмами. Травма определяется как повреждение живой ткани внешним агентом и является четвертой по значимости причиной смерти в Соединенных Штатах. Травмы классифицируют на тупую травму (приводит к внутреннему сжатию, повреждению органов и внутреннему кровотечению) и проникающую травму (является следствием проникновения агента в тело и уничтожения тканей, сосудов и органов, приводит к наружному кровотечению). Травма может быть вызвана несколькими событиями, включая, но не ограничиваясь дорожно-транспортными происшествиями (причинение тупой и/или проникающей травмы), огнестрельными ранениями (причинение проникающее травмы), колющими ранениями (причинение проникающей травмы), несчастными случаями при работе с механизмами (причинение проникающей и/или тупой травмы) и падением со значительной высоты (причинение проникающей и/или тупой травмы). Неконтролируемое кровотечение, возникшее вследствие травмы, ответственно за большую часть связанных с травмой смертельных случаев. Диффузная коагуло-патия является относительно частым осложнением, связанным с травмой, встречающимся у 25-36% пациентов с травмой. Коагулопатия может развиваться вскоре после травмы в результате различных факторов, таких как разведение и потребление факторов свертывания крови и тромбоцитов, фибринолиз, ацидоз и гипотермия. Обычное лечение включает заместительную терапию при переливании свежезамороженной плазмы (СЗП), тромбоцитов, эритроцитов и/или криопреципитата, коррекцию ацидоза и лечения гипотермии. Эти меры часто являются недостаточными для остановки кровотечения и предотвращения смертельного исхода. Лечение введением терапевтического количества FVII может способствовать коагуляции и уменьшить потерю крови у пациента с травмой. Например, пациенту с огнестрельным ранением и большой кровопотерей, в дополнение к хирургическому вмешательству для контроля коагуло-патии и кровотечения может быть введен FVII (Kenet и др., (1999) Lancet 354:1879). Коагулянтная терапия FVII может эффективно уменьшить потерю крови и кровотечение у пациентов с тупой и проникающей травмой (Rizoli и др., (2006) Crit Care 10:R178). Предусмотренные здесь модифицированные полипептиды FVII проявляют повышенную коагулянтную активность по сравнению с немодифицированным полипептидом FVII и поэтому могут быть введены, например, в более низких дозах, реже и с меньшим количеством побочных реакций. Обычно модифицированные полипептиды FVII вводят в виде активированных полипептидов FVII (FVIIa).
I. Комбинированная терапия.
Любые модифицированные полипептиды FVII, описанные здесь, могут быть введены в комбинации с другим терапевтическим агентом или процедурой одновременно, периодически или последовательно, где агент или процедура включает, но не ограничивается другим биологическим агентом, низкомолекулярным соединением и хирургией. Для любого заболевания или состояния, включая все приведенные в качестве примеров выше заболевания и состояния, для которых FVII (в том числе FVIIa и rFVIIa) показан или был использован и для которых доступны другие агенты и лечение, FVII может быть использован в комбинации. Следовательно, модифицированные полипептиды FVII, предусмотренные в настоящем документе, могут быть использованы аналогично. В зависимости от заболевания или состояния, подлежащего лечению, примеры комбинаций включают, но не ограничиваются комбинациями с другими очищенными из плазмы или рекомбинантными факторами свертывания, прокоагулянтами, такими как витамин K, производные витамина K и ингибиторы белка С, плазмой, тромбоцитами, эритроцитами и кортикостероидами.
J. Изделия и комплекты.
Модифицированные полипептиды FVII или нуклеиновые кислоты, кодирующие модифицированные полипептиды FVII, их производные или их биологически активные части могут быть упакованы в виде изделия, содержащего упаковочный материал, фармацевтическую композицию, которая является эффективной для лечения заболевания или нарушения свертывания крови, и этикетку, которая указывает, что модифицированные полипептиды FVII или молекулы нуклеиновой кислоты могут использоваться для лечения заболевания или нарушения свертывания крови. В настоящем документе предусмотрены изделия, содержащие упаковочный материал. Упаковочные материалы, используемые для упаковки фармацевтических препаратов, хорошо известны специалистам в данной области. См., например, патенты США №№ 5323907, 5052558 и 5033352, каждый из которых включен здесь в полном объеме. Примеры фармацевтических упаковочных материалов включают, но не ограничиваются блистерной упаковкой, бутылкой, тюбиком, ингалятором, насосом, пакетом, флаконом, контейнером, шприцем и любым упаковочным материалом, подходящим для выбранной композиции, способа введения и лечения. Широкий спектр предусмотренных здесь рецептур и композиций с соединениями по изобретению предназначен для разнообразных методов лечения любого заболевания или нарушения свертывания крови.
Модифицированные полипептиды FVII и молекулы нуклеиновых кислот также могут быть предусмотрены в виде комплектов. Комплекты могут включать фармацевтическую композицию, описанную здесь, и устройство для введения. Например, модифицированные полипептиды FVII могут поставляться с устройством для введения, таким как шприц, ингалятор, дозировочный колпачок, пипетка или аппликатор. Комплект, при необходимости, может включать инструкции для применения с указанием дозы, режима дозирования и инструкции по способу введения. Комплекты также могут включать фармацевтическую композицию, описанную здесь, и устройство для диагностики. Например, такие комплекты могут включать устройство для измерения концентрации, количества или активности FVII или регулируемой FVII системы у субъекта.
Следующие примеры приведены в иллюстративных целях и не предназначены для ограничения объема изобретения.
K. Примеры.
Пример 1. Клонирование и экспрессия FVII.
A. Клонирование FVII.
Нуклеотидные последовательности, кодирующие полипептид предшественник изоформы человеческого FVII из 466 аминокислот (Р08709, приведен в SEQ ID NO: 1), клонированы в вектор экспрессии млекопитающих pCMV Script (Stratagene; SEQ ID NO: 99), который содержит промотор цитомегаловиру-са (ЦМВ). Олигонуклеотиды СВО-125 (SEQ ID NO 100) и СВО-126 (SEQ ID NO: 101) были использованы в качестве прямого и обратного праймеров, соответственно, для амплификации последовательности FVII с помощью ПЦР с использованием кДНК человеческого FVII (Invitrogen) в качестве матрицы. Праймер СВО-125 содержал сайт рестрикции BamHI (выделен жирным шрифтом), последовательность Козака (двойное подчеркивание) и 18 нуклеотидов, гомологичных 5'-концу последовательности кДНК FVII (подчеркнуты), включая стартовый кодон ATG. Праймер СВО-126 содержал сайт рестрикции EcoRI (выделен жирным шрифтом), стоп-кодон (двойное подчеркивание) и 21 нуклеотид, гомологичные 3'-концу последовательности кДНК FVII (подчеркнут).
СВО-125 прямой праймер 5'gcatcatgacgtgacggatccgccaccatggtctcccaggccctc3' СВО-126 обратный праймер 5'gatcgtacgatacgtgaattcctagggaaatggggctcgcaggag3'
Была использована стандартная реакция ПЦР и условия термоциклирования в сочетании с комплектом для ПЦР KoD HiFi PCR kit (EMD Biosciences) в соответствии с рекомендациями производителя. ПЦР-продукт расщепляли ферментами рестрикции BamHI и EcoRI и лигировали по сайтам рестрикции BamHI и EcoRI в pCMV Script вектор с использованием стандартных молекулярных методик. Вектором была трансформирована Escherichia coli. Были выращены выбранные колонии и были получены бактериальные клетки для очистки плазмид с помощью обычных методов молекулярной биологии.
B. Получение вариантов FVII.
Варианты FVII были получены с помощью комплекта для сайт-направленного мутагенеза Quik-Change II XL Site-Directed Mutagenesis kit (Stratagene) в соответствии с инструкциями производителя с использованием специально разработанных олигонуклеотидов, которые служили в качестве праймеров для включения конкретных мутаций во вновь синтезированные молекулы ДНК. Метод QuikChange предполагает линейную амплификацию матрицы ДНК с помощью высокоточной ДНК-полимеразы Pfu-Ultra. Комплементарные праймеры, включающие желаемые мутации, удлинились в процессе реакции с использованием очищенного двухцепочечного суперспирального pCMV Script вектора, содержащего клонированную кДНК FVII в качестве матрицы. Удлинение праймеров привело к включению желаемой мутации во вновь синтезированные цепи, что привело к мутированной плазмиде с расположенными уступом никами. После амплификации нуклеиновые кислоты обрабатывали DpnI, которая расщепляла Dam-метилированные родительские нити полученного в Е. coli pCMV Script вектора. Это привело к "отбору" новосинтезированных мутированных плазмид, которые не были метилированы. Векторной ДНК, содержащей желаемую мутацию (мутации), трансформировали ультракомпетентные клетки E.coli XLlO-Gold, в которых бактериальная лигаза подвергла ники репарации, что позволило произойти нормальной репликации. В табл. 13 ниже приведены полученные варианты FVII.
Были получены варианты FVII, в которых в различные районы полипептида FVII была вставлена связывающая интегрин тромбоцитов aIIbp3 последовательность. В полипептид вставляли одну из трех различных связывающих интегрин aIIbp3 последовательностей: SFGRGDIRNV (SEQ ID NO: 110); CSFGRGDIRNVC (SEQ ID NO: 111) или GGGSCSFGRGDIRNVC (SEQ ID NO: 112). Связывающую интегрин aIIbp3 последовательность вставляли в С-конец полипептида FVII после аминокислотного остатка Р406 по нумерации зрелого FVII или последовательность вставляли, удаляя и заменяя аминокислотные остатки FVII с S103 до S111, с H115 до S126 или с Т127 до Р134 по нумерации зрелого FVII. Также были получены другие варианты FVII, в которых была вставлена связывающая сывороточный альбумин последовательность. Эти варианты FVII содержали одну из семи различных связывающих сывороточный альбумин последовательностей: QRLMEDICLPRWGCLWEDDF (SEQ ID NO: 103), IEDICLPRWGCLWE (SEQ ID NO: 104), DICLPRWGCLWED (SEQ ID NO: 105), IEDICLPRWGCLW (SEQ ID NO: 106), GGGSIEDICLPRWGCLW (SEQ ID NO: 107), DICLPRWGCLWED (SEQ ID NO: 108) или
GGGSDICLPRWGCLWED (SEQ ID NO: 109).
Связывающую сывороточный альбумин последовательность вставляли в С-конец полипептида FVII после аминокислотного остатка Р406 по нумерации зрелого FVII или последовательность вставляли, удаляя и заменяя аминокислотные остатки FVII с S103 до S111, с H115 до S126 или с Т128 до Р134 по нумерации зрелого FVII.
Варианты FVII с "заменой Gla из FIX" (т.е. полипептиды FVII, в которых эндогенный домен Gla был заменен на домен Gla из FIX) содержат аминокислотные остатки с Y1 до Y45 из SEQ ID NO: 83 на N-конце. В некоторых примерах, варианты с "заменой Gla из FIX" содержат одну или несколько замен аминокислот в домене Gla из FIX. Мутации, которые находятся в домене Gla из FIX, приведены в фигурных скобках и указаны с использованием аминокислотных позиций, соответствующих аминокислотным позициям в зрелом полипептиде FIX дикого типа, или в домене Gla дикого типа из FIX, приведенном в SEQ ID NO: 83. Например, {замена Gla из FIX/M19K} означает, что модифицированный полипептид FVII содержит гетерологичный Gla домен из FIX, в которой метионин в положении 19 домена Gla из FIX, приведенном в SEQ ID NO: 83, заменен на лизин. В табл. 13 ниже приведены аминокислотные остатки, по которым в полипептид FVII тромбоцитов вставлены связывающие интегрин aIIbp 3 или сывороточный альбумин последовательности, и последовательности аминокислот связывающих последовательностей. Например, Н115S126удаление/вставкад QRLMEDICLPRWGCLWEDDF означает, что аминокислотные остатки с Н115 до S126 были удалены и заменены связывающей сывороточный альбумин последовательностью QRLMEDICLPRWGCLWEDDF (SEQ ID NO: 103).
Таблица 13
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
Q286R/K341D
Q143R/K192D
151
Q286R/Q366D
Q143R/Q217D
152
Q286R/Q366N
Q143R/Q217N
153
Q286R/M298Q/Q366D
Q143R/M156Q/Q217D
154
Q286R/M298Q/Q366N
Q143R/M156Q/Q217N
155
Q286R/H373F
Q143R/H224F
156
Q286R/M298Q/H373F
Q143R/M156Q/H224F
157
T239S
T99S
159
T239N
T99N
160
T239Q
T99Q
161
T239V
T99V
162
T239L
T99L
163
Т239Н
Т99Н
164
T239I
T99I
165
Р321К
P170iK
166
Р321Е
P170iE
167
P321Y
P170iY
168
P321S
P170iS
169
Q366D
Q217D
170
Q366E
Q217E
171
Q366N
Q217N
172
Q366T
Q217T
173
Q366S
Q217S
174
Q366V
Q217V
175
Q366I
Q217I
176
Q366L
Q217L
177
Q366M
Q217M
178
H373D
H224D
179
Н373Е
H224E
180
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO полипептида FVII
H373S
H224S
181
H373F
H224F
182
Н373А
Н224А
183
Q366D/H373E
Q217D/H224E
184
Q366V/H373V
Q217V/H224V
185
Q366V/H373L
Q217V/H224L
186
Q366V/H373I
Q217V/H224I
187
K161S
K24S
188
К161А
К24А
189
K161V
K24V
190
H216S
H76S
191
Н216А
Н76А
192
Н216К
Н76К
193
H216R
H76R
194
S222A
S82A
195
S222K
S82K
196
S222V
S82V
197
S222D
S82D
200
S222N
S82N
198
S222E
S82E
199
Н257А
Н117А
201
H257S
H117S
202
S222K/H257A
S82K/H117A
203
Н216А/Н257А
Н76А/Н117А
204
H216A/S222A
H76A/S82A
205
S52A
S[52]A
206
S60A
S[60]A
207
E394N/P395A/R396S
E245N/P246A/R247S
208
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
R202S
R62S
209
A292N/A294S
A150N/A152S
210
G318N
G170fN
211
A175S
A39S
212
K109N
K-26N
213
A122N/G124S
A[122]N/G[124]S
214
A51N
A-84N
215
T130N/E132S
T[130]N/E[132]S
216
S50A/S62A
S[50]A/S[62]A
217
А122N/G124S/E3 94N/P395A/R39 6S
A[ 122]N/G[ 124] S/E245N/P246A/R247S
218
A122N/G124S/E394N/P395A/R39 6S/ G318N
A[l 22]N/G[ 124] S/E245N/P246A/R247S/G 170fN
219
S52N/P54S
S[52]N/P[54]S
220
S119N/L121S
S[119]N/L[121]S
221
T128N/P129A
T[128]N/P[129]A
222
Q66N/Y68S
Q[66]N/Y[68]S
223
S52N/P54S/A122N/G124S/E3 94N /P395A/R396S
S [52]N/P[54] S/A[ 122]N/G[ 124] S /E245N/P246A/R247S
224
K109N/A292N/A294S
[K109N]/A150N/A152S
225
K109N/A175S
[K109N] /A39S
226
V158T/L287T/M298K
V21T/L144T/M156K
256
V158D/L287T/M298K
V21D/L144T/M156K
257
S103 S111 удаление/BCTaBKaQRL MEDICLPRWGCLWEDDF
S[103]S[111]удаление/вставка0ДЕМЕО1 CLPRWGCLWEDDF
227
HI 15 S126yflaneHne/BCTaBKaQRL MEDICLPRWGCLWEDDF
H[l 15]8[126]удаление/вставкаОДЕМЕ01 CLPRWGCLWEDDF
228
Т128Р13 4удаление/BCTaBKaQRL MEDICLPRWGCLWEDDF
T[128]P[134] удаление/BCTaBKaQRLMEDI CLPRWGCLWEDDF
229
S103S111удаление/вставка1Е01С LPRWGCLWE
S[103]S[111]удаление/вставка1ЕОКХРК WGCLWE
230
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
Н115 S126удаление/вставка1Е01 CLPRWGCLWE
H[ 115] S [ 126]yflaneHne/BCTaBKaIEDICLPR WGCLWE
231
Т128Р134удаление/вставка1Е01С LPRWGCLWE
T[ 128]P[ 13 4] удаление/BCTaBKalEDICLPR WGCLWE
232
SI 03 SI 11удаление/вставка01СЕ PRWGCLWED
S[103]S[111 JyflaneHHe/BcraBKaDICLPRW GCLWED
233
HI 158126удаление/вставка01СЕ PRWGCLWED
H[ 115] S [ 126]yflMeHHe/BCTaBKaDICLPRW GCLWED
234
T128P134удаление/вставкаОЮЕ PRWGCLWED
T[128]P[134]yдaлeниe/вcтaвкaDICLPRW GCLWED
235
P406BCTaBKaIEDICLPRWGCLW
P257BCTaBKaIEDICLPRWGCLW
236
P406BCTaBKaGGGSIEDICLPRWG CLW
P257BCTaBKaGGGSIEDICLPRWGCLW
237
P406BCTaBKaDICLPRWGCLWED
P257BCTaBKaDICLPRWGCLWED
238
P406BCTaBKaGGGSDICLPRWGC LWED
P257BCTaBKaGGGSDICLPRWGCL WED
239
S103 S111 удаление/BCTaBKaSFGR GDIRNV
S[103]S[11 l]yдaлeниe/вcтaвкaSFGRGDIR NV
240
HI 15S126yn,aneHHe/BcraBKaSFGR GDIRNV
H[115]S[126] удаление/BCTaBKaSFGRGDI RNV
241
T127P134yflaneHHe/BCTaBKaSFGR GDIRNV
T[ 128]P[ 134]ynЈuieHHe/BCTaBKaSFGRGDIR NV
242
P406BCTaBKaCSFGRGDIRNVC
P257BCTaBKaCSFGRGDIRNVC
243
P406BCTaBKaGGGS С SF GRGDIR NVC
P257BCTaBKaGGGS С SF GRGDIRN VC
244
Замена Gla FIX/S222A
Замена Gla FIX/S82A
245
Замена Gla FIX/H257A
Замена Gla FIX/HI 17A
246
Замена Gla FIX/S222A/H257A
Замена Gla FIX/S82A/H117A
247
S222A/M298Q
S82A/M156Q
248
H257A/M298Q
H117A/M156Q
249
S222A/H257A/M298Q
S82A/H117A/M156Q
250
S222A/A292N/A294S/Q366V
S82A/A150N/A152S/Q217V
251
A175S/S222A/Q366V
A39S/S82A/Q217V
252
S222A/Q366V
S82A/Q217V
253
H257S/Q366V
H117S/Q217V
254
S222A/H373A
S82A/H224A
255
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO полипептида FVII
S103 S111 удаление/BcraBKaIEDIC LPRWGCL WE/G237V
S[103]S[11 ^удаление/BCTaBKaIEDICLPR WGCLWE/G97V
258
SI 03 SI 11удаление/вставка01СЬ PRWGCL WED/G23 7V
S[103]S[11 l]yдaлeниe/вcтaвкaDICLPRW GCLWED/G97V
259
H115 S126удаление/вставкаОДЬ MEDICLPRWGCLWEDDF/G237
H [ 115] S [ 126]удаление/вставкаОДЕМЕ01 CLPRWGCLWEDDF/G97V
260
H115 S126удаление/вставка1Е01 CLPRWGCLWE/G237V
H[ 115] S [ 126]удал ение/BCTaBKaIEDICLPR WGCLWE/G97V
261
HI 158126удаление/вставка01СЬ PRWGCLWED/G23 7V
H [ 115] S [ 126]yflaneHHe/BCTaBKaDICLPRW GCLWED/G97V
262
Т128Р13 4yflaneHne/BCTaBKaQRL MEDICLPRWGCLWEDDF/G23 7
T[ 128]P[ 134]удаление/вставкаОДЕМЕВ1 CLPRWGCLWEDDF/G97V
263
Tl 28P134удаление/вставка1Е01С LPRWGCL WE/G23 7V
T[ 128]P[ 134]yдaлeниe/вcтaвкaIEDICLPR WGCLWE/G97V
264
S103 S111 удаление/BCTaBKaQRL MEDICLPRWGCLWEDDF/G237
S[103]S[11 ^удаление/BCTaBKaQRLMEDI CLPRWGCLWEDDF/G97V
265
T12 8P13 4y дал ение/вставкаО 1С L PRWGCLWED/G237V
T[128]P[134]yдaлeниe/вcтaвкaDICLPRW GCLWED/G97V
266
SI 03 SI 1 ^MeHHe/BcraBKaSFGR GDIRNV/G237V
S[103]S[11 l]yдaлeниe/вcтaвкaSFGRGDIR NV/G97V
267
HI 15S126yдaлeниe/вcтaвкaSFGR GDIRNV/G237V
H [ 115] S [ 126]yдaлeниe/вcтaвкaSFGRGDI RNV/G97V
268
T128P134yдaлeниe/вcтaвкaSFGR GDIRNV/G237V
T[l 28]P[ 134]ynЈweHHe/BcraBKaSFGRGDIR NV/G97V
269
M298Q/H373F
M156Q/H224F
270
S119N/L121S/A175S
S[119]N/L[121]S/A39S
271
T128N/P129A/A175S
T[128]N/P[129]A/A39S
272
A122N/G124S/A175S
A[122]N/G[124]S/A39S
273
{Замена Gla
FIX/E40L}/Q286R/M298Q
{Замена Gla FIX/E[40]L}/Q143R/M156Q
274
{Замена Gla
FIX/K43I}/Q286R/M298Q
{Замена Gla FIX/K[43]I}/Q143R/M156Q
275
{Замена Gla
FIX/Q44S }/Q286R/M298Q
{Замена Gla FIX/Q[44]S}/Q143R/M156Q
276
{Замена Gla
{Замена Gla FLX/M[19]K}/Q143R/M156Q
277
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
FIX/MI 9K}/Q286R/M298Q
{Замена Gla
FIX/MI 9K/E40L/K43I/Q44S }/Q2 86R/M298Q
{Замена Gla
FIX/M[19]K/E[40]L/K[43]I/Q[44]S}/Q143 R/M156Q
278
T128N/P129A/Q286R
T[128]N/P[129]A/Q143R
279
T128N/P129A/Q286R/M298Q
T[128]N/P[129]A/Q143R/M156Q
280
T128N/P129A/Q286R/H373F
T[128]N/P[129]A/Q143R/H224F
281
V158D/Q286R/E296V/M298Q
V21 D/Q 143R/E154V/M15 6Q
282
Tl 28N/P129A/V158D/E296V/M2 98Q
T[128]N/P[129]A/V21D/E154V/M156Q
283
T128N/P129A/S222A
T[128]N/P[129]A/S82A
284
Замена Gla
FIX/T128N/P129A/S222A/Q286R
Замена Gla
FIX/T[128]N/P[129]A/S82A/Q143R
285
Замена Gla FIX/ T128N/P129A/Q286R/M298Q
Замена Gla FIX/
T[ 128]N/P [ 129] A/Q 143R/M156Q
286
T128N/P129A/S222A/H257A/Q28 6R/M298Q
T[128]N/P[129]A/S82A/H117A/Q143R/M1 56Q
287
Tl 28N/P129 A/Q286R/M298Q/H3 73F
T[128]N/P[129]A/Q143R/M156Q/H224F
288
S52A/S60A/V158D/E296V/M298
S [52] A/S[60] A/V21D/E154V/M156Q
289
S52A/S60A/Q286R
S[52]A/S[60]A/Q143R
290
S52A/S60A/S222A
S[52]A/S[60]A/S82A
291
Замена Gla FIX/ S52A/S60A/S222A/Q286R
Замена Gla
FIX/S[52]A/S[60]A/S82A/Q143R
292
S52A/S60A/Q286R/M298Q
S[52]A/S[60]A/Q143R/M156Q
293
S52A/S60A/S222A/H257A/Q286 R/M298Q
S[52]A/S[60]A/S82A/H117A/Q143R/M156
298
S52A/S60A/Q286R/H373F
S[52]A/S[60]A/Q143R/H224F
296
S52A/S60A/ Q286R/M298Q/H373F
S[52]A/S[60]A/Q143R/M156Q/H224F
297
V15 8D/T239V/E296V/M298Q
V21D/T99V/E154V/M156Q
298
T239V/Q286R
T99V/Q143R
299
S222A/T239V
S82A/T99V
300
Замена Gla
FIX/S222A/T239V/Q286R
Замена Gla FIX/S82A/T99V/Q143R
301
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
T239V/Q286R/M298Q
T99V/Q143R/M156Q
302
S222A/T239V/H257A/Q286R/M2 98Q
S82A/T99V/H117A/Q143R/M156Q
303
Замена Gla
FIX/T239V/Q286R/M298Q
Замена Gla FIX/T99V/Q143R/M156Q
304
T239V/Q286R/H373F
T99V/Q143R/H224F
305
T239V/Q286R/M298Q/H373F
T99V/Q143R/M156Q/H224F
306
VI58D/T239I/E296V/M298Q
V21D/T99I/E154 V/M 156Q
307
T239I/Q286R
T99I/Q143R
308
S222A/T239I
S82A/T99I
309
Замена Gla
FIX/S222A/T239I/Q286R
Замена Gla FIX/S82A/T99I/Q143R
310
T239I/Q286R/M298Q
T99I/Q143R/M156Q
311
S222A/T239I/H257A/Q286R/M29 8Q
S82A/T99I/H117A/Q143R/M156Q
312
Замена Gla FIX/ T239I/Q286R/M298Q
Замена Gla FIX/T99I/Q143R/M156Q
313
T239I/Q286R/H373F
T99I/Q143R/H224F
314
T239I/Q286R/M298Q/H373F
T99I/Q143R/M156Q/H224F
315
Замена Gla FIX/ S222A/Q286R/H373F
Замена Gla FIX/S82A/Q143R/H224F
316
Замена Gla
FIX/S222A/Q286R/M298Q
Замена Gla FIX/S82A/Q143R/M156Q
317
Замена Gla FIX/ S222A/Q286R/M298Q/H373F
Замена Gla
FIX/S82A/Q143R/M156Q/H224F
318
V158D/E296V/M298Q/H373F
V21D/E154V/M156Q/H224F
319
V158D/Q286R/E296V/M298Q/H3 73F
V21 D/Q 143 R/E 154V/M15 6Q/H224F
320
H257A/Q286R/M298Q
H117A/Q143R/M156Q
321
H257S/Q286R/M298Q
H117S/Q143R/M156Q
322
Замена Gla FIX/ S222A/H257S/Q286R
Замена Gla FIX/S82A/H117S/Q143R
323
S222A/H257S/Q286R/M298Q
S82A/H117S/Q143R/M156Q
324
H257S/Q286R/M298Q/H373F
HI 17S/Q143R/M156Q/H224F
325
S222A/Q286R/M298Q/H373F
S82A/Q143R/M156Q/H224F
326
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO полипептида FVII
Замена Gla FIX/Q366V
Замена GlaFIX/Q217V
327
S222A/Q286R/M298Q
S82A/Q143R/M156Q
328
T128N/P129A/A175S/Q366V
T[128]N/P[129]A/A39S/Q217V
329
А122N/G124S/A175 S/Q3 66V
A[ 122]N/G[ 124] S/A3 9S/Q217 V
330
T128N/P129A/A175S/S222A
T[128]N/P[129]A/A39S/S82A
331
А122N/G124S/A175 S/S222А
A[ 122]N/G[ 124] S/A39S/S82 A
332
T128N/P129A/A175S/Q286R
T[ 128]N/P[ 129] A/A39S/Q143R
333
A122N/G124S/A175S/Q286R
A[ 122]N/G[ 124] S/A3 9S/Q143R
334
Замена Gla
FIX/T128N/P129А/А175S/S222А/ Q286R
Замена Gla
FIX/T[128]N/P[129]A/A39S/S82A/Q143R
335
Замена Gla
FIX/A 122N/G124S/A175S/S222A /Q286R
Замена Gla
FIX/A[ 122]N/G[ 124]S/A39S/S82 A/Q 143R
336
Tl 28N/P129А/А175 S/Q286R/M2 98Q
T[128]N/P[129]A/A39S/Q143R/M156Q
337
А122N/G124S/A175 S/Q286R/M2 98Q
A[ 122]N/G[ 124] S/A39S/Q143R/M156Q
338
T128N/P129A/A175S/S222A/H25 7A/Q286R/M298Q
T[128]N/P[129]A/A39S/S82A/H117A/Q14 3R/M156Q
339
А122N/G124S/A175 S/S222А/Н25 7A/Q286R/M298Q
A[ 122]N/G[ 124] S/A3 9 S/S 82 A/H117 A/Q 14 3R/M156Q
340
Т128N/P129 А/А17 5 S/Q286R/M2 98Q/H373F
T[128]N/P[129]A/A39S/Q143R/M156Q/H2 24F
341
A122N/G124S/A175S/Q286R/M2 98Q/H373F
A[ 122]N/G[ 124] S/A3 9S/Q143 R/M156Q/H 224F
342
T128N/P129A/M298Q
T[128]N/P[129]A/M156Q
354
{Замена Gla FIX
/К431}/Т 128N/P129A/Q286R/M2 98Q
{Замена Gla FIX /K[43]I}/ T[128]N/P[129]A/Q143R/M156Q
355
Т128N/P129 A/Q286R/M298Q/Q3 66N
T[128]N/P[129]A/Q143R/M156Q/Q217N
356
{Замена Gla FIX /K43I}/Q286R/M298Q/Q366N
{Замена Gla FIX /K[43]I}/Q143R/M156QQ217N
357
{Замена Gla FIX /К431}/
T128N/P129A/Q286R/M298Q/Q3
66N
{Замена Gla FIX /K[43]I}/ T[128]N/P[129]A/Q143R/M156QQ217N
358
Вариант (по нумерации зрелого FVII)
Вариант (по нумерации химотрипсина)
SEQ ID NO
полипептида FVII
T128N/P129A/M298Q/H373F
Т[ 128JN/P [ 129] А/М15 6Q/H224F
359
V158D/Q286R/E296V/M298Q
V21D/Q143R/E154V/M156Q
360
M298Q/Q366N/H373F
M156Q/Q217N/H224F
361
T239V/M298Q/H373F
T99V/M156Q/H224F
362
T239I/M298Q/H373F
T99I/M156Q/H224F
363
T128N/P129A/Q286R/M298Q/Q3 66N/H373F
Т[ 128]N/P[ 129] A/Q 143R/M156Q/Q217N/ H224F
364
T239V/Q286R/M298Q/Q366N
T99V/Q143R/M156Q/Q217N
365
T239I/Q286R/M298Q/Q366N
T99I/Q143 R/M 156Q/Q217N
366
Т128N/P129A/T239V/Q286R/M2 98Q
T[128]N/P[129]A/T99V/Q143R/M156Q
367
Tl 28N/P129A/S222A/T239V/H25 7A/Q286R/M298Q
T[ 128]N/P[ 129] A/S82 A/T99V/H117 A/Q 14 3R/M156Q
368
Т128N/P129A/T239V/Q286R/M2 98Q/H373F
T[ 128]N/P [ 129] A/T99V/Q143 R/M 156Q/H2 24F
369
Tl 28N/P129A/T239I/Q286R/M298Q
T[128]N/P[129]A/T99I/Q143R/M156Q
370
Tl 28N/P129A/T239I/Q286R/M298Q/ H373F
T[128]N/P[129]A/T99I/Q143R/M156Q/ H224F
371
С. Экспрессия полипептидов FVII.
Для первичного анализа экспрессии с помощью ИФА и Вестерн-блоттинга полипептиды FVII экс-прессировали в ВНК-21 клетках. Для биохимических анализов, таких как описано ниже, полипептиды FVII экспрессировали в Freestyle(tm) 293-F клетках (Invitrogen). Полипептид фактора VII дикого типа (SEQ ID NO: 3) и варианты полипептида FVII первоначально экспрессировали в линии клеток почки детеныша хомяка BHK-21 (АТСС CRL 1632). BHK-21 клетки культивировали в минимальной среде Игла (ЕМЕМ, Invitrogen) с 10% эмбриональной телячьей сыворотки (ЭТС) в 100 мм культуральных чашках при 37°С и 5% СО2. После роста примерно до 90% покрытия клетки трансфицировали 24 мкг плазмидной ДНК FVII с использованием набора Lipofectamine 2000 Kit (Invitrogen) в соответствии с инструкциями производителя. Среду сменили через 6 ч после трансфекции на ЕМЕМ среду без сыворотки, содержащую 1 мкг/мл витамина K1 (Sigma), и инкубировали еще 72 ч. Экспрессию FVII в культуральную среду определяли методом ИФА или Вестерн-блоттинга.
Для последующего анализа с помощью биохимических методов, полипептид фактора VII дикого типа (SEQ ID NO: 3) и варианты полипептида FVII экспрессировали в Freestyle(tm) 293-F клетках (Invitro-gen). Клетки культивировали в Freestyle(tm) 293 среде (Invitrogen) при 37°С и 8% СО2 в колбах Эрленмейе-ра с вентилируемыми крышками. Клетки трансфецировали по протоколу производителя. После роста до плотности 1x10 клеток/мл клетки центрифугировали и меняли среду. Затем клетки трансфецировали 240 мкг плазмидной ДНК FVII на каждые 240 мл клеток с использованием 293fectin (Invitrogen). Кроме того, на каждые 240 мл клеток было добавлено 50 мкл 1 мг/мл раствора витамина K1 (Sigma) в этаноле. Клетки выращивали в течение 5 дней, после чего собирали культуральный супернатант. Экспрессию FVII в культуральную среду определяли методом ИФА.
В некоторых примерах варианты полипептида FVII и FVII дикого типа экспрессировали в CHO-Express (СНОХ) клетках (Excellgene). CHO Express (СНОХ) клетки держали в полной среде DM202 (SAFC BioSciences) и использовали в качестве культуры для инокуляции продуцирующих культур. Культуры для инокуляции выращивали до плотности 5x10 жизнеспособных клеток/мл и около 60 мл культуры использовали инокуляции приблизительно 0,6 л полной среды DM202 (плотность инокуляции составляла 0,4x106 жизнеспособных клеток/мл) для получения продуцирующей культуры. Продуцирующую культуру выращивали в течение 4 дней для достижения плотности 8-12x106 жизнеспособных клеток/мл в день трансфекции. Комплекс для трансфекции формировали с помощью плазмидной ДНК фактора VII (6 мг) и 23,1 мг полиэтиленимина (PEI). Трансфекционный комплекс затем разводили в 0,5 л среды для трансфекции Opti-MEM без сыворотки (Invitrogen) и добавляли в 0,6 л продуцирующей культуры. Спустя 5 ч после трансфекции культуру дополнительно разбавляли ~1 л ProCHO5 среды (Lonza) с добавлением 8 мМ L-глутамина и 4 мг/л витамина K1. Экспрессия белка в 2,2 л культуры во встряхиваемой колбе происходила в течение 5-7 дней до выделения сырого фактора VII. Затем с помощью фильтрации собирали культуральный супернатант и очищали FVII. Экспрессию одного из вариантов FVII (Q286R/M298Q) проводили в стабильной клеточной линии. Указанную линию получили в Excellgene (Monthey, Valais, Швейцария) путем трансфекции клеток СНОХ. Клетки, выращенные в присутствии метотрексата, высевали предельными разведениями по 1 клетке на лунку в 96-луночные планшеты. Клоны, продуцирующие высокие уровни варианта FVII, определяли методом ИФА. Один клон (клон 52) затем субклонировали с помощью второго предельного разведения и высеяли в 96-луночные планшеты. Колонии выращивали при 37°С в среде DM204A (SAFC BioSciences), дополненной 8 мМ L-глутамина, 1 мМ цистеина, 1 мг/л витамина K1. Методом ИФА были обнаружены 24 клона с более высокими уровнями экспрессии Q286R/M298Q по сравнению с исходным клоном 52. Эти 24 клона пересеяли в 6
луночные планшеты и выращивали в течение 6 дней, затем выращивали в 40 мл колбах при встряхивании в течение четырех дней. Каждую стадию роста проводили при 37°С в среде DM204A, дополненной, как описано выше. После четырех дней роста клоны были заморожены при концентрации 1x107 жизнеспособных клеток/мл. Уровни продукции Q286R/M298Q каждого клона были определены методом ИФА. Клон 5F7 обладал самой высокой производительностью, как правило, продуцируя 25-35 мг/л
Q286R/M298Q.
1. ИФА.
Иммуноанализ был использован для количественного определения человеческого FVII и FVIIa в образце. Поликлональные антитела к человеческому FVII были использованы для захвата и обнаружения протеазы в растворе. Иммуноанализ может быть использован для определения концентрации белка в кондиционированной среде или очищенном исходном растворе или для определения концентрации FVII в другом образце, например в образце плазмы человека или мыши. Базовый уровень FVII в крови человека составляет около 50 нМ, а концентрация ферментативно активной формы FVIIa составляет около 1 нм.
Для определения количества человеческого FVII или FVIIa белков в образцах был выполнен двойной ИФА. 96-луночные плоскодонные иммунопланшеты Maxisorp (Nunc) покрыли 100 мкл 5 нг/мкл ави-дина на лунку (NeutrAvidin, Pierce Biotech.). Планшеты покрыли и инкубировали при встряхивании в течение 1 ч при комнатной температуре (RT) с последующей четырехкратной промывкой PBS с 0,01% твин-20 (PBST). Планшеты блокировали в течение как минимум 1 ч при комнатной температуре при встряхивании путем инкубации с 1% бычьим сывороточным альбумином (БСА) (мас./об.) в PBS по 200 мкл на лунку. Блокированные планшеты хранили при -40°С до использования (до 2 недель). Перед использованием планшеты промывали четыре раза в PBST для удаления БСА и в каждую лунку добавляли 100 мкл/лунку 1 нг/мкл раствора биотинилированных антифактор VII антител (R &D Systems), планшеты инкубировали при комнатной температуре в течение 45 мин при встряхивании для образования комплекса с авидином. Избыток несвязанных антител отмыли с планшетов PBST (четыре раза).
В планшеты добавили по 100 мкл/лунку последовательных двукратных разведений стандарта FVII (American Diagnostica; разводили в PBST) от 50 до 0,8 нг/мкл. Лунка, содержащая PBST без FVII, была использована в качестве контроля. Для анализа очищенных образцов FVII или FVIIa (до и после активации, см. пример 3) образец сначала разводили 1:25 в PBST, а затем последовательно разводили в два раза, получая 25-кратное, 50-кратное, 100-кратное и 200-кратное разведение. Разбавленные образцы добавляли в лунки по 100 мкл/лунку в двух повторностях. Для анализа образцов плазмы, содержащих FVII или FVIIa, образец плазмы разводили 1:100 и 1:400 в PBST и добавляли в лунки в двух повторностях по 100 мкл/лунку. Образцы плазмы без FVII или FVIIa также были использованы для определения фонового уровня. Затем планшеты инкубировали в течение 30 мин при комнатной температуре при встряхивании для образования комплекса FVII или FVIIa в образце с анти-FVII антителами.
После инкубации с образцом планшеты промывали 4 раза PBST. Вторичные антитела, лошадиные античеловеческий FVII антитела или моноклональные античеловеческий FVII антитела (American Diag-nostica) разбавляли 1:5000 в PBST и добавляли в каждую лунку в объеме 100 мкл. Планшеты инкубировали в течение 30 мин при комнатной температуре при встряхивании для образования комплекса добавленных антител со связанным FVII или FVII на планшете. Для удаления избытка вторичных антител планшеты промывали PBST (4 раза). Для обнаружения связанных вторичных антител в каждую лунку добавляли 100 мкл коза антилошадь антител, сопряженных с HRP, разбавленных 1:5000 в PBST, или 100 мкл коза антимышь антител, сопряженных с HRP, разведенных 1:20000 в PBST. После инкубации в течение 30 мин при комнатной температуре при встряхивании планшеты промывали четыре раза PBST и добавляли 100 мкл/лунку раствора, содержащего 1:1 смесь субстрата ТМВ и пероксида водорода (Pierce Biotech.). Планшеты встряхивали в течение приблизительно 1 мин при комнатной температуре перед добавлением 100 мкл/лунку 2М H2SO4 для остановки реакции. Оптическую плотность при 450 нм измеряли с помощью планшетного спектрофотометра Molecular Device M5 и фоновое значение для планшета (измеряли в лунке только с PBST) вычитали из измеренных значений для каждой лунки. Стандартную кривую строили, откладывая значения поглощения против концентраций стандартов FVII. При указанных выше условиях диапазон стандартной кривой составлял приблизительно 0,2-50 нг/мл. Концентрацию каждого образца затем определяли с помощью калибровочной кривой и умножения на коэффициент разбавления, вычисляя среднее значение и стандартное отклонение.
2. Вестерн-блоттинг.
Экспрессия FVII в культуральную среду также определяли с помощью Вестерн-блоттинга. Аликво-ты, содержащие неразбавленный образец или два последовательных разведения в два раза культуральной среды от трансфецированных FVII клеток в PBS (BHK-21 или СНОХ клеток), обозначали Cone. 1 (неразбавленный), Cone. 2 (2-кратное разведение) и Cone. 3 (4-кратное разведение). Образцы загрузили на по-лиакриламидный гель с SDS рядом с 10, 25 и 50 нг очищенного из плазмы rFVII в качестве контроля (American Diagnostica). Белок FVII, вырабатываемый в BHK-21 или СНОХ клетках, обнаруживали имму-ноблоттингом с использованием первичных поликлональных лошадиных анти-FVII антител (American Diagnostica, использовали в предложенной производителем концентрации) и HRP-конъюгированных антилошадь IgG вторичных антител (разведение 1:2000 1 мг/мл раствора от Zymed Laboratories). В некото
рых примерах FVII обнаруживали Вестерн-блоттингом с использованием первичных антител кролика против человеческого фактора VIIa (Hematologic Technologies) и HRP-конъюгированных вторичных антител против IgG кролика (Invitrogen). Уровень экспрессии определяли по сравнению с очищенным из плазмы контрольным rFVII. Результаты показывают, что в аликвотах культуральной среды FVII присутствует в концентрации от 20 до более чем 50 нг.
Пример 2. Очистка и активация полипептидов FVII.
Полипептиды FVII очищали с использованием Q Sepharose Fast Flow или CaptoQ колонок (GE Healthcare), на которых адсорбируются полипептиды FVII с функциональными доменами Gla, и последующей элюцией кальцием. Как правило, культуральный супернатант от трансфецированных клеток разбавляли в 2 раза раствором, содержащим 20 мМ Трис рН 8,0 и 0,01% Твин-20, а затем в разбавленный образец добавляли 500 мМ ЭДТА рН 8,0 до конечной концентрации 1,5 мМ. Образцы фильтровали перед нанесением на Q Sepharose Fast Flow или CaptoQ колонки, которые были предварительно уравновешены сначала буфером В (20 мМ Трис рН 8,0,1М NaCl, 0,01% твин 20), затем буфером А (20 мМ Трис рН 8,0, 0,15М NaCl, 0,01% твин 20). После нанесения образца колонку промывали буфером до выхода значений поглощения элюата при 280 нм на базовый уровень. Буфер А заменяли на буфер С (20 мМ Трис рН 8,0, 0,15М NaCl, 0,01% Твин-20, 5 мМ CaCl2) и для полной замены буфера в трубках систему промыли насосом. После завершения промывания насосом буфер С пропускали через колонку при 8 мл/мин для элюи-рования полипептидов FVII, которые собирали во фракции. После элюирования колонку промывали буфером В, продолжая сбор фракций, до смывания розового пигмента (из культуральной среды) с колонки. Затем колонку промывали буфером для повторного уравновешивания его ее повторного использования.
Элюированные фракции затем очищали с использованием MonoQ или QHiTrap колонки (GE Healthcare), которая была предварительно уравновешена сначала буфером В, а затем буфером А. Фракции, собранные в буфере С выше, в которых содержится FVII, были объединены и разбавлены в 2 раза буфером А, затем к ним добавили ЭДТА, рН 8,0 до конечной концентрации 40 мМ. На данном этапе для анализа, например, методом ИФА были дополнительно отобраны малые аликвоты (например, 100 мкл). Объединенный образец нанесли на MonoQ (или QHiTrap) колонку, которую затем промыли буфером А. Для элюирования связанных полипептидов FVII через колонку пропускали градиент от 0% до 30% буфера В, собирая при этом фракции. Затем колонку промывали буфером В и буфером А для повторного уравновешивания его ее повторного использования.
В некоторых примерах, после первой колонки Capto Q в объединенных фракциях производили замену буфера с помощью диафильтрации в буфер D (20 мМ MES, рН 6,0, 10 мМ CaCl2, 0,1М NaCl, 0,01% твин 20) и последующего нанесения на колонку SP-HP, предварительно уравновешенную буфером D. После промывания буфером D колонку промыли градиентом от 0,1М NaCl до 1,0М NaCl, собирая при этом фракции. Фракции, содержащие FVII, затем доводили до рН 8,0, разбавляли в 2 раза буфером Е (20 мМ Трис, рН 8,0, 10 мМ CaCl2, 0,01% твин 20) и наносили на колонку Q Н-НР, предварительно уравновешенную буфером Е. Колонку промывали буфером Е и FVII элюировали градиентом 0-1М NaCl в буфере Е.
Очищенные полипептиды FVII активировали с образованием FVIIa с использованием биотинили-рованного фактора Ха из набора для расщепления фактором Ха и его удаления Restriction Protease Factor Xa Cleavage and Removal Kit (Roche). Как правило, 7 фракций, полученных после очистки на MonoQ, объединяли в 15 мл коническую пробирку и к ним добавляли 388 мкл 500 мМ CaCl2, 38,9 мкл 10% БСА в дистиллированной воде и 3,2 мкг биотинилированного фактора Ха. После инкубации в течение 14-16 ч при температуре 37°С к смеси добавляли 250 мкл иммобилизованного авидина (Pierce) и образец перемешивали при 4°С в течение 30 мин. Полученный раствор фильтровали на Econo-Pak колонке (Bio-Rad), фильтрат дополнительно смешивали с 250 мкл иммобилизованного авидина на 30 мин. Раствор снова фильтровали и фильтрат концентрировали до приблизительно 300-500 мкл с использованием Amicon Ultra-410 кДа фильтра для центрифугирования (Millipore). Концентрацию FVIIa затем определяли с помощью ИФА (как описано в примере 1.С.1) и уровень активации фактора VII контролировали методом Вестерн-блоттинга. Иммуноблоттинг проводили, как описано в примере 1.С.2, но с использованием антител кролика против человеческого фактора VIIa (Haematologic Technologies, Inc) при разведении 1:2000 в течение 1 ч в качестве первичных антител, а затем с использованием HRP-коза антикролик-IgG (Н + L) антител (Invitrogen) при разведении 1:5000 в течение 30 мин.
Пример 3. Определение концентрации каталитически активной протеазы в растворе.
Концентрацию каталитически активной FVIIa в неразбавленном растворе определяли титрованием комплекса фактора VIIa и растворимого тканевого фактора (рТФ) необратимым ингибитором пептида FVIIa, Phe-Phe-Arg-хлорметилкетоном (FFR-CMK). Ингибитор связывается с FVIIa, но не с FVII. Продолжительная инкубация при высокой концентрации FVIIa (50 нМ) обеспечивает полное титрование протеазы. Для определения концентрации каталитически активной FVIIa в неразбавленном растворе определяли остаточную активность FVIIa/ТФ комплекса после инкубации с FFR-CMK.
96-луночный прозрачный планшет формата half area для анализа (Nunc) предварительно обрабатывали добавлением 150 мкл/лунку 1 x планшетного буфера (100 мМ Трис рН 8,4, 100 мМ NaCl, 0,01% БСА, 0,01% твин-20) в каждую лунку и инкубацией планшета при 37°С в течение как минимум 1 ч. Бу
фер полностью удаляли бумажным полотенцем и центрифугировали планшеты вверх дном, чтобы удалить весь оставшийся буфер, планшеты сушили на воздухе в течение 1 ч и хранили закрытыми при комнатной температуре (RT). Для приготовления FVIIa/рТФ/FFR-CMK реакционной смеси раствор FVIIa (American Diagnostica; разбавляли до 5 мкМ 50 об.% глицерином и хранили в аликвотах при -20°С) или варианта FVIIa сначала разбавляли до 500 нМ 1 x прямым буфером для анализа (100 мМ Трис рН 8,4, 100 мМ NaCl, 5 мМ CaCl2, 0,01% БСА). FVIIa/рТФ смесь готовили путем смешения 90 мкл дистиллированной воды с 36 мкл 5 x прямого буфера для анализа, 18 мкл 500 нМ FVIIa и 18 мкл 5 мкм рТФ (рекомби-нантный человеческий фактор свертывания III/растворимый тканевый фактор, R &D Systems; неразбавленный раствор 19,6 мкМ в 50% глицерине разбавляли до 5 мкМ в 1 x прямом буфере для анализа и хранили до двух недель при температуре 4°С). Компоненты инкубировали для образования комплекса в течение 5 мин при комнатной температуре.
Исходный раствор 10 мМ FFR-CMK (BaChem) в ДМСО (хранили при температуре -20°С) разводили в воде до 3,5 мкМ. В одном ряду в 11 лунках непрозрачного 96-луночного полипропиленового планшета (Costar) были приготовлены последовательные двукратные разведения FFR-CMK в воде, в последнюю лунку ряда внесли только воду в качестве контроля. Таким образом, получили серию 10 x FFR-CMK растворов ингибитора. В каждую лунку ряда предварительно обработанного прозрачного 96-луночного планшета формата half area для анализа добавили 10,8 мкл смеси FVIIa/рТФ, а затем 1,2 мкл 10 x FFR-CMK серийного раствора ингибитора. Растворы хорошо перемешивали и планшеты центрифугировали при <3000 об/мин в течение 5 мин для удаления каплей из лунок. Планшет закрыли и инкубировали в течение 8 ч при 37°С.
Для анализа остаточной активности FVIIa/ТФ комплекса была приготовлена смесь субстрата Spectrozyme FVIIa (American Diagnostica, # 217L; восстановленный исходный раствор, приготовленный растворением 50 мкмоль субстрата из флакона в 5 мл дистиллированной воды с получением 10 мМ раствора, хранили при 4°С) и 5-кратного прямого буфера (500 мМ Трис рН 8,4, 500 мМ NaCl, 25 мМ CaCl2 и 0,05% БСА) путем смешивания 360 мкл 5 x прямого буфера для анализа с 180 мкл 10 мМ раствора Spec-trozyme FVIIa и 1080 мкл воды. В каждую лунку планшета для анализа добавляли 108 мкл приготовленного раствора субстрата. Содержимое лунок перемешали и планшеты инкубировали при 37°С. Увеличение абсорбции при 405 нм измеряли каждые 30 с в течение 1 ч при 37°С на планшетном спектрофотометре Spectramax Gemini M5 от Molecular Devices.
С использованием SoftMax Pro программного обеспечения (Molecular Devices) были измерены величины абсорбции и определены относительные значения активности протеаз после инкубации с ингибитором путем деления измеренной скорости на скорость реакции, катализируемой не ингибированной протеазой. Относительную активность отложили против концентрации FFR-CMK и точки, которые составляли более 90% или менее 10% от не ингибированной активности, отбросили. Затем через остальные точки была проведена прямая и определена величина отрезка, отсекаемого прямой на оси X, которая представляет собой концентрацию активной протеазы в растворе. Были измерены и усреднены величины из нескольких анализов, и было определено стандартное отклонение.
Пример 4. Определение каталитической активности FYIIa для его субстрата фактора X.
Каталитическую активность вариантов FVIIa для его субстрата фактора X (FX) оценивали косвенно во флуоресцентном анализе путем анализа активности FXa, образованного при активации фактором FVI-Ia, активность FXa определяли с помощью синтетического субстрата Spectrafluor FXa.
А. ТФ-зависимая каталитическая активность FVIIa дикого типа для его субстрата фактора X.
ТФ-зависимая каталитическая активность FVIIa дикого типа оценивали с помощью флуоресцентного анализа, в который для обеспечения оптимальной активности FVIIa была включена связанная с липи-дами форма очищенного тканевого фактора (ТФ). Активность фермента FXa для Spectrafluor FXa (CH3SO2-D-CHA-Gly-ATg-AMC.AcOH) определяли путем измерения увеличения абсорбции свободного флуорофора, АМС (7-амино-4-метилкумарин), как функции от времени. Полипептид FVIIa дикого типа сначала разбавляли до 0,5 мкМ 1 x буфером для анализа (100 мМ Трис рН 8,4, 100 мМ NaCl, 5 мМ CaCl2, и 0,01% БСА), а затем разбавляли до 0,1 нМ буфером для анализа. Связанный с липидами полноразмерный ТФ (Innovin; Dade Behring) восстановили в 20 мл воды, получили 3 нМ раствор и разбавили его до 0,2 нМ в 1 x буфере для анализа. Четыреста мкл 0,1 нМ FVIIa смешивали с 400 мкл 0,2 нМ ТФ и выдерживали при комнатной температуре в течение 5 мин. Раствор дополнительно два раза последовательно разбавляли в 2 раза в 1 * буфере с 0,2 нМ ТФ с получением в общей сложности трех разведений FVIIa с концентрациями FVIIa 0,05 нМ, 0,025 нМ или 0,0125 нМ, каждая из которых содержит 0,2 нМ ТФ (растворы FVIIa/ТФ).
Субстрат фактор X (FX; American Diagnostica, 80 мкг) восстанавливали в 135,6 мкл дистиллированной воды с получением 10 мкМ исходного раствора, который хранили в аликвотах при -80°С. Аликвоты не замораживали и оттаивали более одного раза. Исходный раствор FX разбавляли до 800 нМ в прямом буфере для анализа, затем последовательно разводили в 2 раза с получением растворов с концентрацией
FX от 800 до 50 нМ.
Spectrofluor Xa (American Diagnostica, 10 мкмоль) восстанавливали в дистиллированной воде до 5
мМ и хранили при 4°С. В каждую лунку 96-луночного черного планшета для анализа формата half area (Costar) добавляли 5 мкл Spectrofluor Xa (American Diagnostica). Затем в каждую лунку добавили 25 мкл раствора FX. Последний ряд лунок планшета служил отрицательным контролем без добавления FX. В лунки соответствующих столбцов планшета в двух повторностях были добавлены растворы ТФ/FVIIa трех концентраций по 20 мкл, так что каждое разведение ТФ/FVIIa исследовали с каждым разведением FX, при этом один набор столбцов не содержал добавленного ТФ/FVIIa (т.е. только FX). Содержимое планшета перемешали встряхиванием. Флуоресценцию измеряли во времени на спектрофлуориметре каждые 30 с в течение 1 ч при температуре 37°С (возбуждение: 380 нм, излучение: 450 нм, граница пропускания фильтра: 435 нм), время откладывали в единицах квадрата времени. После анализа на том же планшетном сканере была построена стандартная кривая флуоресценции АМС для перевода единиц флуоресценции в мкМ высвобожденного в процессе анализа субстрата. 1 мМ АМС в ДМСО (Invitrogen) разбавляли до 0,02 мМ в 1 x буфере для анализа. Приготовили шесть последовательных двукратных разведений АМС в пределах от 20 нМ до 0,625 нМ в 1 x буфере. Флуоресценцию АМС измеряли при тех же условиях анализа, как описано выше, после чего строили зависимость флуоресценции от концентрации АМС. Был рассчитан наклон линии, который служил коэффициентом преобразования относительных единиц флуоресценции в мкМ в дальнейших расчетах.
Кинетические константы для активации FX белком FVIIa были рассчитаны с помощью линейной регрессии зависимости обратной концентрации субстрата от обратной скорости расщепления субстрата (в с2); Vmax FVIIa рассчитывали как величину, обратную отсекаемому на оси Y отрезку, Km FVIIa рассчитывали как наклон прямой у отсекаемого на оси Y отрезка, и Vmax/Km FVIIa как обратный наклон. Величину получали с использованием уравнения K^/Kj^ FVIIa = Vmax/KM> FVIIa x 1/(0,5 x k2 x [FVIIa, мкМ] x PFU (единицы флуоресценции/коэффициент
преобразования единиц флуоресценции, мкМ)), где k2 = ([S] x FXa)/(KM> FXa + [S]), где FXa и KM> FXa являются константами для расщепления FXa субстрата SpectrofluorXa, определяемыми экспериментально с помощью стандартов как FXa = 117 с-1 и KM FXa = 164 мкМ.
В указанных выше условиях анализа величина кинетической константы k2 составила 88,1 с-1.
Для оценки каталитической активности (М-1с-1) каждого из вариантов FVIIa для субстрата
FX были определены KM и (табл. 14). Протеаза FVIIa дикого типа обладала активностью 1,8x 107 М-1с-1. Активация фактора X фактором VIIa, измеренная Krishnaswamy и др., (J. Biol. Chem. (1998) 273:8 437886), составляла 2,9x107 М-1с-1.
В. Анализ каталитической активности вариантов FVIIa для его субстрата фактора X.
Каталитическую активность вариантов FVIIa для субстрата фактора X (FX) оценивали косвенно с помощью двух типов хромогенного анализа путем анализа активности FXa, образованного при активации фактором FVIIa, с помощью синтетического субстрата Spectrafluor FXa. Для оценки ТФ-зависимой и ТФ-независимой активности анализы проводили в присутствии или в отсутствие связанного с липидами тканевого фактора. Варианты FVII были экспрессированы, очищены и активированы с образованием FVIIa, как описано выше в примерах 1 и 2. Хотя большинство вариантов FVII были экспрессированы только в Freestyle(tm) 293-F клетках, некоторые из вариантов также были экспрессированы в BHK-21 клетках.
Непрямой анализ в присутствии связанного с липидами тканевого фактора.
Каталитическую активность вариантов FVIIa в присутствии тканевого фактора оценивали с помощью анализа, описанного в разделе А примера 4 выше, с незначительными изменениями. Одним из таких изменений было использование субстрата фактора X, который были обработан ERG-CMK и FFR-CMK для уменьшения фоновой активности (Molecular Innovations). Были использованы два типа анализа данных с использованием двух отдельных анализов: линейный анализ и гиперболический анализ. Для обеспечения точного измерения кинетических констант в линейном диапазоне кривой для линейного анализа использовали диапазон концентраций фактора X между 0 и 150 нМ. Напротив, для обеспечения точного измерения кинетических констант в насыщающей (гиперболической) кривой использовали гиперболический анализ при концентрациях фактора X между 0 и 1,44 мкм.
Непрямой анализ в линейном диапазоне в присутствии связанного с липидами тканевого фактора проводили, как описано в разделе А примера 4 выше, со следующими изменениями. Растворы варианта FVIIa/ТФ приготовили в виде 0,1 нМ FVIIa, 0,4 нМ ТФ растворов и инкубировали в течение 30 мин до разбавления в два раза 0,4 нМ ТФ с получением 1,5625 пМ FVIIa/0,4 нМ ТФ раствора. 25 мкл раствора FVIIa/ТФ смешивали с 25 мкл раствора субстрата, содержащего 1,0 мМ Spectrofluor FXa (American Diagnostica) и 300, 200, 133,3, 88,9, 59,3, 39,5, 36,3 или 0 нМ фактора X (Molecular Innovations). Таким образом, конечные концентрации для анализа составляли 0,8 пМ FVIIa, 0,2 нМ ТФ, 0,5 мМ Spectrofluor FXa и 150, 100, 66,7, 44,4, 29,6, 19,8, 13,2 или 0 нМ фактора X (Molecular Innovations) в 50 мкл/лунку. Стандартную кривую АМС, которая служила для преобразования единиц флуоресценции в мкМ в последующих расчетах, расширили за счет включения диапазон доз, который покрывал от 0 до 100 мкМ АМС.
Непрямой анализ в гиперболическом диапазоне в присутствии связанного с липидами тканевого фактора проводили, как описано в разделе А примера 4 выше, со следующими изменениями. Были при
готовлены растворы варианта FVIIa/ТФ в виде 0,1 нМ FVIIa/0,4 нМ ТФ раствора, их инкубировали в течение 30 минут, затем разбавили в два раза 0,4 нМ ТФ до 1,5625 пМ (или до 0,78 пМ в случае высокоактивной протеазы) FVIIa/0,4 нМ ТФ раствора. Двадцать пять мкл раствора FVIIa/ТФ смешивали с 25 мкл раствора субстрата, содержащего 1,0 мМ Spectrofluor FXa (American Diagnostica) и 1440, 720, 360, 180, 90, 45, 22,5 или 0 нМ фактора X (Molecular Innovations). Таким образом, конечные концентрации для анализа составляли: 0,8 (или 0,39) пМ FVIIa, 0,2 нМ ТФ, 0,5 мМ Spectrofluor FXa и 7, 720, 360, 180, 90, 45, 22,5, 11,25 или 0 нМ фактора X (Molecular Innovations) в 50 мкл/лунку. Параметры и КМ рассчитывали с использованием гиперболического уравнения Михаэлис Ментон вида ОА^ЛТ+СК^/х))). Стандартную кривую АМС, которая служила для преобразования единиц флуоресценции в мкМ в последующих расчетах, расширили за счет включения диапазон доз, который покрывал от 0 до 100 мкМ АМС.
Для определения кинетических констант для активации FX фактором FVIIa или вариантом FVIIa необработанные данные, полученные с помощью приложения SoftMax Pro (Molecular Devices), экспортировали в XML-файлы. Дальнейшие линейные и нелинейные анализы данных проводили с помощью пакета программного обеспечения XLfit4 для автоматизированного аппроксимирования кривых и статистического анализа в интерфейсе таблиц Microsoft Excel (IDBS Software).
При обработке данных с помощью линейного анализа кинетическую константу k^/^ (М-1с-1) вы-
числяли непосредственно из наклона прямой, полученной линейной регрессией зависимости концентра-
ции FX от скорости расщепления флуорогенного субстрата (в мкМ/с2), где - наклон/[FVIIa]x0,5x
k2. Значение поправочного коэффициента k2 было определено как 45, как описано в разделе А примера 4,
значения экспериментально определенных кинетических констант составили Fxa = 56 с-1 и КМ> FXa =
126 нМ для активированного FX (FXa), в котором ранее оттитровали активные центры АТ-Ш/гепарином.
При использовании обычных методов аппроксимации для обеспечения линейности исключили данные,
которые приводили к значениям R2 менее 0,98.
Обработку данных, полученных из анализа гиперболического диапазона, проводили нелинейным регрессионным анализом зависимости концентрации FX от скорости расщепления флуорогенного субстрата (в мкМ/с2). Отдельных параметры и KM рассчитывали как параметры аппроксимации с помощью гиперболического уравнения Михаэлиса-Ментон вида (^шДН^Мх))), где = Vmax/[FVIIa] x 0,5 xk2. Кинетическую константу и KM рассчитывали из параметров аппроксимации и КМ.
Непрямой анализ без тканевого фактора.
Каталитическую активность вариантов FVIIa в присутствии тканевого фактора определяли в непрямом анализе, аналогичном описанному выше, за тем исключением, что тканевой фактор не был включен в анализ. Таким образом, анализ для оценки ТФ-независимой активности проводили, как описано выше, но с некоторыми изменениями. Растворы вариантов FVIIa разбавляли до 50 нМ (или 5 нМ для вариантов с ожидаемой высокой ТФ-независимой активностью). 25 мкл каждого раствора FVIIa смешивали с 25 мкл раствора субстрата, содержащего 1,0 мМ Spectrofluor FXa (American Diagnostica), и 1050, 700, 466,7, 311,1, 207,4, 138,3, 92,2 или 0 нМ фактора X (Molecular Innovations). Таким образом, конечные концентрации для анализа составляли: 25 нМ FVIIa (или 2,5 нМ для высокоактивных вариантов), 0,5 мМ Spectrofluor FXa и 525, 350, 233,3, 155,6, 103,7, 69,1, 46,1 или 0 нМ фактора X (Molecular Innovations) в 50 мкл/лунку. Анализ данных проводили, как описано для анализа линейного диапазона выше без изменений.
В табл. 14 приведена каталитическая активность вариантов FVIIa, измеренная непрямым ТФ-зависимым методом с использованием полипептидов FVIIa, экспрессированных в 293-F клетках и BHK-21 клетках, и каталитическая активность, измеренная ТФ-независимым непрямым методом с использованием полипептидов FVIIa, экспрессированных в 293-F клетках и/или BHK-21 клетках. Результаты представлены в виде кинетической константы каталитической активности k^/Kj^ (М-1с-1), а также выражены в процентах от активности FVIIa дикого типа, где активность представляет собой каталитическую активность kj^/K^ (М-1с-1) каждого варианта FVIIa для его субстрата FX. Для представленных в таблице данных указано использование линейного или гиперболического диапазона для анализа. Не все варианты FVIIa исследовали в каждом анализе. Несколько вариантов FVIIa проявляли увеличенную каталитическую активность по сравнению с молекулой FVIIa дикого типа. Например, полипептид FVIIa, содержащий только мутацию Q286R (Q286R-FVIIa), обладает в 2-3 раза более высокой каталитической активностью, чем FVIIa дикого типа, а полипептид FVIIa с мутацией Q286R и мутацией M298Q (Q286R/M298Q-FVIIa) обладает каталитической активностью в 3 раза большей, чем активность FVIIa дикого типа.
Таблица 14
Каталитическая активность вариантов FVIIa
ТФ-зависимый непрямой анализ с полипептидами FVIIa, полученными в 293-F клетках
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Формат анализа
Ккат/Км (М_1сек_1)
Ккат/Км (%от величины для дикого типа)
Q286N
Q143N
гиперболический
4.88 х 107
100
Q286E
Q143E
гиперболический
1.14 х 107
Q286D
Q143D
гиперболический
6.04 х 106
Q286S
Q143S
гиперболический
4.64 х 107
Q286T
Q143T
гиперболический
2.44 х 107
Q286R
Q143R
линейный
1.11 х 108
323
Q286K
Q143K
гиперболический
5.44 х 107
112
Q286A
Q143A
гиперболический
8.55 х 107
175
Q286V
Q143V
гиперболический
1.65 х 107
H216S
H76S
линейный
4.74 х 107
138
Н216А
Н76А
линейный
5.98 х 107
175
Н216К
Н76К
гиперболический
6.51 х 107
133
H216R
H76R
гиперболический
9.44 х 107
193
S222A
S82A
линейный
5.73 х 107
167
S222K
S82K
линейный
8.02 х 107
234
Н257А
Н117А
линейный
3.90 х 107
114
H257S
H117S
линейный
5.90 х 107
172
K161S
K24S
гиперболический
5.99 х 107
123
К161А
К24А
линейный
4.22 х 107
123
K161V
K24V
гиперболический
5.45 х 107
112
H373D
H224D
линейный
1.79 х 107
Н373Е
Н224Е
линейный
2.79 х 107
H373S
H224S
линейный
2.75 х 107
H373F
H224F
линейный
5.11 х 107
149
Н373А
Н224А
линейный
3.11 х 107
S52A
S[52]A
линейный
4.66 х 107
136
S60A
S[60]A
линейный
5.15 х 107
150
Q366D
Q217D
линейный
1.88 хЮ7
Q366E
Q217E
линейный
4.77 х 107
139
Q366N
Q217N
линейный
5.64 х 107
165
Q366T
Q217T
линейный
3.42 х 107
100
Q366S
Q217S
линейный
2.70 х 107
Q366V
Q217V
линейный
6.59 х 107
192
E394N/P395A/R396
E245N/P246A/ R247S
линейный
5.32 х 107
155
R202S
R62S
линейный
2.57 х 107
A292N/A294S
A150N/A152S
линейный
G318N
G170fN
линейный
5.50 х 107
161
A175S
A39S
линейный
3.32 х 107
K109N
K[109]N
линейный
5.97 х 107
174
A122N/G124S
A[122]N/G[124]S
линейный
5.27 х 107
154
TT30N/E132S
T[130]N/E[132]S
линейный
6.35 х 107
185
A122N/G124S/ E394N/P395A/ R396S
A[122]N/G[124]S/ E245N/P246A/ R247S
линейный
4.88 х 107
142
V158T7L287TV М298К
V21T/L144T/M15 6K
линейный
4.50 х 106
V158D/L287T/ М298К
V21D/L144T/ M156K
линейный
4.48 х 106
S103S111удаление/ BCTaBKaSFGRGDIR NV
S[103]S[111]
удаление/вставка SFGRGDIRNV
линейный
4.83 х 107
141
P406insCSFGRGDI RNVC
P257insCSFGRG DIRNVC
линейный
6.16 х 107
180
P406insGGGSCSFG RGDIRNVC
P257insGGGSCS FGRGDIRNVC
линейный
7.47 х 107
218
T128N/P129A
T[128]N/P[129]A
линейный
5.96 х 107
174
S222A/ замена Gla FIX
S 82А/замена Gla FIX
линейный
6.55 х 107
189
Н257А/ замена Gla FIX
Н117А/замена Gla FIX
линейный
6.45 х 107
186
S222A/H257A/ замена Gla FIX
S82A/H117A/ замена Gla FIX
линейный
5.77 х 107
168
Q286R/ замена Gla FIX
Q143R/3aMeHa Gla FIX
линейный
1.11 х 108
323
Q286R/H257A
Q143R/H117A
линейный
1.27 х 108
371
Q286R/S222A
Q143R/S82A
линейный
1.42 х 108
415
Q286R/S222A/ H257A
Q143R/S82A/ H117A
линейный
9.51 х 107
278
Q286R/S222A/ замена Gla FIX
Q143R/S82A/ замена Gla FIX
линейный
1.61 х 108
470
Q286R/H257A/ замена Gla FIX
Q143R/H117A/ замена Gla FIX
линейный
8.09 х 107
234
Q286R/S222A/H257 А/замена Gla FIX
Q143R/S82A/H11 7А/замена Gla FIX
линейный
7.75 х 107
226
Q286R/M298Q/ K341Q
Q143R/M156Q/ K192Q
линейный
3.93 х 107
115
Q286R/M298Q/ K199E
Q143R/M156Q/ K60cE
линейный
7.74x107
226
T239S
T99S
линейный
1.74 х 107
T239Q
T99Q
линейный
1.74 х 107
T239V
T99V
линейный
9.57 х 107
279
T239L
T99L
линейный
3.77 х 107
110
T239H
T99H
линейный
9.90 х 106
T239I
T99I
линейный
3.50 х 107
102
S222A/H257A/ M298Q
S82A/H117A/ M156Q
линейный
7.75 х 107
224
S222A/H257A/ Q286R/M298Q
S82A/H117A/ Q143R/M156Q
линейный
2.00x108
583
S222A/H257A
S82A/H117A
линейный
5.02 х 107
147
A175S/Q286R/ Q366V
A39S/Q143R/ Q217V
линейный
8.08 х 107
236
A175S/S222A/ Q366V
A39S/S82A/ Q217V
линейный
3.78 х 107
109
K109N/A175S
K[109]N/A39S
линейный
3.67 х 107
107
S222A/Q286R/ Q366V
S82A/Q143R/ Q217V
линейный
1.27 х 108
369
Q286M
Q143M
линейный
5.25 х 107
153
Q286L
Q143L
линейный
2.02 х 107
Q286Y
Q143Y
линейный
1.61 х 107
Q366I
Q217I
линейный
9.37x107
274
Q366L
Q217L
линейный
6.87 х 107
201
Q366M
Q217M
линейный
6.61 х 107
193
S222V
S82V
линейный
6.04 х 107
176
S222D
S82D
линейный
5.34 х 107
156
S222N
S82N
линейный
6.82 х 107
199
S222E
S82E
линейный
5.48 х 107
160
Q286R/M298Q/K341Q
Q143R/M156Q/ K192Q
линейный
3.11 х 107
Q286R/M298Q/K199E
Q143R/M156Q/ K60cE
линейный
9.18 х 107
169
Р321К
P170iK
линейный
3.43 х 107
Р321Е
P170iE
линейный
5.59 х 107
103
P321Y
P170iY
линейный
4.48 х 107
P321S
P170iS
линейный
5.53 х 107
102
T239N
T99N
линейный
1.64 х 107
T239Q
T99Q
линейный
1.70 х 107
T239V
T99V
линейный
9.81 х 107
181
T239L
T99L
линейный
5.24 х 107
Т239Н
T99H
линейный
1.25 х 107
T239I
T99I
линейный
4.67 х 107
S222A/M298Q
S82A/M156Q
линейный
7.13 хЮ7
131
H257A/M298Q
H117A/M156Q
линейный
1.28 хЮ8
236
S222A/H257A/Q286R/ M298Q
S82A/H117A/ Q143R/M156Q
линейный
1.94 х 108
358
Q286R/M298Q/3aMeHa Gla FIX
Q143R/M156Q/ замена Gla FIX
линейный
2.64 х 108
487
Q286R/Q366V
Q143R/Q217V
линейный
7.92 х 107
146
A175S/Q286R/Q366V
A39S/Q143R/ Q217V
линейный
7.63 х 107
141
K109N/A175S
K[109]N/A39S
линейный
2.45 х 107
S222A/Q286R/Q366V
S82A/Q143R/ Q217V
линейный
1.44 х 108
265
Q286R/M298Q/K341D
Q143R/M156Q/ K192D
линейный
1.35 х 107
Q286R/H373F
Q143R/H224F
линейный
1.18 х 108
218
Q286R/M298Q/H373F
Q143R/M156Q/ H224F
линейный
2.01 х 108
371
M298Q/H373F
M156Q/H224F
линейный
8.69 х 107
160
A122N/G124S/A175S
A[122]N/G[124]S/
линейный
1.93 х 107
A39S
M298Q
M156Q
линейный
9.34x107
172
ТФ-независимый непрямой анализ
293-F клетки
ВНК-21 клетки
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ккат/Км
(М'сек1)
Ккат/Км (% от величины для дикого типа)
Ккат/Км (М'сек1)
Ккат/Км (% от величины для дикого типа)
100
1.58х 101
100
Q286N
Q143N
Q286E
Q143E
Q286D
Q143D
3.50х 10"'
Q286S
Q143S
2.66х 101
Q286T
Q143T
1.51х 101
Q286R
Q143R
4.87х 101
4.08х 101
Q286K
Q143K
3.95х 101
Q286A
Q143A
2.11х 101
Q286V
Q143V
2.35
S222A
S82A
7.36х 101
2.02х 101
H257S
H117S
1.75х 101
Q366D
Q217D
Q366E
Q217E
Q366N
Q217N
100
1.36х 101
Q366T
Q217T
Q366S
Q217S
Q366V
Q217V
8.36х 10'
A51N
A[51]N
2.07х 101
V158T/L287T/ М298К
V21T/L144T/M15 6К
V158D/L287T/ М298К
V21D/L144T/M15 6К
S[52]A/S[60]A
T128N/P129A
T[128]N/P[129]A
Q286R/ замена
Q143R/3aMeHa
Gla FIX
Gla FIX
Q286R/H257A
Q143R/H117A
1.07x 101
Q286R/S222A
Q143R/S82A
l.OOx 102
444
3.18x 101
202
Q286R/S222A/ H257A
Q143R/S82A/H11 7A
9.60x 10
Q286R/S222A/ замена Gla FIX
Q143R/S82A/ замена Gla FIX
1.82x Ю2
804
З.бЗх 101
230
Q286R/S222A/ H257А/замена Gla FIX
Q143R/S82A/H11 7А/замена Gla FIX
2.79x 10'
123
Q286R/M298Q
Q143R/M156Q
3.02x 102
1916
Q286R/M298Q/ K341Q
Q143R/M156Q/K 192Q
1.50x 102
665
3.65x 102
2319
Q286R/M298Q/ K199E
Q143R/M156Q/K 60cE
8.69x 101
385
2.29x 102
1451
P321K
P170iK
1.13x 101
S222A/M298Q
S82A/M156Q
7.85x 102
4981
H257A/M298Q
H117A/M156Q
4.12x 101
262
S222A/H257A/ Q286R/M298Q
S82A/H117A/Q14 3R/M156Q
6.09x 102
2695
1.90x 102
1208
Q286R/M298Q/ замена Gla FIX
Q143R/M156Q/ замена Gla FIX
7.52x 102
4775
Q286R/Q366V
Q143R/Q217V
2.38x 101
151
A175S/Q286R/ Q366V
A39S/Q143R/Q21 7V
3.87x 101
171
1.23x 101
S222A/Q286R/ Q366V
S82A/Q143R/Q21 7V
3.21x 101
204
Q286M
Q143M
1.07x Ю1
Q286L
Q143L
3.20
Q286Y
Q143Y
9.50x 10'1
Q366I
Q217I
6.29x 101
278
Q366L
Q217L
2.54x 101
112
Q366M
Q217M
4.05x 101
179
Q286R/K341D
Q143R/K192D
1.80
Q286R/Q366D
Q143R/Q217D
1.00
Q286R/Q366N
Q143R/Q217N
2.75
Q286R/M298Q/ Q366D
Q143R/M156Q/ Q217D
6.80
Q286R/M298Q/
Q143R/M156Q/
2.12x 101
Q366N
Q217N
Q286R/H373F
Q143R/H224F
2.20x 101
139
Q286R/M298Q/ H373F
Q143R/M156Q/ H224F
2.16x 102
957
3.17x 102
2009
M298Q/H373F
M156Q/H224F
2.36x 102
1499
M298Q
M156Q
4.59x 102
2029
3.1x 102
1969
В других экспериментах, каталитическую активность полипептидов FVIIa, полученных в BHK-21 клетках, исследовали с использованием ТФ-независимого и ТФ-зависимого непрямых анализов, как описано выше, с незначительными изменениями. Несколько вариантов были получены в клетках СНОХ в дополнение к BHK-21 клеткам или исключительно в СНОХ клетках. Варианты были проанализированы в одинаковых условиях, независимо от использованной линии клеток. Для ТФ-зависимого каталитического анализа (с использованием линейного анализа) активные центры полипептидов FVIIa сначала оттитровали с 4-метилумбеллиферил-р'-гуанидинобензоатом (MUGB) для определения концентрации FVIIa, как описано в примере 12 ниже. Для максимального увеличения количества точек в линейном диапазоне максимальная концентрация FX в анализе составляла 25 нМ (т.е. диапазон составлял 0-25 нМ вместо 0-150 нМ). FX, использованный в анализе, был активирован (т.е. FXa) и титрован флуоресцеин-моно-р'-гуанидинобензоатом (FMGB), как описано в примере 15 ниже. Кинетические константы для расщепления субстрата Spectrafluor FXa были определены с использованием FXa с оттитрованными активными центрами и составили КМ 190,2 мкМ и 340 с-1. Основные различия затронули и были обусловлены! в основном улучшенным определением активных центров. Эти параметры привели к пересмотренному поправочному коэффициенту k2, значение которого составило 246,4, который использовали в линейном анализе для определения каталитической активности полипептидов FVIIa в присутствии ТФ.
Для ТФ-независимого каталитического анализа активные центры полипептидов FVIIa сначала оттитровали с 4-метилумбеллиферил-р'-гуанидинобензоатом (MUGB) для определения концентрации FVI-Ia, как описано в примере 12 ниже. Использованные для анализа FX были активированы (т.е. FXa) и оттитрованы флуоресцеин-моно-р'-гуанидинобензоатом (FMGB), как описано в примере 15. Кинетические константы для расщепления субстрата Spectrafluor FXa были определены с использованием FXa с оттитрованными активными центрами и составили KM 190,2 мкМ и 340 с-1. Эти параметры привели к пересмотренному поправочному коэффициенту k2, значение которого составило 246,4, который использовали в анализе для определения каталитической активности полипептидов FVIIa в отсутствие ТФ. В табл. 15
приведены каталитические активности каждого из проанализированных вариантов полипептидов FVIIa. Результаты представлены в виде кинетической константы каталитической активности k^/^ (М-1с-1), а также выражены в процентах от активности FVIIa дикого типа, где активность представляет собой каталитическую активность k^/^ (М-1 с-1) каждого варианта FVIIa для его субстрата FX. Также приведены стандартное отклонение (SD), коэффициент вариации (% CV; в %) и число исследованных проб (N). Некоторые из вариантов проявляли заметное увеличение каталитической активности по сравнению с полипептидом FVII дикого типа. Например, вариант с заменой Gla из FIX/Q286R/M298Q проявлял ТФ-зависимую каталитическую активность, которая в 6 раз больше, чем активность полипептида FVII дикого типа. Увеличенная каталитическая активность вариантов FVIIa была более выражена при ТФ-независимом анализе. Например, активность варианта с заменой Gla из FIX/Q366V была более чем в 9 раз больше, чем каталитическая активность FVIIa дикого типа, активность вариантов с заменой Gla из FIX/Q286R/M298Q, заменой Gla из FIX/E40LJ/Q286R/M298Q, заменой Gla из FIX/K43I/Q286R/M298Q и заменой Gla из FIX/Q44S/Q286R/M298Q была в 70-80 раз больше, чем каталитическая активность FVIIa дикого типа, а вариант S52A/S60A/V158D/E296V/M1298Q был в 220 раза более каталитически активен, чем FVIIa дикого типа.
Таблица 15
Каталитическая активность вариантов FVIIa
ТФ-зависимый анализ
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
ккат/Км
(М'сек1)
Стандарт -ное
отклонение
Коэффициент вариации
ккат/Км
(% от величины для дикого типа)
Дикий тип (NovoSeven(r))
Дикий тип (NovoSeven(r))
3.98E+07
1.02Е+07
26%
106%
Дикий тип (NovoSeven-RT(r))
Дикий тип (NovoSeven-RT(r))
3.48E+07
8.33Е+06
24%
93%
Дикий тип
Дикий тип
3.75E+07
5.44Е+06
15%
100%
Дикий тип t
Дикий тип f
3.76E+07
7.09Е+06
19%
100%
T128N/P129A
T[128]N/P[129]A
4.65E+07
1.09Е+07
23%
124%
Замена Gla из FIX
Замена Gla из FIX
5.38E+07
9.08Е+05
144%
K109N
K[109]N
5.54E+07
8.57Е+06
15%
148%
A122N/G124S
A[122]N/G[124]S
3.87E+07
4.96Е+06
13%
103%
S52A/S60A
S[52]A/S[60]A
3.56E+07
4.63Е+06
13%
95%
M298Q
M156Q
6.76E+07
7.38Е+06
11%
180%
M298Q t
M156Qt
7.46E+07
9.42Е+06
13%
198%
T128N/P129A/M298Qt
T[128]N/P[129]A/ M156Qf
6.29E+07
1.28Е+07
20%
167%
V158D/E296V/M298Q
V21D/E154V/M156Q
1.81E+08
4.43Е+07
25%
482%
V158D/E296V/M298Q
V21D/E154V/M156Qt
1.65E+08
4.08Е+07
25%
441%
T128N/P129A/V158D/ E296V/M298Q
T[128]N/P[129]A/V21D /E154V/M156Q
2.01E+08
1.54Е+07
537%
S52A/S60A/V158D/ E296V/M1298Q
S[52]A/S[60]A/V21D /E154/M156Q
2.00E+08
4.31Е+05
532%
Q286R
Q143R
8.06E+07
1.43Е+07
18%
215%
T128N/P129A/Q286R
T[128]N/P[129]A/ Q143R
8.45E+07
1.90Е+07
22%
226%
T128N/P129A/Q286Rt
T[128]N/P[129]A/ Q143RT
6.20E+07
165%
S52A/S60A/Q286R
S[52]A/S[60]A/Q143R
4.10E+07
6.71Е+06
16%
109%
S222A
S82A
4.07E+07
1.17Е+07
29%
109%
T128N/P129A/S222A
T[128]N/P[129]A/S82A
6.25E+07
6.78Е+06
11%
167%
S52A/S60A/S222A
S[52]A/S[60]A/S82A
3.91E+07
8.75Е+06
22%
104%
H257S
H117S
1.18E+08
2.02Е+07
17%
316%
H373F
H224F
5.58E+07
2.05Е+07
37%
149%
Q366V
Q217V
5.48E+07
2.69Е+06
146%
Замена Gla из FIX/ Q366V
Замена Gla из FIX/ Q217V
9.11E+07
2.50Е+07
27%
243%
A175S
A39S
2.11E+07
6.10Е+06
29%
56%
K109N/A175S
K[109]N/A39S
1.74E+07
4.29Е+06
25%
46%
S119N/L121S/A175S
S[119]N/L[121]S/A39S
1.73E+07
1.28Е+06
46%
T128N/P129A/A175S
T[128]N/P[129]A/A39S
8.59E+06
1.82Е+06
21%
23%
A122N/G124S/A175S
A[122]N/G[124]S/A39S
1.05E+07
1.12Е+06
11%
28%
Q286R/H257A
Q143R/H117A
9.91E+07
1.74Е+07
18%
264%
Q286R/H257A t
Q143R/H117Af
3.08E+07
1.52Е+07
49%
82%
Q286R/S222A
Q143R/S82A
1.11E+08
3.21Е+07
29%
296%
Замена Gla из FIX/
T128N/P129A/
S222A/Q286R
Замена Gla из FIX/
T[128]N/P[129]A/
S82A/Q143R
1.47E+08
2.53E+07
17%
393%
Замена Gla из FIX/ T128N/P129A/ S222A/Q286R f
Замена Gla из FIX/ T[128]N/P[129]A/ S82A/Q143Rf
1.43E+08
1.63E+07
11%
379%
Замена Gla из FIX/ S52A/S60A/S222A/ Q286R
Замена Gla из FIX/
S[52]A/S[60]A/S82A/
Q143R
7.24E+07
2.36E+06
193%
Q286R/S222A/H257A
Q143R/S82A/H117A
6.98E+07
1.64E+07
23%
186%
Q286R/M298Q
Q143R/M156Q
1.66E+08
3.86E+07
23%
442%
Q286R/M298Q f
Q143R/M156Q t
1.34E+08
2.37E+07
18%
356%
Q286R/M298Q §
Q143R/M156Q §
1.54E+08
3.86E+07
25%
408%
Замена Gla из FIX/ Q286R/M298Q
Замена Gla из FIX/ Q143R/M156Q
2.55E+08
6.16E+07
24%
680%
Замена Gla из FIX/ Q286R/M298Q f
Замена Gla из FIX/ Q143R/M156Qf
2.30E+08
5.10E+07
22%
613%
T128N/P129A/Q286R/ M298Q
T[128]N/P[129]A/ Q143R/M156Q
1.86E+08
2.64E+07
14%
497%
T128N/P129A/Q286R/ M298Q f
T[128]N/P[129]A/ Q143R/M156Qf
1.50E+08
4.16E+07
28%
398%
Замена Gla из FIX
/T128N/P129A/Q286R/
M298Q
Замена Gla из FIX /T[128]N/P[129]A/ Q143R/M156Q
2.11E+08
4.41E+07
21%
562%
Замена Gla из FIX /T128N/P129A/Q286R/ M298Q f
Замена Gla из FIX /T[128]N/P[129]A/ Q143R/M156Qf
1.99E+08
6.79E+07
34%
529%
{Замена Gla из
FIX/E40L}/
Q286R/M298Q
{Замена Gla из
FIX/E[40]L}/
Q143R/M156Q
2.08E+08
4.39E+07
21%
556%
{Замена Gla из
FIX/K43I}/
Q286R/M298Q
{Замена Gla из
FIX/K[43]I}/
Q143R/M156Q
2.73E+08
5.21E+07
19%
727%
{Замена Gla из FIX/K43I}/ Q286R/M298Q f
{Замена Gla из
FIX/K[43]I}/
Q143R/M156Qf
2.91E+08
4.30E+07
15%
774%
{Замена Gla из
FIX/Q44S}/
Q286R/M298Q
{Замена Gla из
FIX/Q[44]S}/
Q143R/M156Q
1.98E+08
2.75E+07
14%
529%
{Замена Gla из
FIX/M19K}/
Q286R/M298Q
{Замена Gla из FIX/M[19]K}/ Q143R/M156Q
1.41E+08
5.22E+06
375%
S52A/S60A/
S[52]A/S[60]A/Q143R/
1.25E+08
1.14E+07
333%
Q286R/M298Q
M156Q
Замена Gla из FIX /S52A/S60A/ Q286R/M298Q f
Замена Gla из FIX
/S[52]A/S[60]A/Q143R/
M156Qf
1.80E+08
1.81E+07
10%
480%
{Замена Gla из FIX/M19K/E40L/K43I/ Q44S}/ Q286R/M298Q
{Замена Gla из FIX/M[19]K/E[40]L/ K[43]I/Q[44]}/Q286R/ M298Q
1.21E+08
7.07E+06
322%
{Замена Gla из
FIX/K43I}/T128N/
P129A/Q286R/M298Q
{Замена Gla из
FIX/K[43]I}/T128N/
P129A/Q143R/M156Q
2.71E+08
6.41E+07
24%
720%
T239V
T99V
4.64E+07
8.38E+06
18%
124%
T239I
T99I
2.62E+07
6.51E+06
25%
70%
Н257А/ M298Q
H117A/Q143R/M156Q
1.67E+07
4.27E+06
26%
45%
S222A/H257A/Q286R/ M298Q
S82A/H117A/Q143R/ M156Q
1.65E+08
1.76E+07
11%
440%
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82A /H117A/Q143R/M156Q
1.55E+08
5.77E+07
37%
414%
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82A /H117A/Q143R/M156Q
1.73E+08
1.41E+07
461%
S52A/S60A/S222A/ H257A/Q286R/M298Q
S[52]A/S[60]A/S82A/ H117A/Q143R/M156Q
2.49E+08
8.78E+06
665%
H257S/Q286R/Q366V
H117S/Q143R/Q217V
7.10E+07
3.16E+07
44%
189%
S222A/H257A/Q286R/ Q366V
S82A/H117A/Q143R/ Q217V
1.00E+08
1.03E+07
10%
268%
Q286R/M298Q/Q366N
Q143R/M156Q/Q217N
1.17E+08
3.05E+07
26%
312%
T128N/P129A/Q286R/ M298Q/Q366N t
T[129]N/P[129]A/ Q143R/M156Q/Q217N
1.42E+08
4.17E+07
29%
377%
{Замена Gla из FIX/K43I}/Q286R/ M298Q/Q366N f
{Замена Gla из
FIX/K43I}/Q143R/
M156Q/Q217Nt
1.69E+08
3.89E+07
23%
450%
{Замена Gla из FIX/K43I}/T128N/ P129A/Q286R/M298Q/ Q366N f
{Замена Gla из FIX/K43I}/T[128]N/ P[129]A/Q143R/M156Q /Q217Nt
2.52E+08
1.36E+07
669%
Q286R/H373F
Q143R/H224F
9.01E+07
7.73E+06
240%
T128N/P129A/ Q286R/H373F
T[128]N/P[129]A/ Q143R/H224F
6.91E+07
2.15E+07
31%
184%
S52A/S60A/ Q286R/H373F
S[52]A/S[60]A/Q143R/ H224F
9.44E+07
1.43E+07
15%
252%
Q286R/M298Q/H373F
Q143R/M156Q/H224F
1.36E+08
1.92E+07
14%
364%
T128N/P129A/Q286R/ M298Q/H373F
T[128]N/P[129]A/ Q143R/M156Q/H224F
1.33E+08
4.77E+07
36%
354%
S52A/S60A/Q286R/ M298Q/H373F
S[52]A/S[60]A/Q143R/ M156Q/H224F
1.77E+08
3.63E+07
21%
472%
M298Q/H373F
M156Q/H224F
7.21E+07
1.76E+07
24%
192%
T128N/P129A/M298Q/ H373F t
T[128]N/P[129]A/ M156Q/H224F|
6.07E+07
1.29E+07
21%
161%
V158D/Q286R/E296V/ M298Q
V21 D/Q 143R/E154V/ M156Q
1.49E+08
3.59E+07
24%
397%
S222A/T239V
S82A/T99V
7.49E+07
2.57E+06
200%
Замена Gla из FIX /S222A/T239V/Q286R
Замена Gla из FIX /S82A/T99V/Q143R
2.03E+08
3.16E+07
16%
541%
Замена Gla из FIX
/S222A/T239V/Q286R
Замена Gla из FIX /S82A/T99V/Q143Rf
9.94E+07
1.83E+07
18%
264%
T239V/Q286R/M298Q
T99V/Q143R/M156Q
1.72E+08
4.92E+07
29%
459%
Замена Gla из FIX/ T239V/Q286R/M298Q
Замена Gla из FIX/ T99V/Q143R/M156Q
2.53E+08
4.78E+07
19%
675%
Замена Gla из FIX/ T239V/Q286R/M298Q
Замена Gla из FIX/ T99V/Q143R/M156Qt
1.79E+08
3.81E+07
21%
477%
T128N/P129A/T239V/ Q286R/M298Q t
T[128]N/P[129]A/T99V /Q143R/M156Qt
1.04E+08
2.43E+07
23%
276%
S222A/T239V/H257A/ Q286R/M298Q
S82A/T99V/H117A/ Q143R/M156Q
2.14E+08
4.48E+07
21%
571%
T128N/P129A/S222A/ T239V/H257A/ Q286R/M298Q f
T[128]N/P[129]A/S82A /T99V/H117A/Q143R/ M156Qf
1.21E+08
5.58E+06
323%
T239V/Q286R/H373F
T99V/Q143R/H224F
1.06E+08
1.34E+07
13%
283%
T239V/Q286R/M298Q/ H373F
T99V/Q143R/M156Q/ H224F
1.70E+08
1.13E+07
454%
T128N/P129A/T239V/Q 286R/M298Q/H373F f
T[128]N/P[129]A/T99V /Q143R/M156Q/H224F f
2.36E+08
2.77E+07
12%
627%
V158D/T239I/E296V/ M298Q
V21D/T99I/E154V/ M156Q
1.45E+08
1.18E+07
387%
T239I/Q286R
T99I/Q143R
5.79E+07
1.39E+07
24%
155%
S222A/T239I
S82A/T99I
3.05E+07
9.26E+06
30%
81%
Замена Gla из FIX /S222A/T239I/Q286R
Замена Gla из FIX /S82A/T99I/Q143R
6.77E+07
4.44E+06
181%
T239I/Q286R/M298Q
T99I/Q143R/M156Q
1.13E+08
3.68E+06
301%
Замена Gla из FIX/ T239I/Q286R/M298Q
Замена Gla из FIX /T99I/Q143R/M156Q
1.25E+08
2.13E+07
17%
334%
T128N/P129A/T239I/Q 286R/M298Q f
T[128]N/P[129]A/T99I/ Q143R/M156Qf
8.17E+07
8.17E+06
10%
217%
S222A/T239I/H257A/ Q286R/M298Q
S82A/T99I/H117A/ Q143R/M156Q
1.14E+08
2.22E+07
19%
304%
T239I/Q286R/H373F
T99I/Q143R/H224F
6.18E+07
9.27E+06
15%
165%
V158D/T239V/E296V/ M298Q
V21D/T99V/E154V/ M156Q
2.22E+08
1.39E+07
591%
V158D/T239V/E296V/ M298Q f
V21D/T99V/E154V/M1 56Qt
1.65E+08
2.12E+06
438%
T239V/Q286R
T99V/Q143R
8.84E+07
7.16E+05
236%
T239I/Q286R/M298Q/ H237F
T99I/Q143R/M156Q/ H224F
1.08E+08
2.32E+07
21%
289%
T128N/P129A/T239I/Q 286R/M298Q/ H237F f
T[128]N/P[129]A/T991/ Q143R/M156Q/H224F f
1.30E+08
2.51E+07
19%
345%
H257S/Q286R/M298Q
H117S/Q143R/M156Q
1.40E+08
8.97E+06
372%
Замена Gla из FIX /Q286R/S222A/H257S
Замена Gla из FIX /Q143R/S82A/H117S
8.53E+07
1.66E+07
20%
227%
S222A/H257S/Q286R/ M298Q
S82A/H117S/Q143R/ M156Q
1.58E+08
1.76E+07
11%
420%
H257S/Q286R/M298Q/ H373F
H117S/Q143R/M156Q/ H224F
1.52E+08
3.35E+07
22%
407%
S222A/Q286R/M298Q/ H373F
S82A/Q143R/M156Q/ H224F
1.48E+08
2.23 E+06
395%
Замена Gla из
FIX/S222A/
Q286R/M298Q/H373F
Замена Gla из FIX
S82A/Q143R/M156Q/
H224F
2.84E+08
4.85E+07
17%
758%
S222A/Q286R/M298Q
S82A/Q143R/M156Q
1.29E+08
1.86E+07
14%
343%
Замена Gla из FIX/ S222A/Q286R/M298Q
Замена Gla из FIX S82A/Q143R/M156Q
2.10E+08
4.28E+07
20%
559%
T128N/P129A/A175S/ Q366V
T[128]N/P[129]A/A39S /Q217V
3.38E+07
3.06E+06
90%
A122N/G124S/A175S/ Q366V
A[122]N/G[124]S/A39S /Q217V
3.02E+07
7.05E+06
23%
80%
T128N/P129A/A175S/ S222A
T[128]N/P[129]A/A39S /S82A
1.72E+07
3.18E+06
18%
46%
A122N/G124S/A175S/
A[122]N/G[124]S/A39S /S82A
2.08E+07
5.05E+06
24%
56%
S222A
T128N/P129A/A175S/ Q286R
T[128]N/P[129]A/A39S /Q143R
3.33 E+07
1.46E+06
89%
A122N/G124S/A175S/ Q286R
A[122]N/G[124]S/A39S /Q143R
4.11E+07
5.27E+06
13%
110%
Замена Gla из FIX/ S222A/Q286R/H373F
Замена Gla из FIX/ S82A/Q143R/H224F
1.22E+08
3.17E+07
26%
327%
V158D/E296V/M298Q/ H373F
V21D/E154V/M156Q/ H224F
1.51E+08
8.39E+06
402%
H257A/Q286R/M298Q
H117A/Q143R/M156Q
1.13E+08
1.55E+07
14%
301%
Замена Gla из FIX/
T128N/P129A/A175S/
S222A/Q286R
Замена Gla из FIX/
T[128]N/P[129]A/A39S
/S82A/Q143R
3.88E+07
2.74E+06
104%
Замена Gla из FIX/
A122N/G124S/A175S/
S222A/Q286R
Замена Gla из FIX/
A[122]N/G[124]S/A39S
/S82A/Q143R
4.13E+07
8.99E+06
22%
110%
T128N/P129A/A175S/ Q286R/M298Q
T[128]N/P[129]A/A39S /Q143R/M156Q
7.21E+07
1.14E+07
16%
192%
A122N/G124S/A175S/ Q286R/M298Q
A[122]N/G[124]S/A39S /Q143R/M156Q
7.43 E+07
1.10E+07
15%
198%
T128N/P129A/A175S/ S222A/H257A/Q286R/ M298Q
T[128]N/P[129]A/A39S /S82A/H117A/Q143R/ M156Q
6.89E+07
3.36E+06
184%
A122N/G124S/A175S/ S222A/H257A/Q286R/ M298Q
A[122]N/G[124]S/A39S
/S82A/H117A/Q143R/
M156Q
8.40E+07
5.72E+06
224%
T128N/P129A/A175S/ Q286R/M298Q/H373F
T[128]N/P[129]A/A39S /Q143R/M156Q/H224F
5.72E+07
3.36E+06
153%
A122N/G124S/A175S/ Q286R/M298Q/H373F
A[122]N/G[124]S/A39S /Q143R/M156Q/H224F
8.39E+07
9.99E+06
12%
224%
V158D/Q286R/E296V/ M298Q/H373F
V21 D/Q 143 R/E 154 V/ M156Q/H224F
2.39E+08
3.82E+07
16%
638%
M298Q/Q366N/H373F
M156Q/Q217N/H224F
7.05E+07
1.78E+07
25%
188%
T239V/M298Q/H373F t
T99V/M156Q/H224Ft
4.43E+07
1.10E+07
25%
118%
T239I/M298Q/H373F f
T99I/M156Q/H224Ft
3.47E+07
4.57E+06
13%
92%
T128N/P129A/Q286R/ M298Q/Q366N/H373F
T[128]N/P[129]A/ Q143R7M156Q/Q217N/ H224F f
1.33E+08
1.81 E+07
14%
355%
T239V/Q286R/M298Q/ Q366N t
T99V/Q143R/M156Q/ Q217N t
1.85E+08
5.96E+07
32%
491%
T239I/Q286R/M298Q/ Q366N t
T99I/Q143R/M156Q/ Q217Nf
7.40E+07
1.40E+07
19%
197%
ТФ-зависимый анализ
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
^кат/Км
(М^сек"1)
Стандарт -ное
отклонение
Коэффициент вариации
ккат/Км
(% от величи ины для дикого
типа)
Дикий тип (NovoSeven(r))
Дикий тип (NovoSeven(r))
9.8
3.0
30%
88%
Дикий тип (NovoSeven-RT(r))
Дикий тип (NovoSeven-RT(r))
12.4
4.3
35%
112%
Дикий тип
Дикий тип
11.1
2.7
25%
100%
Дикий тип f
Дикий тип f
6.9
2.2
31%
100%
T128N/P129A
T[128]N/P[129]A
17.0
5.2
31%
153%
Замена Gla из FIX
Замена Gla из FIX
41.3
3.0
373%
A122N/G124S
A[122]N/G[124]S
3.4
0.6
16%
31%
S52A/S60A
S[52]A/S[60]A
3.8
34%
M298Q f
M156Qf
69.9
49.4
71%
1013%
T128N/P129AM156Qt
T[128]N/P[129]A/M156
90.8
70.8
78%
1316%
V158D/E296V/M298Q
V21D/E154V/M156Q
1221.7
307.0
25%
11025%
V158D/E296V/M298Q t
V21D/E154V/M156Qf
984.5
308.4
31%
14265%
T128N/P129A/V158D/ E296V/M298Q
T[128]N/P[129]A/ V21D/E154V/M156Q
1375.8
140.3
10%
12415%
S52A/S60A/V158D/ E296V/M1298Q
S[52]A/S[60]A/V21D/ E154V/M156Q
1760.1
575.0
33%
15883%
Q286R
Q143R
10.3
0.7
93%
T128N/P129A/Q286R
T[128]N/P[129]A/ Q143R
8.7
4.3
50%
78%
T128N/P129A/Q286Rt
T[128]N/P[129]A/ Q143R|
10.5
5.6
53%
152%
S52A/S60A/S82A
S[52]A/S[60]A/S82A
10.2
4.7
47%
92%
T128N/P129A/S222A
T[128]N/P[129]A/S82A
4.8
43%
S52A/S60A/S222A
S[52]A/S[60]A/S82A
19.6
177%
H257S
H117S
3.1
1.1
35%
28%
Q366V
Q217V
4.3
0.6
14%
39%
Замена Gla из FIX /Q366V
Замена Gla из FIX /Q217V
90.0
17.7
20%
812%
Q286R/H257A
Q143R/H117A
4.3
2.1
49%
39%
Q286R/H257A f
Q143R/H117Af
2.5
0.0
36%
Замена Gla из FIX/
T128N/P129A/
S222A/Q286R
Замена Gla из FIX/ T[128]N/P[129]A/ S82A/Q143R
15.5
2.9
18%
140%
Замена Gla из FIX/ T128N/P129A/ S222A/Q286R f
Замена Gla из FIX/ T[128]N/P[129]A/ S82A/Q143Rt
21.3
6.5
31%
309%
Замена Gla из FIX/ S52A/S60A/S222A/ Q286R
Замена Gla из FIX/
S[52]A/S[60]A/S82A/
Q143R
2.9
26%
Q286R/S222A/H257A
Q143R/S82A/H117A
21.3
6.5
31%
193%
Q286R/M298Q
Q143R/M156Q
79.9
18.9
24%
721%
Q286R/M298Q f
Q143R/M156Qf
162.4
79.9
49%
2353%
Q286R/M298Q §
Q143R/M156Q§
135.1
7.3
1957%
Замена Gla из FIX/ Q286R/M298Q
Замена Gla из FIX/ Q143R/M156Q
672.7
79.1
12%
6070%
Замена Gla из FIX/ Q286R/M298Q t
Замена Gla из FIX/ Q143R/M156Qf
678.2
249.0
37%
9826%
T128N/P129A/Q286R/ M298Q
T[128]N/P[129]A/ Q143R/M156Q
81.6
13.4
16%
736%
T128N/P129A/Q286R/ M298Q f
T[128]N/P[129]A/ Q143R/M156Qf
212.5
135.4
64%
3079%
Замена Gla из FIX
/T128N/P129A/Q286R/
M298Q
Замена Gla из FIX /T[128]N/P[129]A/ Q143R/M156Q
83.8
35.3
42%
756%
Замена Gla из FIX /T128N/P129A/Q286R/ M298Q f
Замена Gla из FIX /T[128]N/P[129]A/ Q143R/M156Qf
751.9
305.3
41%
10895%
{Замена Gla из
FIX/E40L}/
Q286R/M298Q
{Замена Gla из
FIX/E[40]L}/
Q143R/M156Q
814.1
89.0
11%
7346%
{Замена Gla из
FIX/K43I}/
Q286R/M298Q
{Замена Gla из
FIX/K[43]I}/
Q143R/M156Q
902.4
360.6
40%
8144%
{Замена Gla из FIX/K43I}/ Q286R/M298Q f
{Замена Gla из
FIX/K[43]I}/
Q143R/M156Qf
794.2
178.7
23%
11508%
{Замена Gla из
{Замена Gla из
729.0
4.5
6578%
FIX/Q44S}/ Q286R/M298Q
FIX/Q[44]S}/ Q143R/M156Q
{Замена Gla из FIX/MI 9К}/ Q286R/M298Q
{Замена Gla из FIX/M[19]K}/ Q143R/M156Q
512.0
51.4
10%
4620%
S52A/S60A/ Q286R/M298Q
S[52]A/S[60]A/Q143R/ M156Q
216.8
1.6
1956%
Замена Gla из
FIX/S52A/S60A/
Q286R/M298Q
Замена Gla из
FIX/S[52]A/
S[60]A/Q143R/M156Q
988.7
207.5
21%
14327%
{Замена Gla из FIX/K43I}
/T128N/P129A/Q286R/ M298Q t
{Замена Gla из FIX/K[43]I}/ T[128]N/P[129]A/ Q143R/M156Qf
389.4
34.3
5642%
S222A/H257A/Q286R/ M298Q
S82A/H117A/Q143R/ M156Q
345.3
99.9
29%
3116%
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82A /H117A/Q143R/M156Q
24.8
17.2
69%
224%
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82A /H117A/Q143R/M156Q
82.6
40.2
49%
1196%
S52A/S60A/S222A/ H257A/Q286R/M298Q
S[52]A/S[60]A/S82A/ H117A/Q143R/M156Q
115.6
62.9
54%
1043%
H257S/Q286R/Q366V
H117S/Q143R/Q217V
7.7
1.8
23%
69%
S222A/H257A/Q286R/ Q366V
S82A/H117A/Q143R7 Q217V
12.5
2.8
23%
113%
Q286R/M298Q/Q366N
Q143R/M156Q/Q217N
65.9
33.4
51%
595%
T129N/P129A/Q286R/ M298Q/Q366N f
T[129]N/P[129]A/
Q143R/M156Q/Q217N
64.6
28.7
44%
936%
{Замена Gla из FIX/
K43I}/Q286R/M298Q/
Q217Nf
{Замена Gla из FIX/
K[43]I}/Q143R/M156Q
/Q217Nf
84.9
76.5
90%
1230%
{Замена Gla из FIX/K43I}
/T128N/P129A/Q286R/ M298Q/Q366N t
{Замена Gla из FIX/ K[43]I}/T[128]N/ P[129]A/Q143R/M156 Q/Q217Nf
218.5
137.8
63%
3166%
Q286R/H373F
Q143R/H224F
81.6
123.7
152%
736%
T128N/P129A/ Q286R/H373F
T[128]N/P[129]A/ Q143R/H224F
6.6
0.9
13%
59%
S52A/S60A/Q286R/H37 3F
S[52]A/S[60]A/Q143R/ H224F
30.1
272%
Q286R/M298Q/H373F
Q143R/M156Q/H224F
114.8
24.7
22%
1036%
T128N/P129A/Q286R/ M298Q/H373F t
T[128]N/P[129]A/ Q143R/M156Q/H224F
30.7
8.9
29%
277%
S52A/S60A/Q286R/ M298Q/H373F
S[52]A/S[60]A/Q143R/ M156Q/H224F
63.3
10.8
17%
571%
M298Q/H373F
M156Q/H224F
96.4
47.0
49%
870%
T128N/P129A/M298Q/ H373F
T[128]N/P[129]A/ M156Q/H224F
91.6
48.0
52%
1327%
V158D/Q286R/E296V/ M298Q
V21D/Q143R/E154V/M 156Q
1023.9
339.3
33%
9240%
S222A/T239V
S82A/T99V
3.0
27%
Замена Gla из FIX /S222A/T239V/Q286R
Замена Gla из FIX /S82A/T99V/Q143R
17.4
2.2
13%
157%
Замена Gla из FIX /S222A/T239V/Q286R f
Замена Gla из FIX /S82A/T99V/Q143Rf
87.9
61.7
70%
1274%
T239V/Q286R/M298Q
T99V/Q143R/M156Q
29.3
6.2
21%
264%
Замена Gla из FIX/ T239V/Q286R/M298Q
Замена Gla из FIX/ T99V/Q143R/M156Q
277.7
64.2
23%
2506%
Замена Gla из FIX/ T239V/Q286R/M298Q
Замена Gla из FIX/ T99V/Q143R/M156Qt
902.4
323.5
36%
13076%
T128N/P129A/ T239V/Q286R/M298Q
T[128]N/P[129]A/ T99V/Q143R/M156Qf
229.7
134.1
58%
3329%
S222A/T239V/H257A/ Q286R/M298Q
S82A/T99V/H117A/ Q143R/M156Q
143.0
93.1
65%
1290%
T128N/P129A/
S222A/T239V/H257A/
Q286R/M298Q
T[128]N/P[129]A/
S82A/T99V/H117A/Q1
43R/M156Q
179.0
80.5
45%
2593%
T239V/Q286R/H373F
T99V/Q143R/H224F
12.2
110%
T239V/Q286R/M298Q/ H373F
T99V/Q143R/M156Q/ H224F
40.7
5.2
13%
367%
T128N/P129A/T99V/ Q143R/M156Q/H224F
T[128N]/P129]A/T99V/ Q143R/M156Q/H224F
290.0
72.9
25%
4203%
V158D/T239I/E296V/ M298Q
V21D/T99I/E154V/ M156Q
216.3
32.5
15%
1951%
T239I/Q286R
T99I/Q143R
4.6
1.3
28%
41%
S222A/T239I
S82A/T99I
1.7
15%
Замена Gla из FIX /S222A/T239I/Q286R
Замена Gla из FIX /S82A/T99I/Q143R
20.3
184%
T239I/Q286R/M298Q
T99I/Q143R/M156Q
11.3
4.0
35%
102%
Замена Gla из FIX / T239I/Q286R/M298Q
Замена Gla из FIX /T99I/Q143R/M156Q
244.0
9.6
2202%
T128N/P129A/T239I/Q 286R/M298Q
T[128N]/P129]A/T99I/ Q143R/M156Q
77.8
40.3
52%
1128%
S222A/T239I/H257A/ Q286R/M298Q
S82A/T99I/H117A/ Q143R/M156Q
51.6
5.7
11%
466%
V158D/T239V/E296V/ M298Q
V21D/T99V/E154V/ M156Q
1864.3
374.0
20%
16823%
V158D/T239V/E296V/ M298Q t
V21D/T99V/E154V/ M156Qt
4231.6
913.4
22%
61315%
T239V/Q286R
T99V/Q143R
11.8
4.1
35%
106%
T239I/Q286R/M298Q/ H373F
T99I/Q143R/M156Q/ H224F
13.1
3.8
29%
118%
T128N/P129A/T239I/ Q286R/M298Q/H373F f
T[128]N/P[129]A/T99I/ Q143R/M156Q/H224F
113.3
43.7
39%
1642%
H257S/Q286R/M298Q
H117S/Q143R/M156Q
27.4
4.1
15%
247%
Замена Gla из FIX /S8222A/H257S/Q143R
Замена Gla из FIX /S82A/H117S/Q143R
20.5
3.6
18%
185%
S222A/Q286R/M298Q/ H373F
S82A/Q143R/M156Q/ H224F
41.7
9.1
22%
376%
H257S/Q286R/M298Q/ H373F
H117S/Q143R/M156Q/ H224F
30.4
9.1
30%
274%
S82A/Q143R/M156Q/ H224F
S82A/Q143R/M156Q/ H224F
430.2
126.8
29%
3883%
Замена Gla из
FIX/S222A/
Q286R/M298Q/H373F
Замена Gla из FIX/
S82A/Q143R/M156Q/H
224F
192.1
36.8
19%
1733%
S222A/Q286R/M298Q
S82A/Q143R/M156Q
252.9
7.4
2282%
Замена Gla из FIX/ S222A/Q286R/M298Q
Замена Gla из FIX/ S82A/Q143R/M156Q
414.7
81.3
20%
3742%
T128N/P129A/A175S/ Q366V
T[128]N/P[129]A/A39S /Q217V
3.4
1.0
29%
30%
A122N/G124S/A175S/ Q366V
A[122]N/G[124]S/A39S /Q217V
3.0
0.8
26%
27%
T128N/P129A/A175S/ S222A
T[128]N/P[129]A/A39S /S82A
1.9
0.5
26%
17%
T128N/P129A/A175S/ Q286R
T[128]N/P[129]A/A39S /Q143R
3.3
1.2
37%
29%
A122N/G124S/A175S/ Q286R
A[122]N/G[124]S/A39S /Q143R
3.0
0.7
23%
27%
Замена Gla из FIX/ S222A/Q286R/H373F
Замена Gla из FIX/ S82A/Q143R/H224F
81.2
66.7
82%
732%
V158D/E296V/M298Q/ H373F
V21D/E154V/M156Q/H 224F
1297.2
486.1
37%
11706%
H257A/Q286R/M298Q
H117A/Q143R/M156Q
61.5
43.8
71%
555%
Замена Gla из FIX/
T128N/P129A/A175S/S
222A/Q286R
Замена Gla из FIX/
T[128]N/P[129]A/A39S
/S82A/Q143R
30.5
276%
T128N/P129A/A175S/ S222A/H257A/Q286R/ M298Q
T[128]N/P[129]A/A39S /S82A/H117A/Q143R/ M156Q
20.3
3.8
19%
183%
V158D/Q286R/E296V/ M298Q/H373F
V21D/Q143R/E154V /M156Q/H224F
573.6
100.4
18%
5176%
M298Q/Q366N/H373F
M156Q/Q217N/H224F
125.9
75.2
60%
1825%
T239V/M298Q/H373F f
T99V/M156Q/H224Ff
319.5
125.0
39%
4629%
T239I/M298Q/H373F t
T99I/M156Q/H224Ff
138.2
101.9
74%
2003%
T128N/P129A/Q286R/ M298Q/Q366N/H373F
T[128]N/P[129]A/ Q143R/M156Q/Q217N/ H224F f
160.9
43.3
27%
2331%
T239V/Q286R/M298Q/ Q366N t
T99V/Q143R/M156Q/ Q217Nf
64.2
36.3
57%
931%
T239I/Q286R/M298Q/ Q366N t
T99I/Q143R/M156Q/ Q217Nf
88.8
23.5
26%
1287%
•f полученные в клетках СНОХ
§ полученные в стабильном клоне 52-5F7 клеточной линии СНОХ Пример 5. Определение ингибирования FVIIa/ТФ или FVIIa АТ-Ш/гепарином.
Силу взаимодействия между комплексом АТ-Ш/гепарин и FVIIa в присутствии или в отсутствие растворимого тканевого фактора (рТФ), т. е. ТФ-зависимо или ТФ-независимо, оценивали путем измерения уровня ингибирования различными концентрациями АТ-III каталитической активности FVIIa/рТФ по отношению к субстрату мезил-FPR-ACC. Для каждого исследованного варианта FVIIa была определена величина K05, которая соответствует молярной концентрации АТ-III, которая требуется для 50% ингибирования (IC50) варианта FVIIa в анализе в течение 30 мин при комнатной температуре (25°С). Были проведены два отдельных анализа, один в присутствии рТФ, и один в отсутствие рТФ. 2 мкМ раствор АТ-Ш/гепарина (5 мкМ гепарин) приготовили смешиванием 26,4 мкл 151,7 мкМ АТ-III (очищенный из плазмы человеческий АТ-III; Molecular Innovations) с 50 мкл 0,2 мМ LMW (низкомолекулярного) гепарина (CalBiochem), 400 мкл 5х буфера (100 мМ Hepes, 750 мМ NaCl, 25 мМ CaCl2, 0,05% БСА, 0,5% ПЭГ 8000, рН 7,4) и 1,523 мл химически чистой воды. Этот раствор использовали в качестве раствора ТФ для ТФ-зависимого анализа с самой высокой концентрацией. Раствор, содержащий 4 мкМ АТ-Ш/гепарин (5 мкМ гепарин), для ТФ-независимого анализа готовили смешиванием 52,8 мкл 151,7 мкМ АТ-III (Molecular Innovations) с 50 мкл 0,2 мМ LMW гепарина (CalBiochem), 400 мкл 5 х буфера для анализа и 1,497 мл химически чистой воды. Раствор АТ-Ш/гепарина инкубировали в течение 5-10 мин при комнатной температуре, а затем последовательно разводили в два раза в 96-луночном полипропиленовом планшете с глубокими лунками с окончательным объемом 1 мл с содержанием гепарина 5 мкМ, в результате чего получили разведения 2000, 1000, 500, 250, 125, 62,5, 31,25 и 0 нМ или 4000, 2000, 1000, 500, 250, 125, 62,5 и 0 нМ. Варианты FVIIa и FVIIa дикого типа разбавляли до 250 нМ 1 х буфером (20 мМ Hepes, 150 мМ NaCl, 5 мМ CaCl2, 0,01% БСА, 0,1% ПЭГ 8000, рН 7,4). Для ТФ-зависимого анализа был получен 5 нМ FVIIa/50 нМ рТФ комплекс путем смешивания 20 мкл FVIIa с 10 мкл 5 мкМ рТФ (R &D Systems, человеческий фактор свертывания III: # 2339-РА), 200 мкл 5 х буфера для анализа и 770 мкл химически чистой воды и инкубации раствора в течение 10-15 мин при комнатной температуре. Для ТФ-независимого анализа 100 мкл FVIIa смешивали с 200 мкл 5 х буфера для анализа и 700 мкл химически чистой воды с получением 25 нМ раствора FVIIa. Для начала анализа 25 мкл раствора FVIIa/ТФ или FVIIa отдельно смешивали с 25 мкл каждого разведения АТ-Ш/гепарина в лунках 96-луночного черно планшета для анализа формата half area (Nunc). Окончательные условия ТФ-зависимого анализа составляли 2,5 нМ FVIIa/25 нМ рТФ, а концентрация АТ-Ш/гепарина варьировала в пределах от 1000 до 0 нМ. Для ТФ-независимого анализа концентрация FVIIa составляла 12,5 нМ, а концентрация АТ-Ш/гепарина колебались от 2000 до 0 нМ. Планшеты инкубировали в течение 30 мин при встряхивании при комнатной температуре (~25°С).
Исходный раствор субстрата FVIIa (Мезил-FPR-ACC) готовили растворением субстрата в ДМСО до 20 мМ, затем получали рабочий 0,5 мМ раствор в 1 х буфере для анализа. После инкубации планшета в каждую лунку планшета для анализа добавляли 50 мкл субстрата FVIIa. Реакционную смесь перемешивали и остаточную активность FVIIa оценивали после расщепления субстрата в течение 15 мин с помощью планшетного сканера при 30°С.
Для определения степени ингибирования FVIIa или вариантов FVIIa АТ-Ш/гепарином необработанные данные, полученные с помощью приложения SoftMax Pro (Molecular Devices), экспортировали в виде .XML-файлов. Дальнейшие нелинейный анализ данных проводили с помощью пакета программного обеспечения XLfit4 для автоматизированного аппроксимирования кривых и статистического анализа в интерфейсе таблиц Microsoft Excel (IDBS Software). Для расчета последовательных разведений АТ-III,
соотношения АТ-III к FVIIa и соотношения Vi/V o для каждого варианта FVIIa с каждой экспериментальной концентрацией АТ-III были использованы электронные таблицы. Нелинейный регрессионный анализ зависимости остаточной активности FVIIa (представленный в виде Vi/V o) от концентрации АТ-III обрабатывали с помощью XLfit4 и гиперболического уравнения ингибирования в форме ((С + (Amp*(1-(X/(K05 + X))))); где С - смещение (устанавливали в 0 для экстраполяции наборов данных, которые не достигают 100% ингибирования в ходе анализа), Amp - амплитуда аппроксимации и K05 соответствует концентрации АТ-III, необходимой для достижения половины максимального ингибирования в условиях анализа. Для нескольких вариантов FVIIa АТ-III ингибировал менее 20-25% от общей протеазной активности при самой высокой исследованной концентрации АТ-III, которая составляет верхний предел обнаружения для анализа. Поэтому варианты с менее чем 20-25% максимальным ингибированием относятся к вариантам с самым низким K05 (5 мкМ в присутствии ТФ и 10 мкМ без ТФ) и в большинстве случаев, ожидается, что указанные варианты обладают большей устойчивостью к АТ-III, чем указанная.
В табл. 16 и 17 представлены результаты анализов, которые проводили с использованием вариантов FVIIa, экспрессированных в Freestyle(tm) 293-F клетках и/или BHK-21 клетках в присутствии и в отсутствие ТФ соответственно. Результаты представлены в виде параметров аппроксимации K05 и в виде относительной устойчивости каждого варианта к АТ-III по сравнению с FVIIa дикого типа, выражаемой как отношение их значений K05 (K05 варианта/Ko^ дикого типа). Несколько вариантов FVIIa проявляли повышенную устойчивость к АТ-III по сравнению с FVIIa дикого типа. Например, Q286R-FVIIa (т.е. FVIIa, содержащий мутацию Q286R), Q286R/S222A-FVIIa, Q286R/S222A/замена Gla из FIX-FVIIa, A175S/Q286R/Q366V-FVIIa, Q286M-FVIIa, Q286L-FVIIa и Q286Y-FVIIa проявляли устойчивость к АТ-III в отсутствие ТФ, которая в 4 раза больше устойчивости FVIIa дикого типа.
Таблица 16
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
ТФ-зависимый анализ на устойчивость к АТ-Ш
293-F клетки
ВНК-21 клетки
Ко.5 (нМ)
Ко.5МуТанта / Ко.5Дикого типа
Ко.5
(нМ)
Ко.5мутянта / Ко.5дикого типа
T239S
T99S
254.6
3.5
T239Q
T99Q
117.2
2.1
T239V
T99V
42.5
0.8
T239L
T99L
81.1
1.4
Т239Н
Т99Н
52.0
0.9
T239I
T99I
125.3
2.2
H257A/M298Q
H117A/M156Q
89.1
1.6
S222A/H257A/ Q286R/M298Q
S82A/H117A/Q143R7 M156Q
66.6
0.9
Q286R/Q366V
Q143R/Q217V
62.0
1.1
A175S/Q286R/ Q366V
A39S/Q143R/Q217V
72.0
1.3
S222A/Q286R/ Q366V
S82A/Q143R/Q217V
38.5
0.7
Q286M
Q143M
53.1
0.7
Q286L
Q143L
114.4
1.6
Q286Y
Q143Y
131.3
1.8
Q366I
Q217I
23.2
0.3
Q366L
Q217L
23.0
0.3
Q366M
Q217M
35.4
0.5
Таблица 17
Ингибирование вариантов FVIIa АТ-Ш/гепарином в отсутствие ТФ
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
ТФ-зависимый анализ на устойчивость к АТ-Ш
293-F клетки
ВНК-21 клетки
Ко.5
(нМ)
Ко.5мутанта / Ко.5дикого типа
К0.5(нМ)
Ко.5мутанта / Ко.5дикого типа
Дикий тип
Дикий тип
2265
1.0
2222
1.0
V158D/E296V/ M298Q
V21D/E154V/M156Q
389
0.2
415
0.2
Q286R
Q143R
10000
> 4.4
10000
> 4.5
S222A
S82A
2338
1.0
2088
0.9
H257S
H117S
5884
2.6
5584
2.5
H373D
H224D
10000
> 4.4
Н373Е
Н224Е
6949
3.1
H373S
H224S
9513
4.2
H373F
H224F
1306
0.6
Н373А
Н224А
10000
> 4.4
Q366D
Q217D
10000
> 4.4
Q366E
Q217E
6901
3.0
Q366N
Q217N
5186
2.3
Q366T
Q217T
5885
2.6
Q366S
Q217S
10000
> 4.4
Q366V
Q217V
487
0.2
531
0.2
A175S
A39S
5785
2.6
A122N/G124S
A[122]N/G[124]S
2926
1.3
Q286R/S222A
Q143R/S82A
10000
> 4.5
Q286R/S222A/ замена Gla FIX
Q143R/S82A/3aMeHa Gla FIX
10000
> 4.4
Q286R/M298Q
Q143R/M156Q
3663
1.6
Q286R/M298Q/ K341Q
Q143R/M156Q/ K192Q
Q286R/M298Q/ К199Е
Q143R/M156Q/ КбОсЕ
5182
2.3
Р321К
P170iK
5274
2.4
Р321Е
P170iE
3666
1.6
P321Y
P170iY
705
0.3
P321S
P170iS
2689
1.2
T239S
T99S
10000
> 4.4
T239Q
T99Q
2222
1.0
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
ТФ-зависимый анализ на устойчивость к АТ-Ш
293-F клетки
ВНК-21 клетки
Ко.5
(нМ)
Ко.5Мутанта ^ К().5дикоготипа
Ko.s (нМ)
Кп.5Мутанта / Ко.5дикого типа
T239V
T99V
2644
1.2
T239L
T99L
8532
3.8
Т239Н
Т99Н
10000
> 4.5
T239I
T99I
10000
> 4.5
H257A/M298Q
H117A/M156Q
1344
0.6
S222A/H257A/ Q286R/M298Q
S82A/H117A/Q143R/ M156Q
7742
3.4
Q286R/Q366V
Q143R/Q217V
2251
1.0
A175S/Q286R/ Q366V
A39S/Q143R/Q217V
10000
> 4.5
S222A/Q286R/ Q366V
S82A/Q143R/Q217V
3398
1.5
Q286M
Q143M
10000
> 4.4
Q286L
Q143L
10000
> 4.4
Q286Y
Q143Y
10000
> 4.4
Q366I
Q217I
599
0.3
Q366L
Q217L
1708
0.8
Q366M
Q217M
914
0.4
Для оценки ингибирования вариантов FVIIa AT-III/гепарином в отсутствие ТФ был проведен еще один набор экспериментов, как описано выше, но с незначительными изменениями. Для увеличения скорости реакции ингибирования вместо низкомолекулярного гепарина (LMW-гепарина) был использован полноразмерный нефракционированный гепарин (Calbiochem) (см., например, Olson и др., (2004) Thromb Haemost 92(5), 929-939). Инкубационный период анализа был увеличен до 60 мин, а концентрацию мезил-FPR-ACC субстрата, используемого для определения остаточной активности, увеличили до конечной концентрации 0,5 мМ. В табл. 18 приведены результаты анализов, которые проводили в отсутствие ТФ с использованием вариантов FVIIa, экспрессированных в BHK-21 клетках и СНОХ клетках. Результаты представлены в виде параметров аппроксимации K05 и в виде относительной устойчивости каждого варианта к АТ-III по сравнению с FVIIa дикого типа, выражаемой как отношение их значений K05 (K05 ва-рианта/Ko 5 дикого типа). Также приведены величины стандартного отклонения (SD) и количества проб (N).
Таблица 18
Ингибирование вариантов FVIIa АТ-Ш/гепарином в отсутствие ТФ
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.s (нМ)
Стандартное
ние
Коэффициент вариации, °/о
К),5 мутанта/ К),5 дикого
WT (NovoSeven(r))
WT (NovoSeven(r))
424.3
70.9
17%
1.08
WT (NovoSeven-RT(r))
WT (NovoSevenRT(r))
424.2
60.5
14%
1.08
393.8
67.8
17%
1.00
WTf
WTf
503.0
120.0
24%
1.00
T128N/P129A
T[128]N/P[129]A
465.3
28.1
1.18
замена Gla FIX
замена Gla FIX
298.9
0.76
K109N
K[109]N
330.1
72.3
22%
0.84
A122N/G124S
A[122]N/G[124]S
372.5
28.6
0.95
S52A/S60A
S[52]A/S[60]A
360.6
0.92
M298Q
M156Q
120.1
14.1
12%
0.31
M298Q f
M156Qt
130.0
14.3
11%
0.26
T128N/P129A/M298Q
T[128]N/P[129]A/M1 56Qf
143.9
14.5
10%
0.29
V158D/E296V/M298Q
V21D/E154V/M156Q
75.5
10.1
13%
0.19
V158D/E296V/M298Q
V21D/E154V/M156Q
77.4
18.0
23%
0.15
T128N/P129A/V158D/ E296V/M298Q
T[128]N/P[129]A/V2 1D/E154V/M156Q
81.6
3.8
0.21
S52A/S60A/V158D/E2 96V/M1298Q
S[52]A/S[60]A/V21D/ E154V/M156Q
78.8
2.9
0.20
Q286R
Q143R
1085.1
320.0
29%
2.76
T128N/P129A/Q286R
T[128]N/P[129]A/Q1 43R
1645.2
440.2
27%
4.18
T128N/P129A/Q286Rf
T[128]N/P[129]A/Q1 43Rt
1739.2
467.0
27%
3.46
S52A/S60A/Q143R
S[52]A/S[60]A/Q143
1318.0
376.8
29%
3.35
S222A
S82A
383.5
84.4
22%
0.97
T128N/P129A/S222A
T[128]N/P[129]A/S82
401.0
1.02
H257S
H117S
722.8
1.84
Q366V
Q217V
101.1
24.7
24%
0.26
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное
отклонение
Коэффициент вариации, %
Ко,5 мутанта/ Ко,5 дикого типа
Gla swapFIX/Q366V
Gla swapFIX/Q217V
108.2
5.8
0.27
A175S
A39S
1328.0
96.2
3.37
K109N/A175S
K[109]N/A39S
2031.8
401.2
20%
5.16
S119N/L121S/A175S
S[119]N/L[121]S/A39
1637.2
171.3
10%
4.16
T128N/P129A/A175S
T[128]N/P[129]A/A3 9S
1392.7
295.3
21%
3.54
A122N/G124S/A175S
A[122]N/G[124]S/A3 9S
1345.8
241.1
18%
3.42
Q286R/H257A
Q143R/H117A
2398.7
551.2
23%
6.09
Q286R/H257A f
Q143R/H117Af
2800.8
938.4
34%
5.57
Q286R/S222A
Q143R/S82A
1203.0
191.2
16%
3.05
замена Gla FIX/
T128N/P129A/
S222A/Q286R
замена Gla FIX/
T[128]N/P[129]A/
S82A/Q143R
1703.2
145.2
4.32
Q286R/S222A/H257A
Q143R/S82A/H117A
2592.0
806.5
31%
6.58
Q286R/M298Q
Q143R/M156Q
299.3
62.9
21%
0.76
Q286R/M298Q f
Q143R/M156Qf
287.3
26.6
0.57
Q286R/M298Q §
Q143R/M156Q §
395.1
56.4
14%
0.79
замена Gla FIX/ Q286R/M298Q
замена Gla FIX/ Q143R/M156Q
281.6
43.2
15%
0.72
замена Gla FIX/ Q286R/M298Q f
замена Gla FIX/ Q143R/M156Qf
238.2
21.6
0.47
T128N/P129A/Q286R/ M298Q
T[128]N/P[129]A/Q1 43R/M156Q
283.7
49.4
17%
0.72
T128N/P129A/Q286R/ M298Q f
T[128]N/P[129]A/Q1 43R/M156Qf
283.7
77.6
27%
0.56
замена Gla FIX
/T128N/P129A/Q286R/
M298Q
замена Gla FIX
/T[128]N/P[129]A/Q1
43R/M156Q
508.2
197.0
39%
1.29
замена Gla FIX /T128N/P129A/Q286R/ M298Q f
замена Gla FIX
/T[128]N/P[129]A/Q1
43R/M156Qf
325.2
82.2
25%
0.65
{замена Gla FIX/E40L}/ Q286R/M298Q
{замена Gla FIX/E[40]L}/ Q143R/M156Q
286.7
2.4
0.73
{замена Gla
{замена Gla
244.3
29.8
12%
0.62
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное
отклонение
Коэффициент вариации, °/о
Ко,5 мутанта/ Kfl,5 дикого типа
FIX/K43I}/ Q286R/M298Q
FIX/K[43]I}/ Q143R/M156Q
{замена Gla FIX/K43I}/ Q286R/M298Q f
{замена Gla FIX/K[43]I}/ Q143R/M156QI
219.3
13.7
0.44
{замена Gla FIX/Q44S}/ Q286R/M298Q
{замена Gla
FIX/Q[44]S}/
Q143R/M156Q
271.4
12.4
0.69
{замена Gla FIX/M19K}/ Q286R/M298Q
{замена Gla
FIX/M[19]K}/
Q143R/M156Q
309.6
0.79
замена Gla FIX /S52A/S60A/ Q286R/M298Q f
замена Gla FIX
/S[52]A/S[60]A/Q143
R/M156Qf
253.6
0.50
{замена Gla
FIX/MI 9K7E40L/K43I/
Q44S}/ Q286R/M298Q
{замена Gla FIX/M[19]K/E[40]L/ K[43]I/ Q[44]S} /Q143R/M156Q
339.3
100.8
30%
0.86
{замена Gla FIX/K43I}/T128N/P12 9А/ Q286R/M298Q f
{замена Gla FIX/K[43]I}/ T[128]N/P[129]A/Q1 43R/M156QI
222.5
10.7
0.44
S222A/H257A/Q286R/ M298Q
S82A/H117A/Q143R/ M156Q
313.9
0.80
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82 A/H117A/Q143R/M1 56Q
653.0
127.9
20%
1.66
T128N/P129A/S222A/ H257A/Q286R/M298Q
T[128]N/P[129]A/S82 A/H117A/Q143R/M1 56Qf
327.7
23.2
0.65
S52A/S60A/S222A/H2 57A/Q286R/M298Q
S[52]A/S[60]A/S82A/ H117A/Q143R/M156
447.6
117.6
26%
1.14
Q286R/M298Q/Q366N
Q143R/M156Q/Q217 N
324.1
77.9
24%
0.82
T128N/P129A/Q286R/ M298Q/Q366N f
T[129]N/P[129]A/Q1 43R/M156Q/Q217Nf
345.8
24.2
0.69
{замена Gla FIX/K43I}/Q286R/M29 8Q/Q366N f
{замена Gla
FIX/K[43]I}/Q143R/
M156/Q217Nf
404.4
48.0
12%
0.80
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное
ние
Коэффициент вариации,%
Ко,5 мутанта/ Ко,5 дикого
{замена Gla FIX/K43I} /T[128]N/P[129]A/Q28 6R/M298Q/Q366N f
{замена Gla FIX/K[43]I}/ T[128]N/P[129]A/Q1 43R/M156Q/Q217Nt
319.1
71.8
22%
0.63
Q286R/H373F
Q143R/H224F
620.8
133.4
1.58
T128N/P129A/ Q286R/H373F
T[128]N/P[129]A/ Q143R/H224F
590.4
104.2
18%
1.50
Q286R/M298Q/H373F
Q143R/M156Q/H224 F
152.1
7.2
0.39
T128N/P129A/Q286R/ M298Q/H373F
T[128]N/P[129]A/
Q143R/M156Q/H224
182.6
43.2
24%
0.46
M298Q/H373F
M156Q/H224F
81.7
10.5
13%
0.21
T128N/P129A /M156Q/H224Ff
T[128]N/P[129]A /M156Q/H224F|
89.1
3.8
0.18
V21 D/Q 143R/E154V/ M156Q
V21D/Q143R/E154V/ M156Q
85.0
14.7
17%
0.22
S222A/T239V
S82A/T99V
967.3
282.6
29%
2.46
замена Gla FIX /S222A/T239V/Q286R
замена Gla FIX /S82A/T99V/Q143R
2438.4
269.4
11%
6.19
замена Gla FIX
/S222A/T239V/Q286R
замена Gla FIX /S82A/T99V/Q143R f
1343.5
507.1
38%
2.67
T239V/Q286R/M298Q
T99V/Q143R/M156Q
3626.9
1465.9
40%
9.21
замена Gla FIX/ T239V/Q286R/M298Q
замена Gla FIX/ T99V/Q143R/M156Q
483.7
65.6
14%
1.23
замена Gla FIX/ T239V/Q286R/M298Q
замена Gla FIX/ T99V/Q143R/M156Q
314.3
0.62
T128N/P129A/ T239V/Q286R/M298Q
T[128]N/P[129]A/
T99V/Q143R/M156Q
266.4
52.1
20%
0.53
S222A/T239V/H257A/ Q286R/M298Q
S82A/T99V/H117A/ Q143R/M156Q
469.3
133.2
28%
1.19
T128N/P129A/ S222A/T239V/H257A/ Q286R/M298Q |
T[128]N/P[129]A/
S82A/T99V/H117A/
Q143R/M156Qt
326.5
55.3
17%
0.65
T239V/Q286R/H373F
T99V/Q143R/H224F
630.6
194.0
31%
1.60
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное отклонение
Коэффициент вариации, °/о
Ко,5 мутанта/ Ко,5 дикого
T128N/P129A/T239V/ Q286R/M298Q/H373F
T[128N]/P129]A/ T99V/Q143R/M156Q/ H224F t
121.2
25.8
21%
0.24
V158D/T239I/E296V /M298Q
V21D/T99I/E154V /M156Q
179.5
50.5
28%
0.46
T239I/Q286R
T99I/Q143R
5823.0
2185.5
38%
14.79
S222A/T239I
S82A/T99I
1149.8
12.8
2.92
GlaSwapFIX/S222A/T2 39I/Q286R
замена Gla FIX /S82A/T99I/Q143R
3313.1
130.3
8.41
T239I/Q286R/M298Q
T99I/Q143R/M156Q
1611.4
185.9
12%
4.09
замена Gla FIX / T239I/Q286R/M298Q
замена Gla FIX /T99I/QI43R/M156Q
1171.3
104.5
2.97
T128N/P129A T239I/Q286R/M298Q f
T[128N]/P129]A T99I/Q143R/M156Q
917.0
60.5
1.82
S222A/T239I/H257A/ Q286R/M298Q
S82A/T99I/H117A/ Q143R/M156Q
1223.6
18.9
3.11
T239I/Q286R/H373F
T99I/Q143R/H224F
1007.6
29.8
2.56
V158D/T239V/E296V/ M298Q
V21D/T99V/E154V/ M156Q
67.7
16.6
24%
0.17
V158D/T239V/E296V/ M298Q t
V21D/T99V/E154V/ M156Qf
67.1
0.13
T239V/Q286R
T99V/Q143R
1787.9
106.3
4.54
T239I/Q286R/M298Q/ H237F
T99I/Q143R/M156Q/ H224F
370.4
3.0
0.94
T128N/P129AT239I/Q 286R/M298Q H237F f
T[128]N/P[129]AT99I /Q143R/M156Q /H224F t
316.6
24.7
0.63
S222A/H257S/Q286R/ M298Q
S82A/H117S/Q143R/ M156Q
526.7
1.34
S222A/Q286R/M298Q/ H373F
S82A/Q143R/M156Q/ H224F
163.2
46.9
29%
0.41
замена Gla FIX/S222A/ Q286R/M298Q/H373F
замена Gla FIX
S82A/Q143R/M156Q/
H224F
163.5
58.2
36%
0.42
S222A/Q286R/M298Q
S82A/Q143R/M156Q
308.4
119.9
39%
0.78
замена Gla FIX/ S222A/Q286R/M298Q
замена Gla FIX S82A/Q143R/M156Q
266.3
104.2
39%
0.68
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное
отклонение
Коэффициент вариации,%
Ко,5 мутанта/ Ко,5 дикого
T128N/P129A/A175S/ Q366V
T[128]N/P[129]A/ A39S/Q217V
332.6
56.2
17%
0.84
A122N/G124S/A175S/ Q366V
A[122]N/G[124]S/ A39S/Q217V
336.1
11.0
0.85
T128N/P129A/A175S/ S222A
T[128]N/P[129]A/ A39S/S82A
1913.4
4.86
A122N/G124S/A175S/ S222A
A[122]N/G[124]S/ A39S/S82A
1548.6
394.1
25%
3.93
T128N/P129A/A175S/ Q286R
T[128]N/P[129]A/ A39S/Q143R
9545.5
2797.3
29%
24.24
A122N/G124S/A175S/ Q286R
A[122]N/G[124]S/A3 9S/Q143R
6923.3
17.58
замена Gla FIX/ S222A/Q286R/H373F
замена Gla FIX/ S82A/Q143R/H224F
587.3
5.1
1.49
H257A/Q286R/M298Q
H117A/Q143R/ M156Q
390.8
0.99
замена Gla FIX/
T128N/P129A/A175S/
S222A/Q286R
замена Gla FIX/
T[128]N/P[129]A/
A39S/S82A/Q143R
6486.4
148.2
16.47
замена Gla FIX/
A122N/G124S/A175S/
S222A/Q286R
замена Gla FIX/
A[122]N/G[124]S/
A39S/S82A/Q143R
5524.0
1434.1
26%
14.03
T128N/P129A/A175S/ Q286R/M298Q
T[128]N/P[129]A/ A39S/Q143R/M156Q
2311.8
520.7
23%
5.87
A122N/G124S/A175S/ Q286R/M298Q
A[122]N/G[124]S/ A39S/Q143R/M156Q
1954.2
450.7
23%
4.96
T128N/P129A/A175S/ S222A/H257A/Q286R/ M298Q
T[128]N/P[129]A/
A39S/S82A/H117A/
Q143R/M156Q
3212.9
1140.7
36%
8.16
A122N/G124S/A175S/ S222A/H257A/Q286R/ M298Q
A[122]N/G[124]S/
A39S/S82A/H117A/
Q143R/M156Q
2972.8
751.2
25%
7.55
T128N/P129A/A175S/ Q286R/M298Q/H373F
T[128]N/P[129]A/
A39S/Q143R7M156Q/
H224F
1132.4
441.3
39%
2.88
A122N/G124S/A175S/ Q286R/M298Q/H373F
A[122]N/G[124]S/
A39S/Q143R/M156Q/
H224F
1000.1
184.3
18%
2.54
V158D/Q286R/E296V/
V21D/Q143R/E154V/
62.1
10.5
17%
0.16
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Ko.5
(нМ)
Стандартное
отклонение
Коэффициент вариации,%
Ко,5 мутанта/ Ко,5 дикого
M298Q/H373F
M156Q/H224F
M298Q/Q366N/H373F
VI156Q/Q217N/H224
90.8
4.8
0.18
T239V/M298Q/H373F
T99V/M156Q/H224F
46.6
7.9
17%
0.09
T239I/M298Q/H373F f
T99I/M156Q/H224F
178.7
29.7
17%
0.36
T128N/P129A/Q286R/ M298Q/Q366N/H373F
T[128]N/P[129]A/
Q143R/M156Q/
Q217N/H224F
148.3
12.9
0.29
T239V/Q286R/M298Q/ Q366N f
Q143R/M156Q/ Q217N/T99V
252.2
40.9
16%
0.50
T239I/Q286R/M298Q/ Q366N f
T99I/Q143R/M156Q/ Q217N
813.2
105.1
13%
1.62
f полученные в клетках СНОХ
§ полученные в стабильном клоне 52-5F7 клеточной линии СНОХ Пример 6. In vivo оценка прокоагулянтной активности полипептида FVIIa.
Для оценки прокоагулянтной активности полипептидов FVIIa была создана мышиная модель гемофилии. Гемофилию вызывали у CD-I мышей внутрибрюшинным введением анти-FVIII антител, после этого для начала кровотечения хирургически удаляли кончики хвостов. Также были использованы мыши с дефицитом фактора VIII (FVIII- мыши), но их не обрабатывали анти-FVIII антителами. Затем мышей обрабатывали полипептидом FVIIa и для определения прокоагулянтной активности полипептидов FVIIa измеряли количество потерянной за 20 мин крови.
A. In vivo оценка прокоагулянтной активности FVIIa дикого типа.
Мышиная модель гемофилии была создана с целью оценки прокоагулянтной активности полипептидов FVIIa. Гемофилию вызывали у CD-I мышей введением анти-FVIII антител, после этого для начала кровотечения хирургически удаляли кончики хвостов. Мышей обрабатывали полипептидом FVIIa и для определения прокоагулянтной активности полипептидов FVIIa измеряли необходимое для остановки кровотечения время и количество потерянной за это время крови.
Самцов CD-I мышей наркотизировали путем внутрибрюшинного введения тиобарбитала натрия в дозе 100 мг/кг и кетамина в дозе 100 мг/кг. Лидокаин вводили подкожно в вентральную часть шеи для уменьшения чувствительности. Трахею и сонную артерию канюлировали через небольшой разрез кожи в
области шеи для облегчения дыхания и неограниченного введения антител к фактору VIII, рекомбинант-ного человеческого фактора VIIa (rhFVIIa) и/или модифицированных полипептидов FVII.
Канюлированным мышам вводили 3,76 мг овечьих антител против человеческого FVIII (Affinity Biologicals, lot IG129R4, 612 единиц связывания для мыши/мл) в объеме 40 мкл. Эта доза была определена путем проведения подготовительного эксперимента для определения ответа на дозу антитела (с использованием 0,376, 0,94, 1,88 и 3,76 мг антител против человеческого FVIII) с оценкой кровопотери и времени кровотечения. Через 20 мин хвосты мышей помещали в 15 мл пробирки, содержащие фосфатный буферный раствор (PBS) при 39°С, на 10 мин. Через 30 мин хвосты быстро удаляли из раствора PBS и последние 5 мм хвоста отрезали для инициирования кровотечения. Было отмечено время, через которое началось кровотечение. Затем хвосты помещали в пробирку, содержащую PBS при 39°С, и наблюдали кровотечение в течение 5 мин (предварительное кровотечение), чтобы убедиться, что мыши ответили на антитела к FVIII. После предварительного кровотечения мышам вводили полипептиды FVIIa или носитель, в котором полипептиды FVIIa были растворены и введены. Полипептиды FVIIa разводили в PBS буфере или буфере, состоящем из 52 мМ хлористого натрия, 10,2 мМ безводного хлорида кальция, 9,84 мМ глицилглицина, 0,01% полисорбата 80 и 165 мМ маннита. Препараты FVIIa вводили в дозах 1, 3 или 10 мг/кг в объеме, эквивалентном 3 мл/кг, через канюлированную сонную артерию, хвосты помещали в пробирки, содержащие свежий PBS при 39°С. Кровотечение наблюдали в течение 20 мин и отмечали время, за которое кровотечение прекращалось. Общее время кровотечения рассчитывали как сумму длительности предварительного кровотечения и длительности кровотечения после введения полипептидов FVIIa, PBS или буфера.
Для определения количества потерянной во время кровотечений крови, содержимое 15 мл пробирок анализировали на содержание гемоглобина. Тритон Х-100 разбавляли 1/4 в стерильной воде и 100 мкл полученного раствора добавляли к 1 мл образца для гемолиза. Поглощение образцов измеряли при длине волны 546 нм. Для вычисления количества потерянной крови поглощение сравнивали со стандартной кривой, полученной измерением поглощения при 546 нм известных объемов мышиной крови, разбавленных PBS и подвергнутых гемолизу с помощью Triton X 100, как описано выше.
Эксперимент проводили для сравнения rhFVIIa, полученных, как описано выше, с коммерчески доступным рекомбинантным человеческим FVIIa (Novoseven(r), Ново-Нордиск), потерю крови оценивали после введения 3 мг/кг каждого белка. Потеря крови в группе, которой вводили только носитель (буфер, N=15), составила 671,9±57,89 мкл за 20 мин. Эта величина была уменьшена введением rhFVIIa от Catalyst Biosciences до 264,1±56,59 мкл и до с 273,7±53,93 мкл при введении Novoseven(r) (N=14). Этот эксперимент показал эквивалентность этих двух белков.
В. Анализ коагулянтной активности вариантов FVIIa у CD-I мышей с индуцированной гемофилией.
В подготовительном эксперименте были определены дозы и время, необходимые для получения гемофилии у CD-I мышей при внутрибрюшинном введении антител против человеческого фактора VIII, и продолжительность такого эффекта. Для первой партии антител против фактора VIII (партия 1; Affinity Biologicals, lot IG129R4) при определении доз изначально исходили из доз, использованных в экспериментах с канюлированием, описанных выше. Доза, вызывающая гемофилическое состояние (неконтролируемое кровотечение в течение 20-минутного периода анализа), составляла 7,54 мг/мышь (80 мкл 94,25 мг/мл исходного раствора). Данная партия антител обладала нейтрализующей активностью 612 единиц связывания для мыши/мл. Для второй партии антител против человеческого FVIII (партия 2; Affinity Biologicals, lot IG1577R2, нейтрализующая активность 474 единиц связывания для мышьи/мл) использовали дозу 11,98 мг/мышь (120 мкл 99,8 мг/мл исходного раствора), которую вводили за 6 ч до обрезания хвоста.
Для индуцирования гемофилии самцам мышей CD-I (массой 25-35 г) до эксперимента внутрибрю-шинно вводили антитела против фактора VIII из партии 1 или партии 2. Самцов CD-I и FVIII- мышей наркотизировали путем внутрибрюшинного введения смеси кетамин/ксилазин (45 мг/мл и 3,6 мг/мл, соответственно, в физиологическом растворе) и размещали на платформе с подогревом (39°С) для уверенности в отсутствии падения температуры тела. Температура в процедурной составляла 82°F (27,8°C). За 10 мин до отрезания хвоста его погрузили на 10 мин в предварительно подогретый PBS (15 мл пробирка для центрифугирования; 39°С). 8-10 мышам через хвостовую вену одной инъекцией вводили рекомби-нантный человеческий FVIIa (Novoseven(r), Ново Нордиск) или модифицированные полипептиды FVII, разведенные в буфере, состоящем из 52 мМ хлористого натрия, 10,2 мМ безводного хлорида кальция, 9,84 мМ глицилглицина, 0,01% полисорбата 80 и 165 мМ маннита. В качестве контроля группе мышей вводили только носитель. Если инъекция была пропущена, животное исключали из исследования. Инъекции полипептида FVIIa или носителя были осуществлены за 5 мин до обрезания хвоста. Хвост обрезали лезвием бритвы за 5 мм от конца хвоста, кровь собирали в PBS в течение 20 мин. После сбора крови оценивали полную потерю крови. Содержимое пробирок, в которые собирали кровь, смешали, аликвоты 1 мл каждого образца отобрали и анализировали на содержание гемоглобина. Тритон Х-100 разбавляли 1/4 в стерильной воде и 100 мкл полученного раствора добавляли к 1 мл образца для гемолиза. Поглощение образцов измеряли при длине волны 546 нм. Для вычисления количества потерянной крови погло
щение сравнивали со стандартной кривой, полученной измерением поглощения при 546 нм известных объемов мышиной крови, разбавленных PBS и подвергнутых гемолизу с помощью Triton X 100, как описано выше.
1. Исследование зависимости ответа от дозы для оценки коагулянтной активности FVIIa дикого типа. Было проведено исследование зависимости ответа от дозы при 0,3, 1 или 3 мг/кг FVIIa дикого типа.
Мыши, которые получили только носитель, потеряли 1002,3±60,71 мкл крови за 20 мин анализа. Крово-потеря у мышей, которым вводили 3 мг/кг FVIIa дикого типа, была существенно меньше и составляла 415,5±90,85 мкл (р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 мг/кг привело к потере крови 679,57±83,95 мкл, и кровопотеря при более низкой дозе 0,3 мг/кг составила 852,42±94,46 мкл.
2. Начальный анализ коагулянтной активности вариантов FVIIa.
В качестве контроля вводили только носитель. Мыши, которые получили только носитель, потеряли 915,2±105,6 мкл за 20 мин анализа, кровопотеря уменьшилась до 352±99,86 мкл (среднее ± стандартное отклонение среднего) при введении мышам рекомбинантного человеческого FVIIa. Количество потерянной крови уменьшалось еще сильнее до 165,8±48,41 мкл при введении мышам Q286R-FVIIa (т.е. FVIIa, содержащего мутацию Q286R), до 141,3±43,77 мкл при введении Q286R/M298Q-FVIIa или до 129,5±36,64 мкл при введении V158D/E296V/M298Q-FVIIa. При введении мышам S222A-FVIIa потеря крови также уменьшилась (до 225,7±62,75 мкл) по сравнению с введением FVIIa дикого типа. Введение (замена Gla из FIX)-FVIIa, Q366V-FVIIa или A122N/G124S- FVIIa привело к примерно такой же кровопо-тере, как и при введении мышам рекомбинантного человеческого FVIIa (334,6±54,95 мкл, 321,7±102,6 мкл и 329,8±83,91 мкл соответственно), в то время как кровопотеря у мышей, которым вводили H257A-FVIIa, S222A/Q286R-FVIIa, H257A-FVIIa была несколько большей (390±107 мкл, 447,3±127,7 мкл и 443,7±139,5 мкл соответственно).
3. Исследование зависимости ответа от доз для оценки коагулянтной активности варианта FVIIa. Для исследования зависимости ответа от доз мышам вводили 0,1, 0,3, 1 или 3 мг/кг Q286R-FVIIa,
S222-FVIIa, Q286R/M298Q-FVIIa или V158D/E296V/M298Q-FVIIa. Мыши, которые получили только носитель, потеряли 915,2±105,6 мкл крови за 20 мин анализа. Кровопотеря значительно уменьшилась у мышей, которым вводили 3 мг/кг любого из Q286R-FVIIa (141,3±43,77 мкл), S222-FVIIa (225,7±62,75 мкл) или Q286R/M298Q-FVIIa (129,5±36,64 мкл) (р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 мг/кг привело к потере крови 641±96,48 мкл у мышей, которые получили Q286R-FVIIa, и 487,92±92,07 мкл у мышей, которые получили S222A-FVIIa. Более низкие дозы указанных вариантов FVIIa привели приблизительно к такой же потере крови (817,71±107,94 мкл и 900,34±115,77 мкл для Q286R-FVIIa и S222-FVIIa соответственно), как у мышей, которым вводили носитель. Напротив, у мышей, получивших 1 мг/кг Q286R/M298Q-FVIIa, произошло достоверное снижение потери крови (69,36±15,55 мкл) по сравнению с контрольной группой мышей, которым ввели только носитель. При более низких дозах, 0,3 и 0,1 мг/кг, потеря крови составила 538,3±94,04 и 664±121,6 мкл соответственно. У мышей, получавших 0,3, 1 и 3 мг/кг V158D/E296V/M298Q-FVIIa, кровопотеря составила 754,49±121,6, 481,95±114,22 и 133,25±50,09 мкл соответственно.
Для Q286R-FVIIa, Q286R/M298Q-FVIIa и V158D/E296V/M298Q-FVIIa были проведены дополнительные исследования зависимости ответа от дозы и полученные данные были совмещены с приведенными выше. В экспериментах для оценки эффекта Q286R-FVIIa получавшая носитель группа потеряла 833,61±73,95 мкл крови. Кровопотеря значительно уменьшилась до 196,71±49,18 мкл у мышей, которые получали 3 мг/кг Q286R-FVIIa. Уменьшение дозы до 1 мг/кг приводило к потере крови 577,78±66,29 мкл. При введении мышам 0,1 и 0,3 мг/кг Q286R-FVIIa потеря крови была аналогична потере крови при введении носителя (739,58±104,28 и 806,63±65,17 мкл соответственно).
В экспериментах для оценки эффекта Q286R/M298Q- FVIIa получавшая носитель группа потеряла 902,42±88,04 мкл крови, кровопотеря значительно уменьшилась до 145,17±38,89 и 140,76±33,36 мкл при введении 1 и 3 мг/кг Q286R/M298Q-FVIIa. Уменьшение дозы до 0,1 и 0,3 мг/кг привело к потере крови 664,03±121,62 и 551,94±67,60 мкл соответственно.
В экспериментах для оценки эффекта V158D/E296V/M298Q-FVIIa получавшая носитель группа потеряла 966,64±57,97 мкл крови, кровопотеря значительно уменьшилась до 128,19±27,73 мкл при введении V158D/E296V/M298Q-FVIIa в дозе 3 мг/кг. Уменьшение дозы до 1 мг/кг привело к кровопотере 565,50±65,78 мкл, а при дальнейшем уменьшении дозы до 0,3 и 0,1 мг/кг потеря крови была аналогична потере крови при введении носителя (811,16±71,87 и 893,62±106,73 мкл).
Был проведен статистический анализ Крускала-Уоллиса, а затем тест Данна, значение считали достоверным при р <0,05.
4. Коагулянтная активность H216A-FVIIa, H373F-FVIIa, Q366D-FVIIa и Q366N-FVIIa в дозе 3 мг/кг. Была проведена серия экспериментов для исследования H216A-FVIIa, H373F-FVIIa, Q366D-FVIIa и
Q366N-FVIIa в дозе 3 мг/кг. В качестве контроля мышам вводили только носитель. Мыши, которые получили носитель, потеряли 915,2±105,6 мкл крови за 20 мин анализа. Кровопотеря значительно уменьшилась до 211,1±67,70 мкл при введении мышам H373F-FVIIa. Потеря крови меньше изменилась при введении H216A-FVIIa, Q366D-FVIIa и Q366N-FVIIa и составила 558,6±66,22, 577,1±151,4 и 477,1±112,6
мкл соответственно.
4. Коагулянтная активность Q286R/M298Q/замена Gla из FIX-FVIIa, S222A/H257A/Q286R/M158Q-
FVIIa, Q286R/M298Q/K341D-FVIIa и Q286R/M298Q/H373F-FVIIa в дозе 3 мг/кг.
Коагулянтную активность Q286R/M298Q/замена Gla из FIX-FVIIa, S222A/H257A/Q286R/M158Q-FVIIa, Q286R/M298Q/K34 ID-FVIIa и Q286R/M298Q/H373F-FVIIa в дозе 3 мг/кг оценивали на модели гемофилии на CD-I мышах. В качестве контроля мышам вводили только носитель. Мыши, которые получали носитель, потеряли 803±92,18 мкл крови за 20 мин анализа. Кровопотеря значительно уменьшилась до 118,6±63,27 мкл при введении S222A/H257A/Q286R/M158Q-FVIIa. Обработка Q286R/M298Q/ замена из Gla FIX-FVIIa в дозе 3 мг/кг привела к уменьшению потери крови по сравнению с группой, в которой вводили носитель, с 888,89±104,76 до 171,83±62,06 мкл.
При экспериментальной оценке Q286R/M298Q/K341D-FVIIa и Q286R/M298Q/H373F-FVIIa потеря крови в группе с носителем составила 813,1±82,66 мкл. Кровопотеря уменьшилась до 39,42±5,53 мкл после введения Q286R/M298Q/H373F-FVIIa. Q286R/M298Q/K341D-FVIIa при анализе оказался менее эффективным, потеря крови составила 636,7±121,6 мкл.
5. Исследование зависимости ответа от дозы для оценки коагулянтной активности
S222A/H257A/Q286R/M158Q-FVIIa и Q286R/M298Q/H373F-FVHa.
Исследовали ответ на S222A/H257A/Q286R/M158Q-FVIIa в дозе 0,3, 0,5, 1 и 3 мг/кг. Мыши, которые получали носитель, потеряли 832,48±71,70 мкл крови за 20 мин анализа. Кровопотеря статистически значимо уменьшилась до 118,63±63,27 мкл при введении 3 мг/кг S222A/H257A/Q286R/M158Q-FVIIa, (р < 0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 и 0,5 мг/кг привело к значительному снижению потери крови (202,69±77,60 и 366,52±106,21 мкл), а более низкая доза 0,3 мг/кг привела к потере крови, сравнимой с уровнем для носителя (742,04±112 мкл).
Также в эксперименте оценивали ответ на Q286R/M298Q/H373F-FVIIa в дозе 0,1, 0,3, 1 и 3 мг/кг. Мыши, которые получали носитель, потеряли 813,15±82,66 мкл крови. Кровопотеря статистически значимо уменьшилась до 39,42±5,52 мкл при введении 3 мг/кг Q286R/M298Q/H373F-FVIIa (p <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 и 0,3 мг/кг привело к потере крови 208,10±105,12 и 508,9±155,8 мкл соответственно. Самая низкая исследованная доза 0,1 мг/кг привела к потере крови, сравнимой с уровнем для носителя (733,5±152,88 мкл).
С. Анализ коагулянта активности FVIIa у FVIII- мышей.
Для оценки коагулянтной активности полипептидов FVIIa также была использована мышиная модель гемофилии А с использованием мышей с дефицитом фактора VIII (FVIII- мышей), в анализе использовали те же протоколы, как описано выше, за тем исключением, что мышам не вводили анти-FVIII антитела.
1. Исследование зависимости ответа от дозы для оценки коагулянтной активности FVIIa дикого типа.
На FVIII- мышах был выполнен анализ зависимости ответа от дозы для оценки коагулянтной активности Novoseven(r) и rhFVIIa дикого типа в дозе 0,3, 1, 3 и 6 мг/кг. В эксперименте с Novoseven(r) потеря крови в группе с носителем составила 912,79±38,32 мкл, при введении Novoseven(r) в дозе 6 и 3 мг/кг кровопотеря статистически значимо уменьшилась до 361,74±55,28 и 586,98±60,56 мкл соответственно (р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 мг/кг привело к потере крови 674,84±46,88 мкл, при самой низкой исследованной дозе потеря крови составила 801,08±41,39 мкл.
В эксперименте с rhFVIIa дикого типа потеря крови в группе с носителем составила 904,08±15,38 мкл. Кровопотеря статистически значимо уменьшилась до 451,04±74,17 мкл (р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна) при введении rhFVIIa дикого типа в дозе 6 мг/кг. Уменьшение дозы до 3 мг/кг привело к значению кровопотери 695,75±60,50 мкл, при дальнейшем снижении дозы до 1 и 0,3 мг/кг потеря крови была сравнима с потерей крови при введении носителя (846,08±34,17 и 936,43±31,39 мкл соответственно).
2. Исследование зависимости ответа от дозы для определения коагулянтной активности Q143R-FVIIa, S222A-FVIIa, Q286R/M298Q-FVIIa и V158D/E296V/M298Q-FVIIa.
В первой серии экспериментов исследовали рекомбинантный человеческий FVIIa (Novoseven(r),
Ново Нордиск), V158D/E296V/M298Q-FVIIa, Q286R-FVIIa и S222A-FVIIa в дозе 3 мг/кг. В качестве контроля мышам вводили только носитель. У мышей, получавших только носитель, кровопотеря составила 942,9±27,37 мкл за 20 мин анализа. Введение Novoseven(r) FVII, V158D/E296V/M298Q-FVIIa, Q143R-FVIIa и S222A-FVIIa привело к уменьшению потери крови до 468±55,9, 302,38±73,12, 697,26±92,22 и 675,07±35,29 мкл соответственно. При исследовании Q143R-FVIIa на FVIII- мышах в дозе 3 мг/кг снижение потери крови составило 754,84±60,96 мкл по сравнению с контрольной группой, в которой вводили только носитель (935,54±51,96 мкл). В дозе 5 мг/кг Q143R-FVIIa приводит к дальнейшему уменьшению потери крови до 445,87±79,62 мкл по сравнению с группой, в которой вводили носитель (960,42±24,5 мкл).
Во второй серии экспериментов исследовали зависимость ответа от дозы для V158D/E296V/M298Q-FVIIa и Q286R/M298Q-FVIIa в дозе 0,3, 1 и 3 мг/кг. Введение V158D/E296V/M298Q-FVIIa в дозе 3 мг/кг
привело к статистически значимому снижению потери крови (375,62±74,22 мкл) по сравнению с введением носителя (960,42±24,5 мкл, р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Уменьшение дозы до 1 и 0,3 мг/кг привело к потере крови, близкой к контрольному уровню, 834,76±54,38 и 841,62±68,99 мкл соответственно. Во втором эксперименте оценивали различные партии V158D/E296V/M298Q-FVIIa, потеря крови при введении носителя составила 912,79±38,32 мкл, кровопотеря статистически значимо уменьшалась при введении 3 и 1 мг/кг (247,24±35,17 и 628,30±37,36 мкл, р <0,05 с использованием критерия Крускала-Уоллиса и затем теста Данна). Введение низкой дозы V158D/E296V/M298Q-FVIIa приводит к потере крови, близкой контрольным значениям (841,85±19,32 мкл). В эксперименте для оценки влияния Q286R/M298Q-FVIIa на FVIII- мышах, кровопотеря в группе, в которой вводили носитель, составила 941,39±35,18 мкл. Кровопотеря значительно уменьшалась при введении 3 мг/кг до 258,92±59,82 мкл. При более низких дозах 1 и 0,3 мг/кг уровни потери крови составили 616,82±78.43мкл и 924,9±38,01 мкл соответственно.
D. Анализ коагулянтной активности дополнительных вариантов FVIIa с использованием моделей индуцированной гемофилии.
Коагулянтную активность нескольких вариантов FVIIa оценивали с помощью модели индуцированной гемофилии (IHM) на CD-I мышах, описанной в примере 6.В выше. При исследовании использовали тот же протокол, как описано выше, за тем исключением, что для оценки варианта T128N/P129A-FVIIa и варианта M156Q/H224F-FVIIa использовали различные партии антител против человеческого FVIII (третья и четвертая партии соответственно). Для третьей партии антител против человеческого FVIII (партия 3; Affinity Biologicals, lot IG1 603R1, нейтрализующая активность 418 единиц связывания для мыши/мл) использовали дозу 12,17 мг/мышь (120 мкл 101,4 мг/мл исходного раствора), которую вводили за 18 ч до обрезания хвоста. Для четвертой партии антител против человеческого FVIII (партия 4; Affinity Biologicals, lot IG 1639R1, нейтрализующая активность 875 единиц связывания для мыши/мл) использовали дозу 8,04 мг/мышь (80 мкл 100,45 мг/мл исходного раствора). Потерю крови измеряли, как описано выше, полученные данные представлены в табл. 19 ниже как процент ингибирования (рассчитывали среднее значение для интересующего варианта и делили на значение для группы, в которой вводили носитель) и значение ED50 (полуэффективная доза) (определяли с помощью нелинейного регрессионного анализа с использованием GraphPad Prism(r), GraphPad Software, Inc.), максимум и минимум кривой ответа ограничены потерей крови в группе с введением носителя и потерей крови у нормальных контрольных животных, соответственно.
Таблица 19
индуцированной гемофилии.
Коагулянтную активность нескольких вариантов FVIIa оценивали с помощью модели индуцированной гемофилии (IHM) на CD-I мышах, описанной в примере 6.В выше. При исследовании использовали тот же протокол, как описано выше, за тем исключением, что были использованы партии 4-6 анти-FVIII антител. Партия 4 описана выше, для пятой партии (Лот 5; Affinity Biologicals, lot IG1593R2, нейтрализующая активность 255 единиц связывания для мыши/мл) использовали дозу 12,25 мг/мышь (120 мкл из 102,1 мг/мл исходного раствора), которую вводили за 6 ч до отрезания хвоста. Для шестой партии (партия 6; Affinity Biologicals, lot IG1703R2, нейтрализующая активность 685 единиц связывания для мыши/мл) использовали дозу 8,02 мг/мышь (80 мкл 100,2 мг/мл исходного раствора), которую вводили в 4 ч дня в день, предшествующий дню эксперимента. Потерю крови измеряли, как описано выше, результаты представлены ниже в табл. 20 как процент ингибирования (рассчитывали среднее значение для интересующего варианта и делили на значение для группы, в которой вводили носитель) и значение ED50 (определяли с помощью нелинейного регрессионного анализа с использованием GraphPad Prism(r), GraphPad Software, Inc.), максимум и минимум кривой ответа ограничены потерей крови в группе с введением носителя и потерей крови у нормальных контрольных животных соответственно. "N/группу" относится к количеству мышей в группе, в то время как "N" в отношении расчета ED50 относится к количеству экспериментов, выполненных с вариантом.
Таблица 20
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Потеря крови в
модели индуцирован-ной гемофилии; % ингибирования при каждой дозе
N / группу
Потеря крови в модели индуцирован ной гемофилии; ED50 (мг/кг)
Доза (мг/кг)
0.1
0.3
H257A/Q286R
H117A/Q143R
7-10
M298Q
M156Q
7-10
0.11
M298Q/T128N/ Р129А
M156Q/T[128]N/ Р[129]А
7-9
0.1
Q286R/T128N/ PI 29 А
Q143R/T[128]N/ Р[129]А
6-8
0.27
Замена Gla из FIX/
T128N/P129A
/S222A/Q286R
Замена Gla из FIX/
T[128]N/P[129]A
/S82A/Q143R
6-8
0.27
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Потеря крови в
модели индуцирован-ной гемофилии; % ингибирования при каждой дозе
N / группу
Потеря крови в модели индуцирован ной гемофилии; ED50 (мг/кг)
Доза (мг/кг)
0.1
0.3
Q286R/M298Q
Q143R/M156Q
9-10
0.15
Q286R/M298Q
Q143R/M156Q
8-10
0.13
Q286R/M298Q
Q143R/M156Q
8-9
0.14
Q286R/M298Q
Q143R/M156Q
0.09
Замена Gla из FIX /Q286R/M298Q
Замена Gla из FIX /Q143R/M156Q
35,
7-10
0.14
T128N/P129A/Q286 R/M298Q
T[128]N/P[129]A/ Q143R/M156Q
47,
9-14
0.1
Замена Gla из FIX
/T128N/P129A
/Q286R/M298Q
Замена Gla из FIX /T[128]N/P[129]A /Q143R/M156Q
7-9
0.17
{Замена Gla из FIX
/K43I}/Q286R/
M298Q
{Замена Gla из FIX
/K[43]I}/Q143R/
M156Q
7-9
0.08
Замена Gla из FIX /
S52A/S60A/
Q286R/M298Q/
Замена Gla из FIX /
S[52]A/S[60]A/
Q143R/M156Q/
88 t
9-10
0.11
{Замена Gla из FIX /K43I}/T128N/P129 А/ Q286R/M298Q
{Замена Gla из FIX /K[43]I}/T[128]N/ P[129]A/Q143R/ M156Q
0.17
S222A/H257A/Q286
R/M298Q/
T128N/P129A
S82A/H117A/Q143R/ M156Q/
T[128]N/P[129]A
7-8
0.15
Q286R/M298Q/ Q366N
Q143R/M156Q/ Q217N
7-8
только носитель
п=17
0.1
T128N/P129A/ Q286R/M298Q/ Q366N
T[128]N/P[129]A/
Q143R/M156Q/
Q217N
6-8
0.09
{Замена Gla из FIX /K43I}/T128N/P129 А/ Q286R/M298Q/ Q366N/
{Замена Gla из FIX /K[43]I}/ T[128]N/ P[129]A/Q143R/ M156Q /Q217N
8-10
0.1
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Потеря крови в
модели индуцирован-ной гемофилии; % ингибирования при каждой дозе
N/ группу
Потеря крови в модели индуцирован ной гемофилии; ED50 (мг/кг)
Доза (мг/кг)
0.1
0.3
T128N/P129A/Q286 R/H373F
T[128]N/P[129]A/Q1 43R/H224F
7-9
T128N/P129A/Q286 R/M298Q/ H373F
T[128]N/P[129]A /Q143R/M156Q/ H224F
6-13
0.12
M298Q/H373F
M156Q/H224F
7-8
0.21
T128N/P129A/ M298Q/H373F
T[128]N/P[129]A/ M156Q/ H224F
85f
8-10
0.09
V158D/E296V/ M298Q/Q286R
V21D/E154V/M156Q /Q143R
27,
7-8
0.16
Замена Gla из FIX
/S222A/Q286R/
T239V
Замена Gla из FIX /S82A/Q143R/T99V
30,
8-9
0.36
Q286R/M298Q/ T239V
Q143R/M156Q/T99V
0.16
Замена Gla из FIX
/Q286R/M298Q/
T239V
Замена Gla из FIX
/Q143R/M156Q/
T99V
7-9
0.17
T128N/P129A/ T239V/Q286R/ M298Q
T[128]N/P[129] A/T99V/Q143R/ M156Q/
0.15
S222A/T239V/H257 A /Q286R/M298Q
S82A/T99V/H117A/ Q143R/M156Q/
7-8
0.12
T128N/P129A/S222
A/T239V/H257A/
Q286R/M298Q
T[128]N/P[129]A/S82
A/T99V/H117A/
Q143R/M156Q
7-9
0.09
T128N/P129A/ T239V/Q286R/ M298Q/H373F
T[128]N/P[129]A/
T99V/Q143R/M156Q/
H224F
8-10
0.08
V158D/T239I /E296V/M298Q
V21D/T99I /E154V/M156Q
7-9
0.11
T128N/P129A/ T239I/Q286R/ M298Q
T[128]N/P[129]A/ T99I/Q143R/M156Q
8-10
0.18
V158D/T239V/
V21D/T99V/E154V/
8-9
0.19
Мутация (по нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Потеря крови в
модели индуцирован-ной гемофилии; % ингибирования при каждой дозе
N / группу
Потеря крови в модели индуцирован ной гемофилии; ED50 (мг/кг)
Доза (мг/кг)
0.1
0.3
E296V/M298Q
M156Q
T128N/P129A/T239I / Q286R/M298Q/ H373F/
T[128]N/P[129]A/
T99I/Q143R/M156Q/
H224F
8-10
0.11
M298Q/Q366N/ H373F
M156Q/Q217N/H224 F
8-10
0.11
T239V/M298Q/ H373F
T99V/M156Q/H224F
7-9
Только носитель П=16
0.07
T239I/M298Q/ H373F
T99I/M156Q/H224F
9-10
0.07
T128N/P129A/ Q286R/M298Q/ Q366N/H373F
T[128]N/P[129]A/
Q143R/M156Q/
Q217N/H224F
7-9
T239V/Q286R/ M298Q/Q366N
T99V/Q143R/M156Q/ Q217N
7-9
0.08
T239I/Q286R /M298Q/Q366N
T99I/Q143R/M156Q/ Q217N
8-9
0.34
t доза 0,6 мг/кг
Пример 7. Определение кинетических параметров Михаэлиса-Ментен для амидолитической активности FVIIa для низкомолекулярного субстрата.
Амидолитическая активность вариантов FVII может быть оценена путем измерения кинетических параметров Михаэлиса-Ментен полипептида FVIIa для пептидного субстрата Spectrozyme FVIIa (CH3SO2-D-CHA-But-Arg-pNA.AcOH). Такой анализ может быть выполнен следующим образом. Для обеспечения оптимальной активности FVIIa в анализ может быть включен связанный с липидами очищенный человеческий тканевый фактор (Innovin, Dade Behring, VWR Cat # 68100-390). Комплекс ТФ-FVIIa расщепляет Spectrozyme FVIIa как весьма специфический хромогенный субстрат с высвобождени
ем паранитроанилинового хромофора (pNA), содержание которого можно определять, измеряя поглощение при 405 нм. Активность ферментов определяли, измеряя абсорбцию свободного pNA при 405 нм как функциию времени.
Реакцию осуществляли при трех различных концентрациях фермента. Для реакции варианты FVIIa сначала разбавляли до 40 нМ в 1 х прямом буфере для анализа (100 мМ Трис рН 8,4, 100 мМ NaCl, 5 мМ CaCl2, 0,01% БСА) в 1,7 мл пробирке (низкоадгезионные пробирки для центрифугирования от ISC Bioex-press). Затем FVIIa разбавляли в присутствии ТФ (Innovin, Dade Behring) до 2 нМ в 12-луночном полипропиленовом планшете (Axygen) следующим образом: смешивали 720 мкл 5 х прямого буфера (500 мМ Трис рН 8,4, 500 мМ NaCl, 25 мМ CaCl2, 0,05% БСА), 180 мкл 40 нМ FVIIa и 2700 мкл 2 х ТФ (6 нМ исходный раствор, восстановленный в 10 мл воды). Разбавленную протеазу инкубировали в течение 5 мин при комнатной температуре. Исходный 2 нМ раствор FVIIa далее последовательно разводили в 2 раза также в присутствии ТФ с получением 1 и 0,5 нМ растворов протеазы соответственно. Реакционную среду готовили следующим образом: сначала 1800 мкл 2 нМ исходного раствора FVIIa/ТФ разводили в 360 мкл 5 х прямого буфера, 900 мкл 2 х ТФ, и 540 мкл воды. Этот разбавленный раствор снова разбавляли 1:1 в 1800 мкл 1 х ТФ в прямом буфере.
В планшете приготовили разведения субстрата Spectrozyme FVIIa (American Diagnostica). Исходный раствор Spectrozyme FVIIa готовили восстановлением 50 мкмоль содержимого флакона в дистиллированной воде до 10 мМ и хранили при 4°С. 80 мкл (10 мМ Spectrozyme FVIIa) и 60 мкл 10 мМ Spectrozyme FVIIa + 20 мкл воды (7,5 мМ Spectrozyme FVIIa) добавляли в лунки в двух соседних столбцах 96-луночного полипропиленового планшета для анализа (Costar). Содержимое двух лунок последовательно разводили в 2 раза в каждой из 8 лунок соответствующего столбца, что привело к серии из 10х концентраций субстрата от 10 мМ до 78 мкМ субстрата сверху вниз в лунках в первом столбце и от 7,5 мМ до 58,6 мкМ субстрата сверху вниз в лунках во втором столбце. Пять мкл разведения субстрата Spectrozyme FVIIa добавляли в 96-луночный прозрачный планшет для анализа формата half area (Costar). 45 мкл каждого из трех разведений FVIIa/ТФ добавляли в три группы столбцов с последовательными разведениями субстрата. На этом этапе принимались меры, чтобы избежать введения пузырьков в лунки для анализа. Если пузырьки были введены, они могут быть удалены покалыванием чистой иглой перед началом каждого анализа. Содержимое планшетов затем перемешали встряхиванием. До начала анализа длину оптического пути в лунках для анализа измеряли с помощью планшетного спектрофотометра Spectramax Gemini M5 (Molecular Devices), при измерении в конечной точке и использовании функции Pathcheck из программного обеспечения SoftMax Pro (Molecular Devices). Увеличение абсорбции при 405 нм измеряли каждые 30 с в течение 1 ч при 37°С.
Программное обеспечение SoftMax Pro использовали для преобразования величин абсорбции (единиц оптической плотности/с) в концентрацию отщепленного pNA (мкМ/с) с помощью величины оптического пути и коэффициента молярной экстинкции уходящей группы pNA при 405 нм, 9600 М-1см-1. Уравнение для преобразования выглядит следующим образом: скорость х (1/60х1000)х(1/9600 х длина оптического пути) х 100000. На основании результатов для каждой концентрации протеазы строили график с использованием программного обеспечения Graph Pad Prism, откладывая концентрацию субстрата на оси X и измеренные скорости мкМ/с на оси Y. Величины KM и Ymax определяли с использованием программного обеспечения Graph Pad Prism 4, аппроксимируя данные уравнением Михаэлиса-Ментен следующим образом:
Y = (^^/1000000) х X х [Е])/(1 + (X + KM), где X представляет собой концентрацию субстрата, мкМ, Y представляет собой активность фермента, мкМ/с, kKA1KM представляет собой константу специфичности, М-1 с-1, KM представляет собой константу Михаэлиса, мкМ, Е представляет собой концентрацию фермента, мкМ.
Были установлены начальные значения Е = 1, KM = X при 0,5 х Ymax и kKAT KM = 1000.
Пример 8. Оценка активности взаимодействия между вариантами FVIIa и TFPI.
Активность взаимодействия между полипептидами FVIIa, такими как, например, предусмотренные в настоящем документе, и TFPI, может быть оценена с использованием одного или более анализов. В одном примере, активность взаимодействия между TFPI и FVIIa/ТФ комплексом оценивали путем измерения уровня ингибирования каталитической активности FVIIa/ТФ для субстрата, Spectrazyme VIIa, различными концентрациями TFPI. В другом примере может быть использован высокопроизводительный поверхностный плазмонный резонанс (SPR).
А. Определение IC50 для ингибирования FVIIa/ТФ TFPI.
Активность взаимодействия между TFPI и FVIIa/ТФ комплексом была оценена путем измерения уровня ингибирования каталитической активности FVIIa/ТФ для субстрата, Spectrazyme VIIa, различными концентрациями TFPI. Концентрацию TFPI, которая требуется для 50% ингибирования (IC50), рассчитывали для каждого варианта FVII и стандарта FVIIa.
В каждую лунку 96-луночного прозрачного планшета для анализа формата half area (Nunc) предва
рительно обрабатывали 150 мкл/лунку 1 х планшетным буфером (100 мМ Трис рН 8,4, 100 мМ NaCl, 0,01% БСА, 0,01% твин-20) и инкубировали планшеты при 37 С в течение как минимум 1 ч. Буфер полностью удаляли встряхиванием и промоканием планшета, для удаления оставшегося буфера планшеты центрифугировали вверх дном. Планшеты сушили на воздухе в течение 1 ч и хранили при комнатной температуре (RT). В 1,7 мл пробирке (низкоадгезионная пробирка от ISC Bioexpress) готовили смесь FVI-Ia/ТФ в общем объеме 450 мкл путем смешивания 9 мкл 250 нм FVIIa (American Diagnostica, FVIIa дикого типа или соответствующий вариант, предназначенный для исследования) с 337,5 мкл 2 х ТФ (Innovin; Dade Behring; лиофилизированный продукт суспендировали в 10 мл дистиллированной воды с получением 2 х ТФ, что примерно эквивалентно 7 нМ связанного с липидами ТФ), 90 мкл 5 х буфера (500 мМ Трис рН 8,4, 500 мМ NaCl, 25 мМ CaCl2, 0,05% БСА) и 13,5 мкл воды, в результате чего получили раствор, содержащий 5 нМ FVIIa и 5,2 нМ ТФ. Для образования компонентами комплекса смесь инкубировали при комнатной температуре в течение 5 мин. В каждую лунку 2 колонок в предварительно обработанного 96-луночного прозрачного планшета для анализа формата half area добавили 25 мкл соответствующей смеси FVIIa/рТФ, планшет закрыли для предотвращения испарения.
Рекомбинантный человеческий TFPI (R &D Systems) сначала растворили в 33 мкл 50% глицерина (об./об.) с получением 10 мкМ исходного раствора для хранения при -20°С. Исходный раствор TFPI далее разбавляли до 1,5 мкМ в окончательном 1 х буфере (100 мМ Трис рН 8,4, 100 мМ NaCl, 5 мМ CaCl2, 0,01% БСА) в полипропиленовом планшете для хранения следующим образом: для каждой исследуемой протеазы 87,5 мкл 1,5 мкМ раствора TFPI получали смешиванием 13,1 мкл 10 мкМ TFPI с 17,5 мкл 5 х буфера для анализа и 56,9 мкл дистиллированной воды. Были приготовлены последовательные 3-кратные разведения раствора TFPI в 1х буфере для анализа путем смешивания 27,5 мкл TFPI с 55 мкл 1х буфера для анализа, так что были получены растворы, содержащие 750, 250, 83,3, 27,8, 9,26, 3,1 и 1,03 нМ TFPI. Последняя лунка содержала только 1 х буфер в качестве контроля.
25 мкл каждого разведения TFPI добавляли в 2 лунки (т.е. в двух повторностях) в 2 колонки 96-луночного прозрачного планшета для анализа, содержащего FVIIa/ТФ смесь, так что смесь с протеазой исследовали в двух повторностях с каждым разбавлением TFPI. Раствор 1 х буфера без TFPI также добавили в 2 лунки, содержащие FVIIa/ТФ смесь, в качестве отрицательного контроля. Планшеты быстро перемешивали, а затем центрифугировали при 3000 об/мин в течение 5 мин и инкубировали при 37°С в течение 1,5 ч.
Исходный раствор Spectrazyme VIIa (American Diagnostica) приготовили восстановлением 50 мкмоль субстрата в 5 мл дистиллированной воды до 10 мМ и хранили при 4°С до использования. Непосредственно перед использованием раствор разбавляли до 600 мкМ в дистиллированной воде. После инкубации планшета анализа, описанного выше, в каждую лунку добавляли 10 мкл разбавленного Spec-trazyme VIIa. Реакционную смесь перемешали и планшеты инкубировали при 37°С. Увеличение абсорбции при 405 нм измеряли каждые 30 с в течение 1 ч при 37°С, скорость изменения поглощения рассчитывали с использованием программного обеспечения SoftMax Pro (Molecular Devices).
Для определения степени ингибирования TFPI скорости изменения абсорбции в протеазной реакции в присутствии TFPI сначала делили на скорость изменения абсорбции в реакции в отсутствие TFPI (контрольный образец) и получали относительную активность, также определяли log10 каждой концентрации TFPI. С использованием программного обеспечения GraphPad Prism log10[TFPI] откладывали против относительной активности каждой протеазы, таким образом была получена кривая доза-ответ, при аппроксимации прямой предполагали, что максимум и минимум значений активности фиксируются в 1 и 0 соответственно. Для определения ингибирования TFPI в виде log10C50 (pIC50) значения и абсолютного значения IC50 (ингибирование TFPI в нМ) для каждой протеазы, и определения его среднего значения и стандартного отклонения было использовано программное обеспечение.
Уровень ингибирования TFPI каждого из вариантов FVIIa в комплексе со связанном с липидами ТФ (Innovin; Dade Behring) был определен и выражен как увеличение устойчивости к TFPI в некоторое количество раз по сравнению с FVIIa дикого типа (табл. 21).
В. Исследование вариантов FVIIa на устойчивость к воздействию TFPI методом поверхностного плазмонного резонанса (SPR).
Относительную устойчивость различных вариантов FVIIa к ингибированию человеческим реком-бинантным растворимым TFPI оценивали с помощью высокоэффективного поверхностного плазмонного резонанса (SPR) на биосенсоре Biacore T100. Относительную устойчивость вариантов FVIIa к ингибированию TFPI оценивали путем измерения относительного количества варианта FVIIa, связанного с растворимым TFPI, иммобилизованным на сенсорном чипе СМ5 Biacore, по сравнению с количеством связанного FVIIa дикого типа при стандартизированном времени введения и концентрации протеазы.
Для каждого эксперимента растворимый TFPI (R &D Systems) иммобилизовали на новом сенсорном чипе 4-поточной ячейки Biacore CM5 Series S (GE Healthcare) с использованием протокола связывания аминогруппы, доступного в программном обеспечении для Biacore T-100 (GE Healthcare), и реагентов, содержащихся в комплекте для связывания аминогрупп Amine Coupling Kit (GE Healthcare). Все четыре доступных проточных ячейки использовали для иммобилизации двух различных плотностей TFPI и бычьего сывороточного альбумина (БСА), который служил блокирующим агентом в указанных ячейках. БСА разбавляли до 5 мкг/мл в ацетате натрия (рН 4,0) и иммобилизовали в проточной ячейке до 1 и 3 в 1000 и 2000 единиц ответа (RU) соответственно. Для иммобилизации TFPI лиофилизированный растворимый TFPI (10 мкг) ресуспендировали в 100 мкл 1х буфера для иммобилизации (30 мМ Hepes, 135 мм NaCl, 1 мМ ЭДТА, 0,01% Твин-20, рН 7,4) до концентрации 0,1 мг/мл. В общей сложности 20 мкл 0,1 мг/мл TFPI разбавляли до 10 мкг/мл в ацетате натрия рН 4,0 для иммобилизации в проточной ячейке до 2 и 4 в 1000 и 2000 RU соответственно. Буфер для иммобилизации использовали в качестве рабочего буфера во время иммобилизации. Каждый образец FVIIa готовили в конечной концентрации 320 нМ в IX рабочем буфере (20 мМ Hepes, 150 мМ NaCl, 5 мМ CaCb, 0,1% ПЭГ 8000, 0,1% БСА, 0,01% Твин-20, рН 7,4), содержащем 620 нМ рТФ (Human Coagulation Factor III, R & D Systems). Как правило, каждый вариант FVIIa разбавляли в 10 раз в 1 х рабочем буфере до окончательного разведения 320 нМ. Комплекс FVIIa/рТФ готовили в конечном объеме 120 мкл в двух повторностях, что позволяло внести в 96-луночный планшет для хранения и исследовать с повторяющимися введениями за один проход до 48 уникальных вариантов FVIIa. Комплексы FVIIa/рТФ инкубировали при комнатной температуре в течение 10-15 мин до первого введения образца.
С применением программного обеспечения Biacore Control Software (GE Healthcare) разработали стандартизированный анализ связывания, в котором каждую повторность FVIIa вводят на 180 с для ассоциации с последующими 60 с для диссоциации при скорости потока 10 мкл/мин. Регенерацию сенсорного чипа после фазы диссоциации проводили в течение 30 с 10 мМ глицином, 500 мМ NaCl, рН 3,0, после чего следовал 60-секундный период стабилизации при пропускании IX рабочего буфера при той же скорости потока 10 мкл/мин. При каждом пропускании раствора и последующем анализе данных записывали значения в двух точках, одно за 5 с до завершения фазы ассоциации (связывания), а второе за 5 с до завершения фазы диссоциации. До начала полного анализа сенсорный чип проверяли с помощью одного введения 320 нМ FVIIa/рТФ дикого типа на 180 с, которое должно дать ответ приблизительно 400450 RU и 750-850 RU в проточных ячейках 2 (1000 RU) и 4 (200 RU) соответственно.
Для проверки параметров анализа, включая проверку того, что связывание с указанной ячейкой является минимальным, проверку дрейфа базовой линии и связывания при контрольном введении (рабочего буфера), анализ данных проводили с помощью программного обеспечения Biacore T1OO Evaluation Software (GE Healthcare). Для этой цели были составлены таблицы с данными, в которых указывали количество связанного варианта FVIIa (в RU) точке связывания и точке диссоциации. Данные таблицы впоследствии экспортировали для дальнейшего анализа в таблицы Microsoft Excel. Необработанные данные (связывание в RU) корректировали с учетом связывания с сенсорным чипом в контроле, затем для каждого параметра было вычислено отношение количества связанного FVIIa дикого типа (в RU) к количеству связанного варианта FVIIa (в RU) и приведено как связывание (дикий тип/вариант) и диссоциация (дикий тип/вариант). В табл. 22 представлены результаты исследования. Устойчивость к ингибированию
TFPI отражается как увеличение отношения для одного или обоих оцениваемых параметров. Например, значение 20 для связывания (дикий тип/вариант) или диссоциации (дикий тип/вариант) для конкретного варианта FVIIa указывает, что вариант в 20 раза более устойчив к ингибированию TFPI по сравнению с FVIIa дикого типа. Несколько исследованных вариантов проявляли повышенную устойчивостью к инги-бированию TFPI. Например, варианты, содержащие мутацию K341D (по нумерации зрелого FVII), такие как Q286R/M298Q/K341D-FVIIa, Q286R/K341D-FVIIa и M298Q/K341D-FVIIa, обладали отношением, которое указывает на значительную устойчивость TFPI (большую в 40-150 раз). В некоторых случаях скорость диссоциации была изменена больше, чем скорость ассоциации. Пример 9. Фармакокинетический анализ полипептидов FVIIa.
Фармакокинетические свойства полипептидов FVIIa оценивали путем измерения количества человеческого фактора VIIa в мышиной плазме. Для количественной оценки FVIIa в плазме могут быть использованы два анализа. Для количественной оценки общего содержания FVIIa в плазме мыши может быть использован ИФА, а для количественной оценки коагулянтной активности полипептидов FVIIa в плазме может быть использован FVIIa-зависимый анализ свертывания (FVIIaAC).
A. Введение FVIIa полипептидов мышам.
В фармакокинетических исследованиях оценивали модифицированные полипептиды FVIIa и немо-дифицированный рекомбинантный человеческий FVIIa (rhFVIIa) (Novoseven(r), Ново Нордиск). Для каждого исследования 18 самцам CD-I мышей вводили внутривенно болюс (0,1-3,0 мг/кг в зависимости от исследования) с rFVIIa. Через 5, 15, 30, 60, 120 и 240 мин после инъекции трех мышей в каждой исследуемой группе умерщвляли удушением СО2, и в 1,0 мл шприц с помощью чрескожной сердечной пункции отбирали около 1,0 мл крови. В каждый шприц предварительно набирали достаточное количество цитрата натрия для достижения конечной концентрации 3,2% в 1 мл крови. Образцы крови затем центрифугировали при 9000 об/мин в течение 8 мин при 4°С. Плазму переливали в отдельные подписанные 1,5 мл пробирки (Эппендорф), быстро замораживали в жидком азоте и хранили при -80°С. Кроме того, в каждом эксперименте одной мыши вводили только носитель, плазму от такой мыши использовали для определения фоновой активности FVIIa.
B. ИФА.
Для обнаружения белка FVII в сыворотке крови методом ИФА использовали имеющийся в продаже комплект Imubind(r) Factor VII ELISA (American Diagnostica). В комплект включен планшет, предварительно покрытый анти-FVII/FVIIa антителами для связывания белка, и биотинилированные анти-FVII антитела для обнаружения меченой стрептавидином пероксидазой хрена. Комплект использовали в соответствии с инструкциями производителя со следующими исключениями: во-первых, диапазон стандартной кривой был сужен для уверенности в линейности зависимости во всем диапазоне концентраций и охватывал концентрации от 0,88 нг/мл до 10 нг/мл, во-вторых, для построения стандартной кривой использовали сам очищенный вариант FVIIa, а не стандартный FVII, поставляемый в наборе, из-за различий в аффинности к антителам. Эксперименты показали, что комплекс FVIIa с антитромбином III (ATIII), мощным ингибитором FVIIa в плазме, обнаруживается в 75% от уровня свободной протеазы, что гарантировало, что анализ может обнаружить общий FVIIa в образце плазмы в активный и неактивной форме. Образцы плазмы разморозили при комнатной температуре и разбавляли в 10 раз в буфере для образцов (PBS+0,1% Тритон Х-100+1,0% БСА), затем последовательно разбавляли в 5,5 раз с получением четырех разведений. Четыре разбавленных образца разбавляли в 2 раза в планшете для ИФА для окончательного разведения образца в 20, 110, 605 и 3327,5 раза. Эти четыре разведения мышиной плазмы покрывали диапазон концентраций протеазы от 33000 до 20 нг/мл. Каждый образец измеряли на двух отдельных планшетах для анализа, и измерения, попадающие в диапазон стандартной кривой, были использованы для расчета концентрации вариантов FVIIa в образце плазмы.
C. Анализ коагуляции.
Для анализа свертывания был использован коммерчески доступный комплект (STACLOT FVIIa-RTФ, Diagnostica Stago, Parsippany, штат Нью-Джерси). Для определения коагулянтной активности активных полипептидов FVIIa образцы плазмы анализировали с использованием FVIIa-зависимого анализа свертывания (FVIIaAC). Анализ проводили с использованием реактивов и инструкций, содержащихся в коммерческом комплекте, время свертывания крови измеряется с помощью электромеханического прибора обнаружения сгустка (STArt4, Diagnostica Stago, Parsippany, штат Нью-Джерси). Комплект использовали в соответствии с инструкциями производителя со следующими исключениями: во-первых, для построения стандартной кривой использовали сам очищенный вариант FVIIa, а не стандартный rhFVII, поставляемый в наборе, во-вторых, для рутинных фармакокинетических исследований использовали следующие коммерчески доступные реагенты, которые давали сопоставимые результаты: растворимый тканевый фактор (Calbiochem, La Jolla, Калифорния), смесь синтетических фосфолипидов (Avanti Polar Lipids, Alabaster, Алабама), буфер TBSA (Трис-NaCl, рН 7,5 с 1% БСА; DiaPharma, West Chester, штат Огайо) и 25 мкМ раствор хлорида кальция (Diagnostica Stago, Parsippany, штат Нью-Джерси).
Анализ коагуляции проводили следующим образом. Замороженные образцы плазмы размораживали при комнатной температуре в течение примерно 45 мин, а затем разводили 1:5000 в буфере. 50 мкл
разбавленной плазмы смешивали с 50 мкл фактор VII-дефицитной человеческой плазмы и 50 мкл связанного с липидами тканевого фактора и предварительно инкубировали в течение 180 с. После предварительной инкубации для инициации свертывания к смеси добавили 50 мкл раствора хлорида кальция (25 мкМ). Время свертывания крови определяли с помощью электромеханического обнаружения сгустка. Каждый образец плазмы исследовали в двух повторностях. Система была откалибрована с помощью построения стандартной кривой с использованием времени свертывания для последовательных разведений буфера, содержащих известное количество специфического варианта FVIIa, подвергающегося анализу. Концентрации FVIIa в образцах плазмы мыши рассчитывали по линейной части стандартной кривой зависимости logFVIIa от log времени свертывания. Способность образцов плазмы вызывать свертывание в фактор VII-дефицитной плазме определяли в нг FVIIa/мл плазмы мыши после вычитания фонового уровня эндогенного FVIIa дикого типа в плазме у мышей контрольной группы.
Период полураспада каждого белка FVII определяли обычной аппроксимацией натурального логарифма активности прямой линией и измерением времени, необходимого для уменьшения активности белка FVIIa на половину. Для белков FVII с мультиэкспоненциальным распадом период полураспада определяли по последней фазе профиля зависимости log концентрации в плазме против времени. Дополнительные фармакокинетические параметры рассчитывали следующим образом: плазменную AUC0-inf/ доза (рассчитывали как [AUC(0-t) + Ct/(ln2/T1/2)], где t представляет собой последний момент времени с измеримой концентрацией полипептида FVIIa в плазме, деленный на внутривенную дозу (мг/кг)); период полураспада (период полураспада полипептида FVIIa последней фазе профиля зависимости концентрации FVIIa в плазме от времени; Т1/2 рассчитывали как -ln2, деленный на отрицательный наклон последней фазы кривой log-линейной зависимости концентрации FVIIa в плазме от времени); MRT0-last (среднее время нахождения полипептида FVIIa в организме; рассчитывали как AUMC0-last/AUC0-last, где AUMC0-last представляет собой общую площадь под первым моментом кривой зависимости концентрации от времени (кривая зависимости концентрация FVIIa против времени), рассчитывали по правилу трапеций); Cl (системный клиренс; рассчитывали как доза/AUCo-bf) и Vd (объем распределения, на основе последней константы распада ф), рассчитывали как [Cl/(ln2/T1/2)]).
D. Фармакокинетические свойства вариантов FVIIa.
Фармакокинетические свойства FVIIa дикого типа и вариантов FVIIa оценивали на основе коагу-лянтной активности в плазме с использованием описанного выше протокола FVIIaAC. Результаты представлены в табл. 23. Несколько вариантов FVIIa проявляли улучшенные фармакокинетические параметры по сравнению с FVIIa дикого типа.
Фармакокинетические параметры вариантов FVIIa в мыши
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-last
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
NovoSeven(r) RT FVIIa
0.1
1165
0.9
NovoSeven(r) FVIIa
0.1
741
1.4
NovoSeven(r) FVIIa
1.0
1156
1.7
Дикий тип
0.1
686
1.8
Дикий тип
1.0
798
1.5
118
P257BCTaBKaGGG SCSFGRGDIRNV С
0.1
391
2.3
108
T128N/P129A
0.1
1392
0.8
S52A
0.1
594
1.6
118
K109N
0.1
951
1.1
A51N
0.1
270
3.7
174
S52A/S60A
0.05
460
2.2
S52A/S60A
0.1
408
2.5
M298Q
0.1
258
4.9
443
T128N/P129A/ M298Q
0.1
495
2.0
V158D/E296V/ M298Q
0.05
13.9
258
V158D/E296V/ M298Q
0.1
16(a), 45(a)
22.8
1465
V158D/E296V/ M298Q
1.0
26.6
979
V158D/E296V/ M298Q
3.0
7.7а
7.9
45.6
506
V158D/E296V/ M298Q
6.0
20.8
1305
T128N/P129A/ V158D/E296V/ M298Q
0.1
125
8.0
122
S52A/S60A/V158 D/E296V/M298Q
0.1
21.4
450
Q286R
0.1
181
5.5
439
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-last
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
Q286R
0.3
460
41.7
1.8
Q286R
1.0
1256
0.8
T128N/P129A/ Q286R
0.1
2443
0.4
S52A/S60A/ Q286R
0.1
1565
0.6
Замена Gla из FIX
0.1
207
4.9
140
K341D
0.1
2817
106
114
0.1
S222A
0.1
189
5.3
248
S222A
1.0
139
3.8
293
T128N/P129A/ S222A
0.1
422
28.4(a), 71(a)
2.4
244
S52A/S60A/S222 А
0.1
270
3.7
243
Н257А
0.1
595
1.7
H257S
0.1
1015
1.0
H257S
0.75
816
1.2
Q366V
0.1
51.6
1060
Замена Gla из FIX/Q366V
0.1
157
7.0
6.4
107
A122N/G124S/ E394N/P395A/ R396S
0.1
1089
0.9
G318N
1.0
568
1.8
242
A175S
0.1
2081
111
0.5
K109N/A175S
0.1
1280
183
0.8
207
S119N/L121S/ A175S
0.1
2460
102
0.4
T128N/P129A/ A175S
0.1
2770
0.4
A122N/G124S/ A175S
0.1
3240
0.3
A122N/G124S
0.1
679
52.9
1.1
H257A/Q286R
0.1
1848
56.8
0.5
S222A/Q286R
0.1
861
1.5
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo,ast
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
Замена Gla из
FIX/S222A/
Q286R
1.0
415
2.4
136
Замена Gla из FIX/T128N/ P129A/S222A/ Q286R
0.1
929
1.1
S222A/H257A/ Q286R
0.1
976
1.0
Q286R/M298Q
0.055
1198
0.8
Q286R/M298Q
0.1
605
1.9
Q286R/M298Q
1.0
363
2.8
116
Замена Gla из
FIX/Q286R/
M298Q
0.1
231
4.9
194
T128N/P129A/ Q286R/M298Q
0.1
1571
0.6
T[128]N/P[129]A/ Q286R/M298Q
0.1
1326
42.3
0.8
Замена Gla из FIX/T128N/ P129A/Q286R/ M298Q
0.1
427
2.3
101
{Замена Gla из
FIX/E[40]L}/
Q286R/M298Q
0.1
386
2.6
198
{Замена Gla из
FIX/K[43]I}/
Q286R/M298Q
0.1
439
2.3
280
{Замена Gla из
FIX/Q[44]S}/
Q286R/M298Q
0.1
291
3.4
150
{Замена Gla из FIX/M[19]K}/ Q286R/M298Q
0.1
648
14 (а), 75 (а)
1.5
S52A/S60A/ Q286R/M298Q
0.1
374
2.7
122
Замена Gla из
FIX/S52A/S60A/
Q286R/M298Q
0.1
256
3.9
107
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-last
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
{Замена Gla из FIX/K[43]I}/ T128N/P129A/ Q286R/M298Q
0.1
154
6.5
166
S222A/M298Q
0.1
13.9
332
S222A/H257A/ Q286R/M298Q
0.1
10.8
517
T128N/P129A/ S222A/H257A/ Q286R/M2986Q
0.1
770
1.3
S52A/S60A/
S222A/H257A/
Q28R/M2986Q
0.1
469
2.1
A175S/Q286R/ Q366V
0.1
353
28.9
2.8
118
Q286R/M298Q/ K341D
0.1
219
4.6
151
M298Q/K341D
0.1
2430
0.4
Q286R/M298Q/ Q366N
0.1
569
1.8
T128N/P129A/ Q286R/M298Q/ Q366N
0.1
1897
0.5
{Замена Gla из FIX К[43]1}/ Q286R/M298Q/ Q366N
0.1
257
10(a), 28(a)
3.9
163
{Замена Gla из FIX К[43]1}/ T128N/P129A/ Q286R/M298Q/ Q366N
0.1
393
2.5
T128N/P129A /Q286R/H373F
0.1
1467
0.9
Q286R/M298Q/ H373F
0.1
466
2.2
T128N/P129A/ Q286R/M298Q/ H373F
0.1
597
27(a), 67(a)
1.6
153
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-iast
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
T128N/P129A/ M298Q/H373F
0.1
307
7(d), 27(a)
3.3
126
V158D/Q286R/ E296V/M298Q
0.1
172
5.8
535
S222A/T239V
0.1
127
7.9
535
Замена Gla из
FIX/S222A
/T239V/Q286R
0.1
460
2.2
108
T239V/Q286R/ M298Q
0.1
398
28(а),71(а)
2.5
258
Замена Gla из
FIX7T239V/
Q286R/M298Q
0.1
365
13(а),56(а)
2.7
220
T128N/P129A/ T239V/Q286R/ M298Q
0.1
914
1.1
S222A/T239V/ H257A/Q286R/ M298Q
0.1
181
5.5
225
T128N/P129A/ S222A/T239V/ H257A/Q286R/ M298Q
0.1
564
1.8
T239V/Q286R/ H373F
0.1
385
2.6
269
T239V/Q286R/ M298Q/H373F
0.1
149
6.7
353
T128N/P129A/ T239V/Q286R/ M298Q/H373F
0.1
345
2.9
V158D/T239I/ E296V/M298Q
0.1
370
14(а),70(а)
2.7
273
T239I/Q286R
0.1
1820
0.6
S222A/T239I
0.1
1300
6(d), 81(a)
0.8
Замена Gla из FIX /S222A/ T239I/Q286R
0.1
1073
0.9
T239I/Q286R/ M298Q
0.1
1029
27(а),60(а)
1.0
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-last
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
Замена Gla из
FIX/T239I/
Q286R/M298Q
0.1
1269
0.8
T128N/P129A/ T239I/Q286R/ M298Q
0.1
2105
0.5
S222A/T239I/
H257A/Q286R/
M298Q
0.1
1212
31(a), 79(a)
0.8
101
T239I/Q286R7 H373F
0.1
1841
30(a), 85(a)
0.5
V158D/T239V/ E296V/ M296Q
0.1
184
24(a), 134(a)
5.4
1053
T239V/Q286R
0.1
1522
29(a), 72(a)
0.7
T239V/Q286R/ M298Q/H373F
0.1
950
1.1
T239V/Q286R/ M298Q/H373F
0.1
806
1.3
T239V/Q286R/ M298Q/H373F
0.1
663
1.5
T239V/Q286R/ M298Q/H373F
0.1
1350
0.7
S222A/H257S/ Q286R/M298Q
0.1
814
1.2
H257S/Q286R/ M298Q/H373F
0.1
297
3.4
163
S222A/Q286R/ M298Q/H373F
0.1
106
9.4
478
Замена Gla из FIX /S222A/ Q286R/M298Q/ H373F
0.1
104
9.1(a), 17(a)
9.7
242
S222A/Q286R/ M298Q
0.1
347
2.9
102
Замена Gla из FIX /S222A/ Q286R/M298Q
0.1
263
3.8
T128N/P129A/ A175S/Q366V
0.1
2196
52(a), 85(a)
0.5
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRTo-last
(мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
A122N/G124S/ A175S/Q366V
0.1
2148
0.5
T128N/P129A/ A175S/S222A
0.1
4248
122
0.2
A122N/G124S/ A175S/S222A
0.1
3316
102
0.3
T128N/P129A/ A175S/Q286R
0.1
6160
151
0.2
A122N/G124S/ A175S/Q286R
0.1
4097
139
0.2
Замена Gla из FIX /S222A/ Q286R/H373F
0.1
480
2.1
V258D/E296V/ M298Q/H373F
0.1
8.7(a), 20(a)
11.1
321
H257A/Q286R/ M298Q
0.1
1029
1.0
Замена Gla из FIX/T128N/ P129A/A175S/ S222A/Q286R
0.1
2787
38(a), 134(a)
0.4
Замена Gla из FIX/A122N/ G124S/A175S/ S222A/Q286R
0.1
3492
148
0.3
T128N/P129A/ A175S/Q286R/ M298Q
0.1
5120
171
0.2
A122N/G124S/ A175S/Q286R/ M298Q
0.1
3681
154
0.3
T128N/P129A/ A175S/S222A/ H257A/Q286R/ M298Q
0.1
3140
113
0.3
A122N/G124S/ A175S/S222A/ H257A/Q286R/ M298Q
0.1
2659
37.(4), 130(a)
0.4
Мутация (по нумерации зрелого FVII)
ВВ доза (мг/кг)
AUCo-inf (мкг*мин/ мл)/доза
Период полураспада (мин)
MRToust (мин)
Клиренс (мл/мин/ кг)
Объем распределения (мл/кг)
T128N/P129A/ A175S/Q286R/ M298Q/H373F
0.1
3580
118
0.3
A122N/G124S/ A175S/Q286R /M298Q/H373F
0.1
3148
105
0.3
V158D/Q286R/ E296V/M298Q/ H373F
0.1
124
8.1
237
M298Q/H373F/ Q366N
0.1
169
8.2
5.9
T239V/M298Q/ H373F
0.1
9.1
235
T239I/M298Q/ H373F
0.1
562
1.8
T128N/P129A/ Q286R/M298Q/ Q366N/H373F
0.1
607
1.6
T239V/Q286R/ M298Q/ Q366N
0.1
729
1.4
T239I/Q286R/ M298Q/Q366N
0.1
1548
0.6
а - период полураспада а-фазы, измерение полупериода распределения в - период полураспада в-фазы, измерение полупериода распада
В табл. 24 приведены результаты исследования с использованием следующих фармакокинетиче-ских параметров: % выхода препарата (in vivo) (измеренная концентрация FVIIa в плазме спустя 5 мин после введения (первая временная точка), деленная на теоретическую максимальную концентрацию FVIIa в плазме (рассчитанную из введенной массы FVIIa и теоретического общего объема крови), умноженная на 100%); % выхода препарата (in vitro) (измеренная концентрация FVIIa в плазме, в которую добавили известное количество FVIIa, деленная на теоретическую максимальную концентрацию FVIIa в плазме (рассчитанную из количества добавленного FVIIa к известному объему плазмы), умноженная на 100%); величины AUC* Активность/доза (в присутствии ТФ) (отношение AUC/доза в плазме, умноженное на ТФ-зависимую непрямую активность (см. табл. 15 выше); улучшения проявления активности по сравнению с FVIIa Novoseven(r) (в присутствии ТФ) (рассчитывали как AUC*Активность/доза (в присутствии TO)Novoseven(r) FVIIa/AUC*Активность/доза (в присутствии ТФ)мугант FVIIa; величины AUC*Активность/доза (без ТФ) (отношение AUC/доза в плазме, умноженное на ТФ-независимую не
прямую активность (см. табл. 15 выше); улучшения проявления активности по сравнению с FVIIa Novoseven(r) (без ТФ) (рассчитывали как AUC*Активность/доза (без ТФ)^^^(r) FVIIa/AUC*Активность/доза
(без ТФ)мутант FVIIa) •
Таблица 24
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC * активность /
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой активности по
сравнению с Ново7 (в отсутствие ТФ)
NovoSeven(r) FVIIa
60%
2.95Е+10
1.0
7.26Е+03
1.0
Дикий тип
46%
4.71Е+10
1.4
1.22Е+04
1.5
T239I/Q286R/ M298Q/Q366N
52%
1.15Е+11
3.9
1.38Е+05
18.9
T239V/Q286R/ M298Q/Q366N
66%
1.35Е+11
4.6
4.69Е+04
6.5
T128N/P129A/ Q286R/M298Q/Q36 6N/ H373F
66%
8.10Е+10
2.8
9.77Е+04
13.5
T239I/M298Q/ H373F
60%
1.95Е+10
0.7
7.77Е+04
10.7
T239V/M298Q/ H373F
17%
4.89Е+09
0.2
3.53Е+04
4.9
M298Q/H373F/ Q366N
32%
1.19Е+10
0.4
2.13Е+04
2.9
V158D/Q286R/ E296V/M298Q/ H373F
21%
2.97Е+10
1.0
7.12Е+04
9.8
A122N/G124S/ A175S/Q286R/ M298Q/H373F
79%
2.64Е+11
9.0
определяли
не определяли
T128N/P129A/ A175S/Q286R/ M298Q/H373F
85%
2.05Е+11
7.0
определяли
не определяли
A122N/G124S/ A175S/S222A/ H257A/Q286R/ M298Q
76%
2.23Е+11
7.6
определяли
не определяли
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC* активность/
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
T128N/P129A/ A175S/S222A/ H257A/Q286R/ M298Q
69%
2.16Е+11
7.4
6.36Е+04
8.8
A122N/G124S/ A175S/Q286R/ M298Q
84%
2.73Е+11
9.3
определяли
не определяли
T128N/P129A/ A175S/Q286R/ M298Q
76%
3.69Е+11
12.6
определяли
не определяли
Gla Swap FIX /A122N/G124S/ A175S/S222A/ Q286R
42%
1.44Е+11
4.9
определяли
не определяли
Gla Swap FIX /T128N/P129A/ A175S/S222A/ Q286R
69%
1.08Е+11
3.7
8.51Е+04
11.7
H257A/Q286R /M298Q
42%
1.16Е+11
4.0
6.33Е+04
8.7
V258D/E296V/ M298Q/H373F
17%
1.36Е+10
0.5
1.17Е+05
16.1
Gla Swap FIX /S222A/Q286R/ H373F
42%
5.88Е+10
2.0
3.90Е+04
5.4
A122N/G124S/A175 S/Q286R
78%
1.68Е+11
5.8
1.22Е+04
1.7
T128N/P129A/ A175S/Q286R
34%
2.05Е+11
7.0
2.01Е+04
2.8
A122N/G124S/ A175S/S222A
60%
6.90Е+10
2.4
определяли
не определяли
T128N/P129A/ A175S/S222A
88%
7.31Е+10
2.5
8.00Е+03
1.1
A122N/G124S/ A175S/Q366V
60%
6.48Е+10
2.2
6.42Е+03
0.9
T128N/P129A/ A175S/Q366V
74%
7.43Е+10
2.5
7.39Е+03
1.0
Gla Swap FIX / S222A/Q286R/ M298Q
40%
5.52Е+10
1.9
1.09Е+05
15.0
S222A/Q286R/ M298Q
22%
4.46Е+10
1.5
8.78Е+04
12.1
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC* активность /
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
замена Gla FIX/ S222A/Q286R/ M298Q/ H373F
16%
2.94Е+10
1.0
1.99Е+04
2.7
S222A/Q286R/ M298Q/H373F
1.57Е+10
0.5
4.57Е+04
6.3
H257S/Q286R/ M298Q/H373F
20%
4.52Е+10
1.5
9.01Е+03
1.2
S222A/H257S/ Q286R/M298Q
72%
1.28Е+11
4.4
3.39Е+04
4.7
T239I/Q286R/ M298Q/H373F
56%
8.73Е+10
3.0
1.05Е+04
1.5
T239V/Q286R
66%
1.35Е+11
4.6
1.79Е+04
2.5
V158D/T239V/ E296V/ M296Q
4.08Е+10
1.4
3.43Е+05
47.3
T239I/Q286R/ H373F
77%
1.14Е+11
3.9
определяли
не определяли
S222A/T239I/ H257A/Q286R/ M298Q
61%
1.38Е+11
4.7
6.26Е+04
8.6
T128N/P129A/T2391 /Q286R/M298Q
81%
1.72Е+11
5.9
1.64Е+05
22.6
замена Gla FIX / T239I/Q286R/ M298Q
56%
1.59Е+11
5.4
3.10Е+05
42.6
T239I/Q286R/ M298Q
54%
1.16Е+11
4.0
1.16Е+04
1.6
замена Gla FIX /S222A/T239I/ Q286R
42%
7.27Е+10
2.5
2.18Е+04
3.0
S222A/T239I
71%
3.97Е+10
1.4
2.19Е+03
0.3
T239I/Q286R
56%
1.05Е+11
3.6
8.34Е+03
1.1
V158D/T239I/ E296V/M298Q
34%
5.38Е+10
1.8
8.01Е+04
11.0
T239V/Q286R/ M298Q/H373F
10%
2.54Е+10
0.9
6.07Е+03
0.8
T239V/Q286R/ H373F
16%
4.09Е+10
1.4
4.69Е+03
0.6
T128N/P129A/ S222A/T239V/ H257A/Q286R/ M298Q
49%
6.84Е+10
2.3
1.01Е+05
13.9
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC * активность /
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
S222A/T239V/ H257A/Q286R/ M298Q
15%
3.87Е+10
1.3
2.59Е+04
3.6
T128N/P129A/ T239V/Q286R/ M298Q
60%
9.47Е+10
3.2
2.10Е+05
28.9
(замена Gla FIX/T239V/ Q286R/M298Q
34%
9.24Е+10
3.2
1.01Е+05
14.0
T239V/Q286R7 M298Q
21%
6.85Е+10
2.3
1.17Е+04
1.6
замена Gla FIX/ S222A/T239V/ Q286R
33%
9.32Е+10
3.2
7.99Е+03
1.1
S222A/T239V
10%
9.52Е+09
0.3
3.83Е+02
0.1
V158D/Q286R/ E296V/M298Q
15%
2.56Е+10
0.9
1.76Е+05
24.3
T128N/P129A/ Q286R/M298Q/ H373F
36%
7.92Е+10
2.7
1.83Е+04
2.5
Q286R/M298Q/ H373F
66%
1.39Е+11
3.9
1.42Е+05
12.1
T128N/P129A/ Q286R/H373F
49%
2.03Е+11
6.9
1.93Е+04
2.7
{замена Gla FIX K[43]I}/ T128N/
PI 29 A Q286R/M298Q
/Q366N
45%
9.88Е+10
3.4
8.58Е+04
11.8
{замена Gla FIX K[43]I}/Q286R/ M298Q/Q366N
36%
4.35Е+10
1.5
2.18Е+04
3.0
Q286R/M298Q/ Q366N
41%
1.33Е+11
4.5
7.50Е+04
10.3
M298Q/K341D
84%
4.26Е+10
1.0
1.02Е+04
0.6
Q286R/M298Q/ K341D
33%
4.98Е+09
0.1
5.24Е+03
0.3
A175S/Q286R/ Q366V
22%
3.72Е+10
0.9
7.31Е+03
0.4
S52A/S60A/S222A/ H257A/Q28R/ M2986Q
45%
1.17Е+11
4.0
5.42Е+04
7.5
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC * активность/
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
T128N/P129A/S222 A/H257A/Q286R/ M2986Q
53%
1.80Е+11
6.1
5.23Е+04
7.2
S222A/H257A/ Q286R/M298Q
3.04Е+10
0.9
4.17Е+04
4.9
S222A/M298Q
8.63Е+09
0.2
9.51Е+04
5.1
{замена Gla FIX/K[43]I}/T128N/ P129A/Q286R/ M298Q
23%
2.46Е+08
0.0
6.00Е+04
8.3
замена Gla FIX/S52A/S60A/ Q286R/M298Q
32%
4.63Е+10
1.6
2.54Е+05
34.9
S52A/S60A/ Q286R/M298Q
31%
4.67Е+10
1.6
8.11Е+04
11.2
{замена Gla FIX/M[19]K}/ Q286R/M298Q
69%
9.11Е+10
3.1
3.32Е+05
45.7
{замена Gla FIX/Q[44]S}/ Q286R/M298Q
35%
5.77Е+10
2.0
2.12Е+05
29.2
{замена Gla FIX/K[43]I}/ Q286R/M298Q
28%
1.20Е+П
4.1
3.96Е+05
54.5
{замена Gla FIX/E[40]L}/ Q286R/M298Q
36%
8.04Е+10
2.7
3.14Е+05
43.3
замена Gla FIX /T128N/P129A/ Q286R/M298Q
84%
9.00Е+10
3.1
3.58Е+04
4.9
T[128]N/P[129]A/ Q286R/M298Q
66%
1.55Е+11
5.3
2.20Е+05
30.3
T[128]N/P[129]A/ Q286R/M298Q
62%
4.21Е+11
14.4
1.84Е+05
25.4
Q143R/M156Q/3aMe на Gla FIX
21%
8.53Е+10
2.7
2.30Е+05
29.9
Q286R/M298Q
51%
1.08Е+11
3.2
1.03Е+05
11.2
S222A/H257A/ Q286R
40%
1.55Е+11
4.4
2.72Е+04
3.2
замена Gla FIX/T128N/P129A /S222A/Q286R
44%
1.37Е+11
4.7
1.44Е+04
2.0
Мутация (no нумерации зрелого FVII)
% выхода (in vivo)
AUC* активность/
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
замена Gla FIX/ S222A/ Q286R
32%
5.95Е+10
1.4
2.15Е+04
1.2
S222A/Q286R
51%
1.85Е+11
5.4
4.61Е+04
2.5
H257A/Q286R
63%
3.66Е+11
12.5
1.59Е+04
2.2
A122N/G124S/ A175S
82%
8.70Е+10
2.4
2.18Е+04
1.2
T128N/P129A/ A175S
80%
6.16Е+10
1.7
S119N/L121S/ A175S
60%
8.68Е+10
2.5
K109N/A175S
22%
4.73Е+10
1.3
A175S
52%
8.10Е+Ю
2.4
1.40Е+04
0.8
G318N
37%
5.22Е+10
1.2
0.00Е+00
0.0
A122N/G124S/ E394N/P395A/ R396S
46%
1.07Е+11
2.5
определяли
не определяли
замена Gla FIX/ Q366V
26%
1.43Е+10
0.5
1.41Е+04
1.9
Q366V
4.09Е+09
0.1
1.44Е+03
0.1
H257S
39%
1.67Е+11
5.1
1.30Е+04
0.9
H257A
36%
4.96Е+10
1.2
1.18Е+04
0.6
S52A/S60A/S222A
11%
1.05Е+10
0.4
5.28Е+03
0.7
T128N/P129A/ S222A
21%
5.28Е+10
1.8
4.06Е+03
0.6
S222A
10%
1.55Е+10
0.4
8.56Е+03
0.5
K341D
98%
4.77Е+10
1.1
определяли
не определяли
S52A/S60A/Q286R
67%
6.42Е+10
2.2
1.59Е+04
2.2
T128N/P129A/ Q286R
67%
4.13Е+11
14.1
4.24Е+04
5.8
Q286R
35%
1.31Е+11
3.7
3.52Е+04
2.6
S52A/S60A/V158D/ E296V/M298Q
9.34Е+09
0.3
8.24Е+04
11.3
T128N/P129A/ V158D/E296V/ M298Q
21%
5.03Е+10
1.7
3.44Е+05
47.4
T128N/P129A/ M298Q
58%
3.11Е+10
1.1
4.49Е+04
6.2
M286Q
18%
1.33Е+10
0.4
4.93Е+04
3.8
S52A/S60A
51%
5.36Е+10
1.4
7.76Е+03
0.6
Мутация (по нумерации зрелого FVII)
% выхода (in vivo)
AUC* активность/
дозу (в присутствии ТФ)
Увеличение проявляемой активности по сравнению с
Ново7 (в присутствии ТФ)
AUC * активность
/ дозу (в отсутствие ТФ)
Увеличение проявляемой
активности по сравнению с Ново7 (в
отсутствие ТФ)
A51N
15%
4.65Е+10
1.1
9.39Е+03
0.5
A122N/G124S
45%
5.26Е+10
1.8
4.61Е+03
0.6
A122N/G124S
45%
9.20Е+10
2.2
0.00Е+00
0.0
K109N
52%
1.05Е+11
3.6
K109N
52%
8.43Е+10
2.0
S52A
37%
3.50Е+10
0.8
0.00Е+00
0.0
замена Gla FIX
31%
2.63Е+10
0.7
1.28Е+04
1.4
T128N/P129A
88%
8.25Е+10
2.4
25147.5
2.6
P257BCTaBKaGGGSC SFGRGDIRNVC
38%
6.29Е+10
1.5
определяли
не определяли
Пример 10. Определение связывания фактора VIIa с растворимым тканевым фактором.
Способность вариантов FVIIa, экспрессированных в HEK 293 или ВНК клетках, связывать растворимый тканевый фактор (рТФ) оценивали с помощью поверхностного плазмонного резонанса на приборе Biacore. Варианты FVIIa оценивали путем измерения профиля связывания при трех концентрациях протеазы в двух повторностях, используя два различных уровня рТФ, связанных с чипом Biacore CM5.
С новым сенсорным чипом Series S CM5 (GE Healthcare Cat # BR 1006-68) связали бычий сывороточный альбумин и растворимый тканевый фактор с помощью прибора Biacore T100. Соединение было проведено с использованием буфера для соединения Biacore (30 мМ Na Hepes pH 7,4, 135 мМ NaCl, 1 мМ ЭДТА, 0,01% твин-20) с применением комплекта для связывания аминогрупп (GE Healthcare Cat # BR-1000-50) и протокола в программном обеспечении Biacore T100. Для иммобилизации были использованы все четыре ячейки чипа. Ячейки 1 и 3 связали с 500 единицами ответа (RU) бычьего сывороточного альбумина, указанный белок разводили в ацетатном буфере, рН 4,0, ячейки 2 и 4 связали с 500 и 250 RU рТФ (R &D Systems), растворенным в ацетатном буфере, рН 4,5.
Каждый вариант FVIIa и протеазу FVIIa дикого типа исследовали при трех концентрациях и в двух повторностях. Протеазы разбавляли до 60, 30 и 15 нМ в 100 мкл буфера Biacore (20 мМ Na Hepes, pH 7,4, 150 мМ NaCl, 5 мМ CaCb, 0,1% ПЭГ 8000, 0,1% БСА, 0,01% Твин-20) в 96-луночном планшете для анализа. Каждый образец анализировали с помощью прибора Biacore T100 при времени контакта 120 с и времени диссоциации 180 с при скорости потока 10 мкл/мин. Буфер без растворенных белков также был исследован. Чип регенерировали 50 мМ ЭДТА, рН 7,0 в течение 60 с, затем 30 с. Анализ для определения связывания FVIIa дикого типа с рТФ дал три набора кривых, которые дали значение Kd около 8 нМ.
Для анализа данных использовали программное обеспечение Biacore T100 Evaluation. Для аппроксимации был использован анализ связывания кинетика/аффинность 1:1, который аппроксимирует данные изотермой Ленгмюра, данные индивидуально аппроксимировали для двух повторностей для каждого варианта при двух уровнях единиц ответа. Четыре полученных после аппроксимации значения Kd были усреднены и приведены в табл. 25. Варианты FVIIa, содержащие мутацию M298Q, как правило, проявляли более низкое значение Kd и, следовательно, более прочно связывали рТФ.
Связывание вариантов FVIIa с растворимым ТФ
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Аффинность Kd (нМ) |
293-F клетки
ВНК21 клетки
Дикий тип
Дикий тип
7.9
9.0
Q286N
Q143N
8.9
Q286E
Q143E
3.8
Q286D
Q143D
9.8
Q286S
Q143S
8.2
Q286T
Q143T
10.6
Q286R
Q143R
7.6
Q286K
Q143K
8.2
Q286A
Q143A
6.3
Q286V
Q143V
11.9
S222A
S82A
4.2
H257S
H117S
4.2
Q366D
Q217D
3.2
Q366E
Q217E
5.6
Q366N
Q217N
3.8
Q366T
Q217T
7.1
Q366S
Q217S
9.0
Q366V
Q217V
7.9
A175S
A39S
6.5
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Аффинность Kd (нМ)
293-F клетки
ВНК21 клетки
V158T/L287T/M298K
V21T/L144T/M156K
8.4
V158D/L287T/M298K
V21D/L144T/M156K
8.5
Q286R/S222A
Q143R/S82A
7.3
Q286R/S222A/ замена Gla FIX
Q143R/S82A/ замена Gla FIX
8.4
Q286R/M298Q
Q143R/M156Q
4.7
Q286R/M298Q/K341Q
Q143R/M156Q/K192Q
11.4
Q286R/M298Q/K199E
Q143R/M156Q/K60cE
4.9
S222A/M298Q
S82A/M156Q
5.1
H257A/M298Q
H117A/M156Q
3.1
S222A/H257A /Q286R/M298Q
S82A/H117A/Q143R/ M156Q
2.5
Q286R/Q366V
Q143R/Q217V
29.3
A175S/Q286R/Q366V
A39S/Q143R/Q217V
18.3
S222A/Q286R/Q366V
S82A/Q143R/Q217V
8.6
Q286M
Q143M
7.1
Q286L
Q143L
7.1
Q286Y
Q143Y
7.5
Q366I
Q217I
6.7
Q366L
Q217L
5.2
Q366M
Q217M
4.7
Н216А/Н257А
Н76А/Н117А
6.0
Q286R/K341D
Q143R/K192D
3.5
M298Q/K341D
Q143R/Q217D
7.9
Q286R/Q366N
Q143R/Q217N
8.0
Q286R/M298Q/Q366D
Q143R/M156Q/Q217D
4.6
Q286R/M298Q/Q366N
Q143R/M156Q/Q217N
3.8
Дополнительную серию экспериментов проводили для оценки связывания вариантов FVIIa с растворимым ТФ с использованием того же анализа, как описано выше, но с модифицированным диапазоном доз FVIIa 30 нМ, 15 нМ и 7,5 нМ, и для аппроксимации данных SPR была использована модель с двумя состояниями. Этот анализ модели с двумя состояниями проводили с помощью пакета программного обеспечения Biacore T100 Evaluation Software, который приведен ниже. Результаты представлены в табл. 26 ниже.
Зависимое от концентрации связывание 1:1
MM-V1) Л /f2(s-1) Л
FVIIa + sTF FVIIa sTF FVIIa sTF1
Ms"1) Ms-1)
v-1 -'
обратимое изменение конформации 1 -го порядка
Связывание вариантов FVIIa с растворимым ТФ
Мутация (по нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Аффинность Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность К <1 дикого типа ' *VI мутанта
Дикий тип (NovoSeven(r))
Дикий тип (NovoSeven(r))
6.5
1.2
19%
1.2
1 9
Дикий тип (NovoSeven-RT(r))
Дикий тип (NovoSeven-RT(r))
6.3
85%
13%
1.2
Дикий тип
Дикий тип
7.6
1.9
24%
1.0
Дикий тип f
Дикий тип f
3.9
0.6
15%
1.0
T128N/P129A
T[128]N/P[129]A
6.8
1.2
18%
1.1
замена Gla FIX
замена Gla FIX
36.0
2.6
0.2
K109N
K[109]N
10.8
0.2
0.7
S52A/S60A
S[52]A/S[60]A
23.2
4.0
17%
0.3
M298Q
M156Q
5.9
0.7
11%
1.3
M298Q f
M156Qt
1.9
0.1
2.0
T128N/P129A/ M298Q f
T[128]N/P[129]A/ M156Qf
2.4
0.4
16%
1.6
V158D/E296V /M298Q
V21D/E154V/ M156Q
2.0
0.5
26%
3.9
V158D/E296V/ M298Q f
V21D/E154V/ M156Qt
1.8
0.5
30%
2.2
T128N/P129A/ V158D/E296V/ M298Q
T[128]N/P[129]A/ V21D/E154V/ M156Q
2.0
0.1
3.9
S52A/S60A/V158D/ E296V/M1298Q
S[52]A/S[60]A/ V21D/E154V/ M156Q
14.6
1.3
0.5
Q286R
Q143R
6.7
0.4
1.1
T128N/P129A/ Q286R
T[128]N/P[129]A/ Q143R
11.1
4.3
39%
0.7
T128N/P129A/ Q286R f
T[128]N/P[129]A/ Q143Rf
10.0
1.6
16%
0.4
Мутация (по нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Аффинность Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность Kd дикого типа / Kd мутанта
S52A/S60A/Q286R
S[52]A/S[60]A/ Q143Rf
51.6
18.4
36%
0.1
S222A
S82A
2.6
0.1
3.0
T128N/P129A/ S222A
T[128]N/P[129]A/ S82A
3.6
0.2
2.1
S52A/S60A/S222A
S[52]A/S[60]A/ S82A
17.2
2.4
14%
0.4
H257S
H117S
6.6
1.5
23%
1.2
замена Gla FIX/Q366V
замена Gla FIX/Q217V
56.0
15.1
27%
0.1
A175S
A39S
12.3
0.1
0.6
K109N/A175S
K[109]N/A39S
9.0
0.0
0.8
S119N/L121S/ A175S
S[119]N/L[121]S/ A39S
6.6
0.1
1.1
T128N/P129A/ A175S
T[128]N/P[129]A/ A39S
10.0
0.1
0.8
A122N/G124S/ A175S
A[122]N/G[124]S/ A39S
12.1
2.2
18%
0.6
Q286R/H257A
Q143R/H117A
7.2
1.0
13%
1.1
Q286R/H257A f
Q143R/H117Af
5.5
0.1
0.7
Q286R/S222A
Q143R/S82A
3.4
0.2
2.3
замена Gla FIX/ T128N/P129A/ S222A/Q286R
замена Gla FIX/ T[128]N/P[129]A/ S82A/Q143R
21.3
5.6
26%
0.4
замена Gla FIX/ T128N/P129A/ S222A/Q286R f
замена Gla FIX/ T[128]N/P[129]A/ S82A/Q143Rf
24.6
6.4
26%
0.2
замена Gla FIX/ S52A/S60A/S222A/ Q286R
замена Gla FIX/ S[52]A/S[60]A/ S82A/Q143R
56.9
8.5
15%
0.1
Q286R/S222A/ H257A
Q143R/S82A/ H117A
6.0
0.5
1.3
Q286R/M298Q
Q143R/M156Q
4.1
0.5
11%
1.9
Q286R/M298Q
Q143R/M156Qf
3.6
1.1
29%
1.1
Q286R/M298Q
Q143R/M156Q§
3.2
0.2
1.2
замена Gla FIX/ Q286R/M298Q
замена Gla FIX/ Q143R/M156Q
30.4
5.4
18%
0.3
замена Gla FIX/ Q286R/M298Q f
замена Gla FIX/ Q143R/M156Qf
22.1
1.5
0.2
T128N/P129A /Q286R/ M298Q
T[128]N/P[129]A/ Q143R/M156Q
4.7
1.2
26%
1.6
Мутация (по нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Аффинность
Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность дикого типа / К <] мутанта
T128N/P129A/Q286 R/M298Qf
T[128]N/P[129]A/ Q143R/M156Qf
3.9
0.4
11%
1.0
замена Gla FIX /T128N/P129A/ Q286R/ M298Q
замена Gla FIX /T[128]N/P[129]A/ Q143R/M156Q
20.8
1.4
0.4
замена Gla FIX /T128N/P129A/ Q286R/ M298Q f
замена Gla FIX /T[128]N/P[129]A/ Q143R/M156Qf
37.5
12.3
33%
0.1
{замена Gla FIX/E40L}/ Q286R/M298Q
{замена Gla FIX/E[40]L}/ Q143R/M156Q
38.5
7.4
19%
0.2
{замена Gla FIX/K43I}/ Q286R/M298Q
{замена Gla FIX/K[43]I}/ Q143R/M156Q
35.3
3.4
10%
0.2
{замена Gla FIX/K43I}/ Q286R/M298Q f
{замена Gla FIX/K[43]I}/ Q143R/M156Qt
23.7
3.6
15%
0.2
{замена Gla FIX/Q44S}/ Q286R/M298Q
{замена Gla FIX/Q[44]S}/ Q143R/M156Q
40.8
6.4
16%
0.2
{замена Gla FIX/MI 9K}/ Q286R/M298Q
{замена Gla FIX/M[19]K}/ Q143R/M156Q
16.7
2.4
14%
0.5
S52A/S60A/ Q286R/M298Q
S[52]A/S[60]A/Q14 3R/M156Q
25.1
1.7
0.3
замена Gla FIX /S52A/S60A/Q286R/ M298Q t
замена Gla FIX/ S[52]A/S[60]A/ Q143R/M156Q f
6.0
0.1
0.6
{замена Gla FIX/ M19K/E40L/K43I/ Q44S}/Q286R/ M298Q
{замена Gla FIX/ M[19]K7E[40]L/ K[43]I/Q[44]S} /Q143R/M156Q
4.9
0.1
1.6
{замена Gla FIX/K43I} /T128N/P129A/ Q286R/M298Q f
{замена Gla FIX/K[43]I} /T[128]N/P[129]A/ Q143R/M156Qf
10.5
1.3
13%
0.4
T239V
T99V
5.2
1.5
T239I
T99I
6.2
1.2
T128N/P129A/ S222A/H257A/ Q286R/M298Q
T[128]N/P[129]A/S 82A/H117A/Q143R /M156Q
2.6
0.3
11%
3.0
T128N/P129A/ S222A/H257A/Q286 R/M298Q f
Мутация (no нумерации зрелого FVII)
T[128]N/P[129]A/
S82A/H117A/ Q143R/M156Qt
Мутация (no нумерации химотрипсина)
4.0
0.2
1.0
Аффинность
Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность
типаТк(tm) мутанта
S52A/S60A/S222A/ H257A/Q286R/ M298Q
S[52]A/S[60]A/S82 A/H117A/Q143R/ M156Q
11.1
2.7
24%
0.7
T128N/P129A/ Q286R/M298Q/ Q366N f
T[129]N/P[129]A/ Q143R/M156Q/ Q217Nf
3.2
0.6
18%
1.2
{замена Gla FIX/K43I}/Q286R/ M298Q/Q366N f
{замена Gla FIX/K[43]I} /Q143R/M156Q/ Q217N f
13.0
0.7
0.3
{замена Gla FIX/K43I}/T[128]N/ P[129]A/Q286R/ M298Q/Q366N f
{замена Gla FIX/K[43]I} /T[128]N/P[129]A/ Q143R/M156Q/ Q217Nf
13.1
0.3
0.3
T128N/P129A/Q286 R/H373F
T[128]N/P[129]A/ Q143R/H224F
6.8
0.0
1.1
T128N/P129A/Q286 R/M298Q/H373F
T[128]N/P[129]A/ Q143R/M156Q/ H224F
3.1
0.1
2.4
S52A/S60A/Q286R/ M298Q/H373F
S[52]A/S[60]A/ Q143R/M156Q/ H224F
23.4
7.5
32%
0.3
T128N/P129A/ M298Q/H373F f
T[128]N/P[129]A/ M156Q/H224Ff
1.3
0.5
41%
3.1
V21D/Q143R/ E154V/M156Q
V21D/Q143R/ E154V/M156Q
2.2
0.2
3.5
замена Gla FIX /S222A/T239V/Q28 6R
замена Gla FIX /S82A/T99V/Q143
19.1
7.7
40%
0.4
замена Gla FIX /S222A/T239V/ Q286R f
замена Gla FIX /S82A/T99V/ Q143Rf
14.9
0.4
0.3
T239V/Q286R/ M298Q
T99V/Q143R/ M156Q
2.5
0.1
3.1
замена Gla FIX/ T239V/Q286R/M29 8Q
замена Gla FIX/ T99V/Q143R/M156
22.7
6.8
30%
0.3
замена Gla FIX/ T239V/Q286R/ M298Q f
замена Gla FIX/ T99V/Q143R/ M156Qf
25.7
9.2
36%
0.2
T128N/P129A/T239 V/Q286R/M298Q f
T[128]N/P[129]A/ T99V/Q143R/ M156Qt
7.8
0.6
0.5
Мутация (по нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Аффинность Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность Kd дикого типа / Kd
S222A/T239V/ H257A/Q286R/ M298Q
S82A/T99V/H117A /Q143R/M156Q
2.2
0.0
3.4
T128N/P129A/S222 A/T239V/H257A/ Q286R/M298Q f
[T128]N/P[129A]/ S82A/T99V/H117A /Q143R/M156Qf
3.6
0.7
18%
1.1
T128N/P129A/ T239V/Q286R/ M298Q/H373F f
T[128N]/P129]A/
T99V/Q143R/ M156Q/H224Ff
3.9
0.1
1.0
T239I/Q286R
T99I/Q143R
8.0
0.2
1.0
GlaSwapFIX/S222A/ T239I/Q286R
замена Gla FIX /S82A/T99I/Q143R
39.6
1.2
0.2
замена Gla FIX / T239I/Q286R/ M298Q
замена Gla FIX /T99I/Q143R/ M156Q
13.1
2.1
16%
0.6
T128N/P129A/T239I /Q286R/M298Q f
[T128]N/P[129A]/ T99I/Q143R/ M156Qf
5.1
0.9
18%
0.8
T239I/Q286R/H373 F
T99I/Q143R/H224F
7.8
0.1
1.0
V158D/T239V/E296 V/M298Q
V21D/T99V/E154V /M156Q
1.7
0.6
32%
4.4
V158D/T239V/E296 V/M298Q f
V21D/T99V/E154V /M156Qf
1.9
0.7
36%
2.1
T239V/Q286R
T99V/Q143R
2.3
0.0
1.7
T128N/P129A/T239I / Q286R/M298Q/ H237F f
T[128]N/P[129]A/
T99I/Q143R/ M156Q/H224Ff
3.4
0.0
1.2
замена Gla FIX/ Q286R/S222A/ H257S
замена Gla FIX/ Q143R/S82A/ H117S
34.3
9.1
27%
0.2
S222A/Q286R/ M298Q/H373F
S82A/Q143R/ M156Q/H224F
2.1
0.1
3.7
замена Gla FIX/S222A/ Q286R/M298Q/ H373F
замена Gla FIX S82A/Q143R/ M156Q/H224F
9.5
0.9
0.8
T128N/P129A/ A175S/ Q366V
T[128]N/P[129]A/ A39S/Q217V
6.5
12.0
184%
1.2
A122N/G124S/ A175S/Q366V
A[122]N/G[124]S/ A39S/Q217V
13.0
0.6
0.6
T128N/P129A/ A175S/S222A
T[128]N/P[129]A/ A39S/S82A
4.5
0.3
1.7
Мутация (no нумерации зрелого FVII)
Мутация (no нумерации химотрипсина)
Аффинность Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность Кд дикого типа / Kd мутанта
A122N/G124S/ A175S/S222A
A[122]N/G[124]S/ A39S/S82A
7.0
0.6
1.1
T128N/P129A/ A175S/Q286R
T[128]N/P[129]A/ A39S/Q143R
8.6
0.1
0.9
A122N/G124S/ A175S/Q286R
A[122]N/G[124]S/ A39S/Q143R
8.6
0.0
0.9
замена Gla FIX/ S222A/Q286R/ H373F
замена Gla FIX/ S82A/Q143R/ H224F
40.9
7.5
18%
0.2
замена Gla FIX/ A122N/G124S/ A175S/S222A/Q286 R
замена Gla FIX/ A[122]N/G[124]S/ A39S/S82A/Q143R
43.7
14.0
32%
0.2
T128N/P129A/ A175S/Q286R/ M298Q
T[128]N/P[129]A/ A39S/Q143R/ M156Q
5.5
0.0
1.4
A122N/G124S/A175 S/
Q286R/M298Q
A[122]N/G[124]S/ A39S/Q143R/M156
5.3
0.1
1.4
T128N/P129A/ A175S/S222A/ H257A/Q286R/ M298Q
T[128]N/P[129]A/ A39S/S82A/H117A /Q143R/M156Q
6.7
0.8
11%
1.1
A122N/G124S/ A175S/S222A/ H257A/Q286R/ M298Q
A[122]N/G[I24]S/ A39S/S82A/H117A /Q143R/M156Q
7.7
0.6
1.0
T128N/P129A/ A175S/Q286R7 M298Q/H373F
T[128]N/P[129]A/ A39S/Q143R/ M156Q/H224F
7.4
3.2
43%
1.0
A122N/G124S/ A175S/Q286R/ M298Q/ H373F
A[122]N/G[124]S/ A39S/Q143R/ M156Q/H224F
5.0
0.1
1.5
V158D/Q286R/E296 V/M298Q/H373F
V21D/Q143R/E154 V/M156Q/H224F
1.7
0.5
27%
4.5
M298Q/Q366N/ H373F f
M156Q/Q217N/ H224F f
1.6
0.9
60%
2.5
T239V/M298Q/ H373F f
T99V/M156Q/ H224F f
3.5
0.4
11%
1.1
T239I/M298Q/ H373F f
T99I/M156Q/ H224F
2.3
0.6
24%
1.7
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Аффинность Kd (нМ)
Стандартное отклонение
Коэффициент вариации
Аффинность КаДИК0Г0 типа/Ка мутанта
T128N/P129A/
Q286R/ M298Q/Q366N/
H373F f
T[128]N/P[129]A/
Q143R/ M156Q/Q217N/ H224F t
2.6
0.6
23%
1.5
T239V/Q286R/ M298Q /Q366N f
T99V/Q143R/ M156Q /Q217Nt
4.1
0.3
0.9
T239I/Q286R/ M298Q/Q366N f
T99I/Q143R/ M156Q/Q217Nf
2.4
0.6
27%
1.6
t полученные в клетках СНОХ
§ полученные в стабильном клоне 52-5F7 клеточной линии СНОХ Пример 11. Ингибирование вариантов FVIIa Zn2+.
Варианты FVIIa, экспрессированные в клетках HEK 293 или ВНК, исследовали на устойчивость к ингибированию Zn2+ в присутствии или в отсутствие растворимого тканевого фактора. ZnCl2 (Aldrich) разбавляли до 20 мМ в dH2O, затем до 4 мМ в 1 х буфере (50 мМ Na Hepes, pH 7,5, 100 мМ NaCl, 1,5 мМ CaCl2, 0,01% Твин-20 и 0,01% ПЭГ-8000). В 96-луночном планшете последовательным разведением в 2 раза были приготовлены одиннадцать концентраций цинка, вплоть до 3,9 мкМ. Последняя ячейка ряда содержала буфер без цинка для измерения не ингибированной протеолитической активности FVIIa. Варианты FVIIa и протеазу дикого типа разбавляли до 500 нМ, затем снова разбавляли в 10 раз до 50 нМ. Приготовленный 50 нМ исходный раствор использовали для анализов без растворимого тканевого фактора (рТФ, R &D Systems). При выполнении анализов с растворимым тканевым фактором протеазу снова разбавляли в 1 х буфере для анализа с рТФ до конечной концентрации 12,5 нМ и 125 нМ соответственно. Растворы предварительно инкубировали в течение не менее 5 мин при комнатной температуре.
Для начала реакции ингибирования 20 мкл FVIIa/рТФ или раствора FVIIa смешивали с 60 мкл разведения цинка в каждом ряду в одной из десяти концентраций. Для ингибирования FVIIa смеси готовили с использованием 2 мМ ZnCl2, а для FVIIa/рТФ - с использованием 4 мМ ZnCl2. Планшеты инкубировали в течение 30 мин при комнатной температуре. Для анализа ингибирования Zn2+ 20 мкл субстрата FVIIa (мезил-dFPR-ACC, растворенный до 20 мМ в ДМСО и разведенный в буфере для анализа) добавили в лунки до конечной концентрации 90 мкМ. Концентрации рТФ и цинка для анализа оставались неизменными вследствие добавления их по мере необходимости в раствор субстрата. Увеличение флуоресценции (возбуждение: 380 нм, излучение: 460 нм) измеряли в течение 60 мин при 30°С на планшетном спектрофотометре Spectramax Gemini M5 (Molecular Devices). Остаточную протеолитическую активность рассчитывали для каждой концентрации цинка путем деления ингибированной скорости реакции на не ингибированную скорость катализируемой протеазой реакции. Концентрацию Zn2+, необходимую для ингибирования половины протеолитической активности (K05), рассчитывали путем построения остаточной активности против концентрации цинка и аппроксимирования гиперболическим уравнением с использованием программного обеспечения XLFit4 (IDBS). Каждую протеазу исследовали два раза в двух отдельных повторностях для получения среднего значения для K05.
Результаты представлены в табл. 27. Мутации Н257 и Н216 повышали устойчивость примерно в 3 раза. Мутация M268Q также повышала устойчивость к цинку в 3 раза. Во всех случаях при комбинации с дополнительными мутациями эффект сохранялся в различной степени. Наиболее устойчивыми вариантами были комбинации приведенных выше мутаций: H216A/H257A-FVIIa и H257A/M298Q-FVIIa.
Таблица 27
Q286R/S222A/ замена Gla из FIX
S82A/Q143R/ замена Gla из FIX
34.0
S222A/M298Q
S82A/M156Q
138.0
H257A/M298Q
H117A/M156Q
481.0
S222A/H257A/Q286R/ M298Q
S82A/H117A/Q143R/ M156Q
180.6
S222A/Q286R/Q366V
S82A/Q143R/Q217V
40.5
S222V
S82V
86.8
S222D
S82D
89.5
S222N
S82N
94.6
S222E
S82E
110.5
Н216А/Н257А
Н76А/Н117А
407.5
H216A/S222A
H76A/S82A
226.0
H257S/Q286R
H117S/Q143R
316.5
S222A/H373A
S82A/H224A
94.0
Пример 12. Определение концентрации каталитически активных протеаз с использованием титран-та активных сайтов 4-метилумбеллиферил-р'-гуанидинобензоата (MUGB).
В некоторых случаях концентрацию каталитически активного FVIIa в исходном растворе определяли титрованием комплекса FVIIa с растворимым тканевым фактором (рТФ) 4-метилумбеллиферил-р'-гуанидинобензоатом (MUGB), флуорогенным эфирным субстратом, разработанным для активных центров трипсиноподобных сериновых протеаз. Анализ проводили, как описано в работе Payne и др., (Biochemistry (1996) 35: 7100-7106), с небольшими изменениями. MUGB легко реагирует с FVIIa, но не с FVII или неактивной протеазой, с образованием стабильного ацил-ферментного интермедиата при насыщающей концентрации MUGB и медленном деацилировании, что ограничивает скорость катализа. В этих условиях протеаза FVIIa осуществляет один оборот катализа, высвобождая 4-метилумбеллифероновый флуорофор (4-MU). Если первоначальный подъем флуоресценции сопоставить со стандартной кривой зависимости флуоресценции от концентрации 4-MU, может быть рассчитана концентрация активных центров.
Анализы проводились с 1 или 2 мл реакционной смеси в 0,4 см х 1 см или 1 см х 1 см кварцевых кюветах, соответственно, при постоянном перемешивании. Каждая реакционная смесь содержала 0,5 мкМ рТФ (R &D Systems Human) в буфере, содержащем 50 мМ Hepes, 100 мМ NaCl, 5 мМ CaCl2 и 0,1% ПЭГ 8000, рН 7,6. Использовали свежеприготовленный стандартный раствор 4-MU при исходной концентрации 0,5М в ДМСО, концентрации подтверждали измерением абсорбции при 360 нм, используя коэффициент экстинкции 19000 М-1см-1 в 50 мМ Трис-буфер, рН 9,0. MUGB приготовили в исходной концентрации 0,04М в ДМСО из сухого вещества. Анализы начали добавлением 4 мкл 4 мМ MUGB (для реакции в 2,0 мл) или 2 мМ MUGB (для реакции в 1,0 мл) (в каждом случае конечная концентрация составила 8 мкМ) к 0,5 мкМ раствору рТФ (20,2 мкл или 10,1 мкл 49,4 мкМ рТФ) в 1 х буфере для анализа, фоновый гидролиз MUGB сначала измеряли за ~150-200 с до добавления FVIIa или варианта FVIIa до конечной концентрации 100-200 нМ по данным ELISA (пример 1.С.1) или титрования активных сайтов FFR-CMK (пример 3). За флуоресценцией высвобожденного 4-MU в фазе резкого подъема флуоресценции в реакции следовала дополнительная фаза 1000-1200 с. Стандартную кривую свободного 4-MU получали титрованием 1 х буфера, содержащего 0,5 мкмоль рТФ, 4-MU с калиброванной абсорбцией концентрацией шагами по 20 нМ до конечной концентрации 260-300 нМ.
Для анализа данных полученные результаты импортировали в пакет программного обеспечения GraphPad Prism, вклад фонового гидролиза вычитали из кривой путем экстраполяции начальной скорости спонтанного гидролиза MUGB, которая, как правило, составляла менее 5% от общего всплеска флуоресценции. Исправленную кривую аппроксимировали одноэкспоненциальным уравнением с линейным компонентом (для описания медленного деацилирования) вида Афлуоресценции = Amp(l-e-kt) + Bt, где Amp = амплитуда фазы всплеска флуоресценции в условиях насыщающего анализа, описанных выше, k представляет собой наблюдаемую константу скорости первого порядка образования ацил-фермента и В представляет собой общую константу скорости, связанную с полным превращением MUGB. Концентрацию активной протеазы FVIIa рассчитывали путем сравнения параметра аппроксимации для амплитуды со стандартной кривой 4-MU. Значения для нескольких анализов были измерены, усреднены и было определено стандартное отклонение.
Пример 13. Удельная активность вариантов полипептидов FVIIa для мезил-dFPR-ACC.
Для оценки активности вариантов FVIIa была определена активность (активность/моль) полипептидов FVIIa для расщепления трипептидного субстрата АСС (мезил-dFPR-ACC) при стандартных условиях анализа. Анализ включал преинкубацию полипептидов FVIIa с насыщающим количеством рТФ до разведения субстратом мезил-dFPR-ACC. В анализе определяли начальные скорости расщепления субстрата и увеличение флуоресценции АСС. Начальные скорости нарастания флуоресценции нормированы на внутреннюю стандартную кривую АСС и данные приводили в виде мкмоль/с/мкмоль FVIIa.
Для проведения реакций каждый тестируемый образец FVIIa разбавляли в полипропиленовом планшете для хранения до 200 нМ в 1 х буфере (20 мМ Hepes, 150 мМ NaCl, 5 мМ CaCl2, 0,1% БСА, 0,1% ПЭГ-8000, рН 7,5). В случае необходимости готовили разведение исходного раствора FVIIa 1:10 таким
образом, чтобы минимальный отбираемый пипеткой объем составлял 5 мкл. Были приготовлены разведения исходного раствора растворимого тканевого фактора (рТФ) (R &D Systems) в конечной концентрации 1,0 мкМ в соответствующем объеме 1 х буфере для анализа, необходимом для исследования от 8 до 32 протеаз/планшет. Например, при исследовании 8 протеаз требовалось 1,0 мл 1,0 мкМ рТФ/планшет, тогда как для исследования 32 протеаз необходимо 2,5 мл рТФ/планшет. Были получены комплексы образцов FVIIa с рТФ в конечной концентрации 100 нМ FVIIa/500 нМ РТФ в объеме 50 мкл для анализа путем смешивания 25 мкл 200 нМ варианта FVIIa с 25 мкл 1,0 рТФ мкМ в полипропиленовом планшете для хранения. Комплексы FVIIa/рТФ затем инкубировали при комнатной температуре в течение 15 мин для достижения равновесия. После периода уравновешивания 10 мкл каждого комплекса FVIIa/рТФ внесли в соответствующий ряд лунок 96-луночного черного планшета для анализа формата half area (Costar). Варианты FVIIa и контроль исследовали в трех повторностях. Мезил-dFPR-ACC субстрат готовили в 1,1 х конечной концентрации 0,09 мМ с учетом разведения 1:10 полипептида FVIIa субстратом. В 96-луночном планшете формата half area было приготовлено 20 мл 0,1 мМ раствора мезил-dFPR-ACC субстрата в 1 х буфере для анализа путем разбавления исходного раствора субстрата в безводном ДМСО.
Анализ проводили на автоматизированной рабочей станции Biomek(r) FX (Beckman Coulter), оснащенной головкой с 96 носиками (MBP BioRobotix ART(r) 130 мкл советы). Планшеты для анализа (предварительно заполненные 10 мкл FVIIa/рТФ раствора) помещали на платформу рабочей станции с одно-канальным резервуаром, заполненным 1,1 х раствором мезил-dFPR-ACC. Температуру планшетного спектрофотометра установили на 37°С. Станция Biomek(r) FX начинала анализ внесением 90 мкл 1,1 х субстрата мезил-dFPR-ACC из одноканального резервуара в каждую лунку черного планшета для анализа, содержащую 10 мкл FVIIa/рТФ.
Конечные концентрации вариантов FVIIa, рТФ и Мезил-dFPR-ACC в анализе составляли 10 нМ, 50 нМ и 0,09 мМ соответственно. Затем рабочая станция перемешивала 100 мкл образца, отбирая и сливая по 70 мкл два раза. Черный планшет для анализа перенесли в планшетный спектрофотометр SpectraMax Gemini (Molecular Devices) и измеряли начальную скорость реакции в течение 10 мин при 37°С.
После завершения анализа на том же планшетном спектрофотометре SpectraMax Gemini была определена флуоресценция в планшете, содержащем пробы для построения стандартной кривой свободного АСС (100 мкл/лунку), данные использовали для обеспечения точного преобразования единиц флуоресценции/с в мкМ/с. Стандартный планшет готовили следующим образом: во все "четные" лунки (т.е. в каждую вторую лунку) в верхнем ряду 96-луночного черного планшета для анализа формата half area 1 мМ образец АСС разбавляли до 25 нМ в 1 х буфере до конечного объема 200 мкл (5 мкл 1 мМ АСС в 195 мкл 1 х буфера для анализа). 100 мкл 1 х буфера вносили пипеткой во все остальные лунки "четных" колонок. Субстрат АСС серийно разводили 1:1 в лунках сверху вниз в колонке с получением еще 6 концентраций АСС. В последнем ряду лунки содержали только 100 мкл 1 х буфера (т.е. без АСС). Флуоресценцию измеряли с помощью определения конечной точки и строили график зависимости флуоресценции от концентрации АСС. Наклон линии, проходящей через эти точки, дает коэффициент перевода единиц флуоресценции в мкМ.
Для анализа данных, полученных с помощью планшетного спектрофотометра, а также построения стандартной кривой было использовано программное обеспечение SoftMax Pro (Molecular Devices). Файл, содержащий данные, был сохранен и экспортирован в виде ASCII текстового файла, который был импортирован в программу Microsoft Excel, обработан и проанализирован с использованием электронных таблиц Microsoft Excel. После импорта данных в электронные таблицы Microsoft Excel было осуществлено преобразование единиц флуоресценции в мкМ с помощью наклона стандартной кривой АСС, обеспечивающего коэффициент преобразования, которое перевело единицы флуоресценции/с в активность, измеряемую в мкМ/с. Все значения в трех повторностях были оценены на промахи, которые были исключены в случае необходимости. Удельную активность каждого варианта FVIIa и контроля дикого типа выражали в мкмоль/с/мкмоль и рассчитывали по следующим выражениям:
среднее значение (единицы флуоресценции/с)*коэффициент преобразования (единицы
флуоресценции/мкМ) = активность (в мкМ/с); удельная активность (в мкмоль/с/мкмоль) = [(мкм/с)*(100 мкл)*(1/1000000)]/[(10 нМ)*(100
мкл)*(1/1000000)*(1/1000)]
В табл. 28 приведена удельная активность проанализированных вариантов FVIIa, а также отношение активности к активности FVIIa дикого типа. Также включены стандартное отклонение (SD) и коэффициент вариации (в процентах; % CV). Несколько вариантов FVIIa проявили повышенную удельную активность для расщепления мезил-dFPR-ACC по сравнению с полипептидом FVIIa дикого типа. Например, Q366V-FVIIa проявлял удельную активность для расщепления мезил-dFPR-ACC, которая была в 4 раза больше, чем активность варианта FVIIa дикого типа. Варианты FVIIa, содержащие мутацию H373F, также обычно обладают повышенной удельной активностью для расщепления мезил-dFPR-ACC по сравнению с полипептидом FVIIa дикого типа.
Удельная активность полипептидов FVIIa для мезил-dFPR-ACC
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
Дикий тип (NovoSeven(r))
Дикий тип [NovoSeven(r))
2.31
0.34
0.15
100%
Дикий тип
Дикий тип
2.40
0.15
0.06
104%
T128N/P129A
Г[128]ШР[129]А
2.50
108%
Замена Gla из FIX
Замена Gla из FIX
1.63
71%
A122N/G124S
A[122]N/G[124]S
2.24
97%
S52A/S60A
S[52]A/S[60]A
1.95
85%
V158D/E296V/ M298Q
V21D/E154V/ M156Q
3.28
142%
T128N/P129A/ V158D/E296V/ M298Q
T[128]N/P[129]A/
V21D/E154V/
M156Q
3.26
142%
S52A/S60A/V158D/ E296V/M1298Q
S[52]A/S[60]A/
V21D/E154V/
M156Q
2.56
111%
Q286R
Q143R
1.24
54%
T128N/P129A/ Q286R
T[128]N/P[129]A/ Q143R
1.21
52%
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
S52A/S60A/Q286R
S[52]A/S[60]A/ Q143R
0.44
0.11
0.25
19%
S222A
S82A
2.35
102%
T128N/P129A/ S222A
T[128]N/P[129]A/ S82A
2.70
117%
S52A/S60A/S222A
S[52]A/S[60]A/ S82A
1.22
53%
H257S
H117S
2.64
115%
H373F
H224F
1.17
51%
Q366V
Q217V
9.29
403%
Замена Gla из FIX/Q366V
Замена Gla из FIX/Q217V
2.82
122%
K109N/A175S
K[109]N/A39S
3.38
147%
Q286R/H257A
Q143R/H117A
1.96
85%
Замена Gla из FIX/
T128N/P129A/
S222A/Q286R
Замена Gla из FIX/
T[128]N/P[129]A/
S82A/Q143R
0.53
23%
Замена Gla из FIX/ S52A/S60A/S222A/ Q286R
Замена Gla из FIX/
S[52]A/S[60]A/
S82A/Q143R
0.44
0.42
0.96
19%
Q286R/M298Q
Q143R/M156Q
1.91
0.11
0.06
83%
Замена Gla из FIX/ Q286R/M298Q
Замена Gla из FIX/ Q143R/M156Q
1.53
66%
T128N/P129A/Q286 R/ M298Q
T[128]N/P[129]A/ Q143R/M156Q
1.80
78%
Замена Gla из FIX
/T128N/P129A/
Q286R/M298Q
Замена Gla из FIX /T[128]N/P[129]A/ Q143R/M156Q
0.78
34%
{Замена Gla из
FIX/E40L}/
Q286R/M298Q
{Замена Gla из
FIX/E[40]L}/
Q143R/M156Q
1.16
50%
{Замена Gla из
FIX/K43I}/
Q286R/M298Q
{Замена Gla из
FIX/K[43]I}/
Q143R/M156Q
1.20
52%
{Замена Gla из
FIX/Q44S}/
Q286R/M298Q
{Замена Gla из
FIX/Q[44]S}/
Q143R/M156Q
1.11
48%
{Замена Gla из
{Замена Gla из
1.26
55%
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
FIX/M19K}/ Q286R/M298Q
FIX/M[19]K}/ Q143R/M156Q
S52A/S60A/ Q286R/M298Q
S[52]A/S[60]A/ Q143R/M156Q
1.08
0.17
0.15
47%
T128N/P129A/ S222A/H257A/ Q286R/M298Q
T[128]N/P[129]A/
S82A/H117A/
Q143R/M156Q
1.66
72%
S52A/S60A/S222A/
H257A/Q286R/
M298Q
S[52]A/S[60]A/
S82A/H117A/
Q143R/M156Q
0.98
42%
H257S/Q286R/ Q366V
H117S/Q143R/ Q217V
2.00
0.17
0.08
87%
S222A/H257A/ Q286R/ Q366V
S82A/H117A/ Q143R/Q217V
2.43
105%
Q286R/M298Q/ Q366N
Q143R/M156Q/ Q217N
2.35
102%
Q286R/H373F
Q143R/H224F
0.78
34%
T128N/P129A/ Q286R/H373F
T[128]N/P[129]A/ Q143R/H224F
2.31
100%
S52A/S60A/ Q286R/H373F
S[52]A/S[60]A/ Q143R/H224F
3.14
136%
Q286R/M298Q/ H373F
Q143R/M156Q /H224F
4.59
199%
T128N/P129A/ Q286R/M298Q/ H373F
T[128]N/P[129]A/
Q143R/M156Q/
H224F
2.83
123%
S52A/S60A/Q286R/ M298Q/H373F
S[52]A/S[60]A/ Q143R/M156Q/ H224F
5.02
218%
M298Q/H373F
M156Q/H224F
4.00
174%
V21D/Q143R/ E154V/M156Q
V21D/Q143R/ E154V/M156Q
1.83
79%
S222A/T239V
S82A/T99V
1.91
83%
Замена Gla из FIX
/S222A/T239V/
Q286R
Замена Gla из FIX
/S82A/T99V/
Q143R
0.66
28%
T239V/Q286R/ M298Q
T99V/Q143R/ M156Q
1.74
75%
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
Замена Gla из FIX/
T239V/Q286R/
M298Q
Замена Gla из FIX/
T99V/Q143R/
M156Q
1.13
49%
S222A/T239V/ H257A/Q286R/ M298Q
S82A/T99V/
H117A/Q143R/
M156Q
1.66
72%
T239V/Q286R/ H373F
T99V/Q143R/ H224F
1.53
66%
T239V/Q286R/ M298Q/H373F
T99V/Q143R/ Ml 5607 H224F
3.07
133%
V158D/T239I/ E296V/M298Q
V21D/T99I/E154V /M156Q
2.24
97%
T239I/Q286R
T99I/Q143R
0.88
38%
S222A/T239I
S82A/T99I
1.36
59%
Замена Gla из
FIX/S222A/T239I/
Q286R
Замена Gla из FIX /S82A/T99I/Q143R
0.25
11%
T239I/Q286R/ M298Q
T99I/Q143R/ M156Q
1.37
60%
Замена Gla из FIX /
T239I/Q286R/
M298Q
Замена Gla из FIX
/T99I/Q143R/
M156Q
0.67
29%
S222A/T239I/H257 A/Q286R/M298Q
S82A/T99I/H117A/ Q143R/M156Q
1.41
61%
T239I/Q286R/ H373F
T99I/Q143R/ H224F
1.24
54%
V158D/T239V/E29 6V/M298Q
V21D/T99V/E154 V/M156Q
2.19
0.15
0.07
95%
T239V/Q286R
T99V/Q143R
1.26
0.14
0.11
55%
T239I/Q286R/M298 Q/ H237F
T99I/Q143R/M156 Q/H224F
1.59
0.21
0.13
69%
H257S/Q286R/ M298Q
H117S/Q143R/ M156Q
1.85
0.23
0.13
80%
Замена Gla из FIX
/Q286R/S222A/
H257S
Замена Gla из FIX
/Q143R/S82A/
H117S
0.49
0.04
0.09
21%
S222A/H257S/ Q286R/ M298Q
S82A/H117S/ Q143R/M156Q
1.77
0.23
0.13
77%
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
H257S/Q286R/ M298Q/ H373F
H117S/Q143R/ M156Q/H224F
2.32
0.41
0.18
101%
S222A/Q286R/ M298Q/H373F
S82A/Q143R/ M156Q/H224F
2.79
0.39
0.14
121%
Замена Gla из
FIX/S222A/Q286R/
M298Q/H373F
Замена Gla из
FIX/S82A/Q143R/
M156Q/H224F
1.92
83%
S222A/Q286R/ M298Q
S82A/Q143R/ M156Q
1.90
82%
Замена Gla из FIX/
S222A/Q286R/
M298Q
Замена Gla из FIX
S82A/Q143R/
M156Q
1.12
49%
T128N/P129A/A175 S/Q366V
T[128]N/P[129]A/ A39S/Q217V
3.40
148%
A122N/G124S/A17 5S/Q366V
A[122]N/G[124]S/ A39S/ Q217V
2.34
0.22
0.09
101%
T128N/P129A/A175 S/S222A
T[128]N/P[129]A/ A39S/ S82A
3.19
138%
A122N/G124S/A17 5S/S222A
A[122]N/G[124]S/ A39S/ S82A
2.68
0.30
0.11
116%
T128N/P129A/A175 S/Q286R
T[128]N/P[129]A/ A39S/Q143R
1.88
81%
A122N/G124S/A17 5S/Q286R
A[122]N/G[124]S/ A39S/Q143R
2.16
0.42
0.20
94%
Замена Gla из FIX/
S222A/Q286R/
H373F
Замена Gla из FIX/
S82A/Q143R/
H224F
1.37
0.26
0.19
60%
V158D/E296V/M29 8Q/ H373F
V21D/E154V/M15 6Q/H224F
5.60
243%
H257A/Q286R/ M298Q
H117A/Q143R/ M156Q
2.18
95%
Замена Gla из FIX/ T128N/P129A/ A175S/S222A/ Q286R
Замена Gla из FIX/T[128]N/ P[129]A/A39S/ S82A/Q143R
0.75
32%
Замена Gla из FIX/ A122N/G124S/ A175S/S222A/ Q286R
Замена Gla из FIX/ A[122]N/G[124]S/ A39S/S82A/Q143R
0.89
38%
Мутация (по нумерации зрелого FVII)
Мутация (по нумерации химотрипсина)
Активность
(мкмоль/ сек/мкмоль)
Станда -ртное отклонение
Коэффициент вариации
Активность (% дикого типа)
T128N/P129A/ A175S/Q286R/ M298Q
T[128]N/P[129]A/
A39S/Q143R/
M156Q
2.02
88%
A122N/G124S/ A175S/Q286R/ M298Q
A[122]N/G[124]S/
A39S/Q143R/
M156Q
3.03
131%
T128N/P129A/ A175S/S222A/ H257A/Q286R/ M298Q
T[128]N/P[129]A/ A39S/S82A/ H117A/Q143R /M156Q
2.18
95%
A122N/G124S/ A175S/S222A/ H257A/Q286R/ M298Q
A[122]N/G[124]S/ A39S/S82A/H117 A/Q143R/M156Q
1.99
86%
T128N/P129A/ A175S/Q286R/ M298Q/H373F
T[128]N/P[129]A/
A39S/Q143R/
M156Q/H224F
2.78
121%
A122N/G124S/ A175S/Q286R/ M298Q/H373F
A[122]N/G[124]S/
A39S/Q143R/
M156Q/H224F
2.71
118%
V158D/Q286R7 E296V/M298Q/ H373F
V21D/Q143R/
E154V/M156Q/
H224F
1.89
82%
Пример 15. Активация FX и определение концентрации каталитически активных протеаз с использованием титранта активных сайтов флуоресцеин-моно-р'-гуанидинобензоата (FMGB).
Концентрацию фактора X (FX), который способен стать каталитически активным, определяли в исходном растворе зимогена путем активации образцов FX ядом гадюки Рассела (RVV-азой), а затем путем титрования активного фактора X (FXa) флуоресцеин-моно-р'-гуанидинобензоатом (FMGB), флуороген-ным эфирным субстратом, титрантом активных сайтов для трипсиноподобных сериновых протеаз. После активации титрование активных сайтов было проведено, как описано в работе Воск и др., (Archives of Biochemistry and Biophysics (1989) 273:375-388) с небольшими изменениями. FMGB легко реагирует с FXa, но не с FX или неактивной протеазой, с образованием стабильного ацил-ферментного интермедиата при насыщающей концентрации FMGB и медленном деацилировании, что ограничивает скорость катализа. В этих условиях протеаза FXa осуществляет один оборот катализа, высвобождая флуоресцеиновый флуорофор. Если первоначальный подъем флуоресценции сопоставить со стандартной кривой зависимо
сти флуоресценции от концентрации флуоресцеина, может быть рассчитана концентрация активных центров.
Реакцию активации FXa проводили при конечной концентрации FX 10 мкМ (по абсорбции А280 с коэффициентом экстинкции 1,16) в конечном объеме 50-100 мкл в реакционном буфере, содержащем 100 мМ Трис, 50 мМ NaCl, 5 мМ CaCl2, 0,1% ПЭГ 8000, рН 8,1. Активацию инициировали добавлением яда гадюки Рассела в конечной концентрации 5 мкг/мл (5 мкл 98 мкг/мл разведения на 100 мкл реакционной смеси или 2,5 мкл на 50 мкл реакционной смеси) при 37°С в течение 45-60 мин (необходимое для полной активации время ранее определили путем отбора образцов каждые 15 мин и тестирования увеличения расщепления флуорогенного субстрата Spectrafluor FXa). В реакционную смесь быстро добавили 1/10 объема буфера, содержащего 100 мМ Трис, 50 мМ NaCl, 5 мМ, 100 мМ ЭДТА, 0,1% ПЭГ 8000, рН 8,1.
Анализы проводили в реакционном объеме 1 мл в 0,4 см х 1 см кварцевой кювете при постоянном перемешивании. Реакционная смесь содержала 100-400 нМ свежеактивированного FXa и 5 мкМ FMGB в буфере, содержащем 30 мМ Hepes, 135 мМ NaCl, 1 мМ ЭДТА и 0,1% ПЭГ 8000, рН 7,4. Стандартный раствор флуоресцеина приготовили в исходной концентрации 70 мМ в ДМФА, значение концентрации подтверждали измерением абсорбции в стандартных условиях при 496 нм, используя коэффициент экс-тинкции 89125 М-1 см-1 в 0,1 н NaOH. FMGB приготовили в исходной концентрации 0,01М в ДМФА из сухого вещества, значение концентрации подтверждали измерением абсорбции в стандартных условиях при 452 нм, используя коэффициент экстинкции 19498 в фосфатно-солевом буфере (PBS), рН 7,2. Анализы начинали добавлением 5 мкл 1 мМ FMGB (конечная концентрация 5 мкМ) в 1 х буфере и измеряли фоновый гидролиз FMGB в течение ~150-200 с перед добавлением FXa в конечной концентрации 100400 нМ, начальную концентрацию определяли по поглощению до активации RVV-азой (см. выше). За флуоресценцией высвобожденного флуоресцеина в фазе резкого подъема флуоресценции в реакции следовала дополнительная фаза 3600 с. Стандартную кривую свободного флуоресцеина получали титрованием 1 х буфера стандартным флуоресцеином шагами по 20 нМ до конечной концентрации 260-300 нМ.
Для анализа данных полученные результаты импортировали в пакет программного обеспечения GraphPad Prism, вклад фонового гидролиза вычитали из кривой путем экстраполяции начальной скорости спонтанного гидролиза FMGB, которая, как правило, составляла менее 5% от общего всплеска флуоресценции. Исправленную кривую аппроксимировали одноэкспоненциальным уравнением с линейным компонентом (для описания медленного деацилирования) вида Дфлуоресценции = Amp(l-e-kt) + Bt, где Amp = амплитуда фазы всплеска флуоресценции в условиях насыщающего анализа, описанных выше, k представляет собой наблюдаемую константу скорости первого порядка образования ацил-фермента и В представляет собой общую константу скорости, связанную с полным превращением FMGB. Концентрацию активной протеазы FXa рассчитывали путем сравнения параметра аппроксимации для амплитуды со стандартной кривой флуоресцеина. Значения для нескольких анализов были измерены, усреднены и было определено стандартное отклонение. Поэтому количество активного FXa в пробе непосредственно представляет собой концентрацию FX в исходном растворе, который может быть активирован фактором FVIIa. Значение, полученное титрованием активных сайтов, использовали при расчете концентрации FX, который использовали в непрямом анализе, таком как ТФ-зависимый и ТФ-независимый анализ, описанный в примере 4.
Если изменения в изобретении очевидны специалистам в данной области, предполагается, что изобретение ограничено только приведенной ниже формулой изобретения.
ФОРМУЛА ИЗОБРЕТЕНИЯ
1. Модифицированный полипептид фактора VII (FVII), включающий модификации в полипептиде
FVII, где
модификации осуществляют в положениях, соответствующих положениям 286 и 298 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих положениях в полипептиде FVII,
модификация в положении 286 представляет собой замену аминокислоты на аргинин (Arg, R);
модификация в положении 298 представляет собой замену аминокислоты на глютамин (Gln, Q) и
модифицированный полипептид FVII обладает повышенной коагулянтной активностью по сравнению с полипептидом FVII, немодифицированным в положениях 286 и 298.
2. Модифицированный полипептид FVII по п.1, где модификация в положении 286 представляет собой замену Gln (Q) на Arg (R).
3. Модифицированный полипептид FVII по п.1, где модификация в положении 298 представляет собой замену Met (M) на глютамин (Gln, Q).
4. Модифицированный полипептид FVII по п.1, содержащий модификации Q286R и M298Q.
5. Модифицированный полипептид FVII по любому из пп.1-4, где немодифицированный полипептид FVII содержит последовательность аминокислот, приведенную в любой из SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353, или представляет собой ее аллельный или видовой вариант, или вариант, обладающий по меньшей мере 60% идентичностью с последовательностью FVII из любой последовательности
2.
SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353, или представляет собой активный фрагмент полипептида FVII, который включает последовательность аминокислот, приведенную в любой из последовательностей SEQ ID NO: 1-3, 18-74, 98, 158 или 343-353.
6. Модифицированный полипептид FVII по любому из пп.1-5, содержащий одну или несколько дополнительных модификаций в другом положении в полипептиде FVII.
7. Модифицированный полипептид FVII по п.6, где дополнительная модификация представляет собой замену аминокислоты в положении, соответствующем положению, выбранному из 51, 52, 54, 60, 66, 68, 109, 119, 122, 124, 130, 132, 158, 161, 175, 196, 197, 199, 202, 216, 222, 237, 239, 257, 286, 287, 290, 292, 294, 296, 305, 314, 318, 321, 337, 341, 366, 373, 374, 394, 395 и 396.
8. Модифицированный полипептид FVII по п.6, в котором дополнительная модификация аминокислоты выбрана из
D196K, D196R, D196A, D196Y, D196F, D196W, D196L, D196I, K197Y, К197А, К197Е, K197D, K197L, К197М, K197I, K197V, K197F, K197W, К199А, K199D, К199Е, G237W, G237T, G237I, G237V, Т239А, R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, К341Е, K341R, K341Q, K341N, К341М, K341D, G237T238BcraBicaA, G237T238BCTaBKaS, С237Т238вставкаУ, G237T238BCTaBKaAS, G237T238BCTaBKaSA, 0196К197вставкаК, D196К197BcraBKaR, 0196К197вставкаУ, D196K197BCTaBKaW, 0196К197вставкаА, 0196К197вставкаМ, К197П98вставкаЕ, К1971198вставкаУ, К197И98вставкаА, К197П98вставка8, T239S, T239N, T239Q, T239V, T239L, Т239Н, T239I, L287T, M298Q, Р321К, Р321Е, P321Y, P321S, Q366D, Q366E, Q366N, Q366T, Q366S, Q366V, Q366I, Q366L, Q366M, H373D, Н373Е, H373S, H373L, H373I, H373F, Н373А, K161S, К161А , K161V, H216S, Н216А, Н216К, H216R, S222A, S222K, S222V, S222N, S222E, S222D, Н257А, H257S, замена Gla из FIX, {замена Gla из FIX/E40L}, {замена Gla из FIX/K43I}, {замена Gla из FIX/Q44S}, {замена Gla из FIX/MI9К}, {замена Gla из FIX/M19K/E40L/K43I/Q44S}, замена Gla из FX, замена Gla из белка С, замена Gla из белка S, замена Gla из тромбина, S52A, S60A, E394N, Р395А, R396S, R202S, A292N, A294S, G318N, A175S, K109N, A122N, G124S, A51N, T130N, E132S, S52N, P54S, S119N, L121S, T128N, Р129А, Q66N, Y68S, S103S11 lyдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, Н115 S126yAaneHHe/BCTaBKaQRLMEDICLPRWGCLWEDDF, T128P134yдaлeниe/вcтaвкaQRLMEDICLPRWGCLWEDDF, SI 03 SI 11 удаление/BCTaBKaIEDICLPRWGCLWE, Н115 S126удаление /BCTaBKalEDICLPRWGCLWE, Т128Р134удаление/ BCTaBKalEDICLPRWGCLWE, SI 03 SI 11 удаление/ BCTaBKaDICLPRWGCLWED, H115 S126удаление/ BCTaBKaDICLPRWGCLWED,
Т128Р134удаление/BCTaBKaDICLPRWGCLWED, P406BCTaBKaIEDICLPRWGCLW, P406BCTaBKaGGGSIEDICLPRWGCLW, P406BCTaBKaDICLPRWGCLWED, P406BCTaBKaGGGSDICLPRWGCLWED, SI03SI 11 удаление/ BCTaBKaSFGRGDIRNV, H115S126удаление/ BCTaBKaSFGRGDIRNV, T127P134yдaлeниe/вcтaвкaSFGRGDIRNV, P406BCTaBKaCSFGRGDIRNVC, P406BCTaBKaGGGSCSFGRGDIRNVC, V158T, V158D, L287T и E296V.
9. Модифицированный полипептид FVII по любому из пп.6-8, включающий модификации, выбранные из
Q286R/M298Q/K341Q, Q286R/M298Q/K199Е, Q286R/M298Q/3aMeHa Gla из FIX, S222A/H257A/Q286R/M158Q, Q286R/M298Q/Q366D,
Q286R/M298Q/Q366N, Q286R/M298Q/H373F, {Замена Gla из FIX/E40L}/Q286R/M298Q, {Замена Gla из FIX/K43I}/Q286R/M298Q, {Замена Gla из FIX/Q44S}/Q286R/M298Q, {Замена Gla из FIX/M19K}/Q286R/M298Q, {Замена Gla из FIX/M19K/E40L/K43I/Q44S}/Q286R/M298Q, T128N/P129A/Q286R/M298Q, V158D/Q286R/E296V/M298Q, замена Gla из FIX/T128N/P129A7Q286R7M298Q, Tl28N/P129A/S222A/H257A7Q286R/M298Q, Tl28N/P129A/Q286R7M298Q/H373F, S52A/S60A/Q286R/M298Q, замена Gla из FIX/S52A/S60A/Q286R7M298Q, S52A/S60A/S222A/H257A/Q286R/M298Q, S52A/S60A/Q286R/M298Q/H373F, T239V/Q286R/M298Q, S222A/T239V/H257A/Q286R/M298Q, замена Gla из FIX/T239V/Q286R/M298Q, T239V/Q286R/M298Q/H373F, T239I/Q286R7M298Q, S222A/T239I/H257A/Q286R/M298Q, замена Gla из FIX/T239I/Q286R/M298Q, T239I/Q286R/M298Q/H373F, замена Gla из FIX/S222A/Q286R/M298Q, замена Gla из FIX/S222A/Q286R7M298Q/H373F, VI58D/Q286R/E296V/M298Q/H373F, H257A/Q286R/M298Q, H257S/Q286R/M298Q, S222A/H257S/Q286R/M298Q, H257S/Q286R/M298Q/H373F, S222A/Q286R/M298Q/H373F, S222A/Q286R/M298Q, T128N/P129A/A175S/Q286R/M298Q, A122N/G124S/A175S/Q286R/M298Q, Tl 28N/P129А/А175S/S222A/H257A/Q286R/M298Q, A122N/G124S/A175S/S222A/H257A/Q286R/M298Q,
T128N/P129A/A175S/Q286R7M298Q/H373F, A122N/G124S/A175S/Q286R7M298Q/H373F, {Замена Gla из FIX /K43I}/T128N/P129A/Q286R/M298Q,
T128N/P129A/Q286R7M298Q/Q366N, {замена Gla из FIX /K43I}/Q286R7M298Q/Q366N, {замена Gla из FIX /K43I}/T128N/P129A/Q286R/M298Q/Q366N, V158D/Q286R/E296V/M298Q, T128N/P129A/Q286R7M298Q/Q366N/H373F, T239V/Q286R7M298Q/Q366N, T239I/Q286R/M298Q/Q366N,
T128N/P129A/T239V/Q286R/M298Q,T128N/P129A/S222A/T239V/H257A/Q286RyivI298Q, T128N/P129A/T239V/Q286R/M298Q/H373F, T128N/P129A/T239I/Q286R/M298Q и T128N/P129A/T239I/Q286R7M298Q/H373F.
10. Модифицированный полипептид FVII по любому из пп.6-11, включающий модификации, выбранные из
T128N/P129A/Q286R/M298Q,
T239I/Q286R/M298Q/Q366N, T239V/Q286R/M298Q/Q366N,
T128N/P129A/Q286R/M298Q/Q366N/H373F, V158D/Q286R/E296V/M298Q/H373F,
A122N/G124S/A175S/Q286R/M298Q/H373F,
T128N/P129A/A175S/Q286R/M298Q/H373F,
A122N/G124S/A175S/S222A/H257A/Q286R/M298Q,
T128N/P129A/A175S/S222A/H257A/Q286R/M298Q,
A122N/G124S/A175S/Q286R/M298Q,T128N/P129A/A175S/Q286R/M298Q, H257A/Q286R/M298Q, замена Gla из FIX/S222A/Q286R/M298Q, S222A/Q286R/M298Q, замена Gla из FIX/ S222A/Q286R/M298Q/H373F, S222A/Q286R/M298Q/H373F, S222A/H257S/Q286R/M298Q, T239I/Q286R/M298Q/H373F, S222A/T239I/H257A/Q286R/M298Q, T128N/P129A/T239I/Q286R/M298Q, замена Gla из FIX /T239I/Q286R/M298Q, T239I/Q286R/M298Q, Q286R/M298Q, Т128N/P129 A/S222A/T239V/H257A/Q286R/M298Q,
S222A/T239V/H257A/Q286R/M298Q,T128N/P129A/T239V/Q286R/M298Q, замена Gla из FIX/T239V/Q286R/M298Q, V158D/Q286R/E296V/M298Q, Tl28N/P129A/Q286R/M298Q/H373F, Q286R/M298Q/H373F, {замена Gla из FIX K[43]I}/T128N/P129A/Q286R/M298Q/Q366N, {замена Gla из FIX K[43]I}/Q286R/M298Q/Q366N, Q286R/M298Q/Q366N, S52A/S60A/S222A/H257A/Q28R/M2986Q,
T128N/P129A/S222A/H257A/Q286R/M2986Q, S222A/H257A/Q286R/M298Q, {замена Gla из FIX/K[43]I}/T128N/P129A/Q286R/M298Q,
замена Gla из FIX/S52A/S60A/Q286R/M298Q, S52A/S60A/Q286R/M298Q, {замена Gla из FIX/M[19]K}/Q286R/M298Q, {замена Gla из FIX/Q[44]S}/Q286R/M298Q, {замена Gla из FIX/K[43]I}/Q286R/M298Q, {замена Gla из FIX/E[40]L}/Q286R/M298Q,
замена Gla из FIX/T128N/P129A/Q286R/M298Q и Q143R/M286Q/3aMeHa Gla из FIX.
11. Модифицированный двухцепочечный активированный полипептид фактора VII (FVIIa), включающий аминокислотные замены, соответствующие положениям 128, 129, 286 и 289 в SEQ ID NO: 3, где
аминокислота в положении 128 заменена на аспарагин (N), аминокислота в положении 129 заменена на аланин (А), аминокислота в положении 286 заменена на аргинин (R) и аминокислота в положении 298 заменена на глутамин (Q),
модифицированный полипептид FVIIa включает аминокислотную последовательность, по крайней мере на 85 или 90% идентичную последовательности полипептида, приведенной в SEQ ID NO:3; и
модифицированный полипептид FVIIa обладает прокоагулянтной активностью.
12. Модифицированный полипептид фактора VII (FVII), состоящий из аминокислотной последовательности, приведенной в SEQ ID NO: 280.
13. Модифицированный двухцепочечный активированный полипептид фактора VII (FVIIa), состоящий из аминокислотной последовательности, приведенной в SEQ ID NO: 280, расщепленной между аргинином в положении 152 и изолейцином в положении 153.
14. Модифицированный полипептид FVIIa по п.11, где полипептид включает аминокислотную последовательность, по крайней мере на 95% идентичную последовательности полипептида, приведенной в SEQ ID NO:3.
15. Активированный модифицированный полипептид фактора VII (FVIIa) по п.11, в котором аминокислотная последовательность легкой цепи модифицированного FVIIa по крайней мере на 95% идентична аминокислотной последовательности на участке 1-152 последовательности, приведенной в SEQ ID NO:280, и включает аминокислотные замены в положениях 128 и 129.
16. Активированный модифицированный полипептид фактора VII (FVIIa) по п.11, в котором аминокислотная последовательность тяжелой цепи модифицированного FVIIa по крайней мере на 95% идентична аминокислотной последовательности на участке 153-406 последовательности, приведенной в SEQ ID NO:280, и включает аминокислотные замены в положениях 286 и 298.
17. Модифицированный полипептид фактора VII (FVII), в котором полипептид FVII включает только 1, 2, 3, 4, 5, 6 или 7 замен аминокислот в полипептиде FVII дикого типа, имеющем аминокислотную последовательность, приведенную в SEQ ID NO: 3 или в его аллельном или видовом варианте, или в полипептиде с последовательностью, приведенной в SEQ ID NO: 3, содержащем гетерологичный Gla домен вместо Gla домена последовательности SEQ ID NO: 3;
одна замена аминокислоты находится в положении, соответствующем положению 286 в полипептиде FVII с аминокислотной последовательностью, приведенной в SEQ ID NO: 3, или в соответствую
щем положении в полипептиде FVII, и
замена в положении 286 представляет собой замену на аргинин (Arg, R), что приводит к модифицированному полипептиду FVII, обладающему повышенной коагулянтной активностью по сравнению с полипептидом FVII, немодифицированным в положении 286.
18. Модифицированный полипептид FVII по любому из пп.1-17, где немодифицированный полипептид FVII содержит последовательность аминокислот, приведенную в любой из SEQ ID NO: 1-3 или 18-74, или представляет собой его аллельный или видовой вариант, или представляет собой активный фрагмент полипептида FVII, включающий последовательность аминокислот, приведенную в любой из последовательностей SEQ ID NO: 1-3 или 18-74.
19. Модифицированный полипептид FVII по п.18, где модифицированный полипептид FVII представляет собой активный фрагмент, включающий замену аминокислоты в положении, соответствующем положению 286 в полипептиде FVII.
20. Модифицированный полипептид FVII по любому из пп.17-19, в котором замена аминокислоты, в дополнение к замене 286R, находится в положении, соответствующем положению, выбранному из 51, 52, 54, 60, 66, 68, 109, 119, 122, 124, 130, 132, 158, 161, 175, 196, 197, 199, 202, 216, 222, 237, 239, 257, 286, 287, 290, 292, 294, 296, 298, 305, 314, 318, 321, 337, 341, 366, 373, 374, 394, 395 и 396.
21. Модифицированный полипептид FVII по любому из пп.17-20, включающий замену аминокислот, выбранную из
D196K, D196R, D196A, D196Y, D196F, D196W,
D196L, D196I, K197Y, К197А, К197Е, K197D, K197L, К197М, K197I, K197V, K197F, K197W, К199А, K199D, К199Е, G237W, G237T, G237I, G237V, Т239А, R290A, R290E, R290D, R290N, R290Q, R290K, R290M, R290V, К341Е, K341R, K341Q, K341N, К341М, K341D, T239S, T239N, T239Q, T239V, T239L, Т239Н, T239I, L287T, M298Q, Р321К, Р321Е, P321Y, P321S, Q366D, Q366E, Q366N, Q366T, Q366S, Q366V, Q366I, Q366L, Q366M, H373D, Н373Е, H373S, H373L, H373I, H373F, Н373А, K161S, К161А, K161V, H216S, Н216А, Н216К, H216R, S222A, S222K, S222V, S222N, S222E, S222D, Н257А, H257S, S52A, S60A, E394N, Р395А, R396S, R202S, A292N, A294S, G318N, A175S, K109N, A122N, G124S, A51N, T130N, E132S, S52N, P54S, S119N, L121S, T128N, Р129А, Q66N, Y68S, V158T, V158D, L287T, E296V, М298К и M298Q.
22. Модифицированный полипептид FVII по п.21, включающий замены аминокислот, выбранные из
Q286R/H257A, Q286R/S222A, Q286R/S222A/H257A, Q286R/S222A/3aMeHa Gla из FIX, Q286R/H257А/замена Gla из FIX,
Q286R/S222A/H257А/замена Gla из FIX, Q286R/Q366V, Q286R/A292N/A294S/Q366V,
A175S/Q286R/Q366V, S222A/Q286R/Q366V, H257S/Q286R, H257S/Q286R/Q366V,
S222A/H257A/Q286R/Q366V, Q286R/H373A, S222A/H257A/Q286R/M158Q,
Q286R/K341D, Q286R/Q366D, Q286R/Q366N, Q286R/H373F, T128N/P129A/Q286R,
T128N/P129A/Q286R/H373F, S52A/S60A/Q286R, S52A/S60A/Q286R/H373F/,
T239V/Q286R, T239V/Q286R/H373F, T239I/Q286R/H373F,
V158D/Q286R/E296V/M298Q/H373F,T128N/P129A/A175S/Q286R,
A122N/G124S/A175S/Q286R,T128N/P129A/A175S/Q286R/M298Q/H373F.
23. Модифицированный полипептид FVII по любому из пп.1-10, включающий замены аминокислот,
выбранные из
T128N/P129A/Q286R/M298Q,
T239I/Q286R/M298Q/Q366N,T239V/Q286R/M298Q/Q366N,
T128N/P129A/Q286R/M298Q/Q366N/H373F, V158D/Q286R/E296V/M298Q/H373F,
A122N/G124S/A175S/Q286R/M298Q/H373F,
T128N/P129A/A175S/Q286R/M298Q/H373F,
A122N/G124S/A175S/S222A/H257A/Q286R/M298Q,
T128N/P129A/A175S/S222A/H257A/Q286R/M298Q,
А122N/G124S/A175S/Q286R/M298Q, Т128N/P129А/А175S/Q286R/M298Q,
H257A7Q286R/M298Q, S222A/Q286R/M298Q, S222A/Q286R/M298Q/H373F,
S222A/H257S/Q286R/M298Q, T239I/Q286R/M298Q/H373F,
S222A/T239I/H257A/Q286R/M298Q,T128N/P129A/T239I/Q286R/M298Q,
T239I/Q286R/M298Q,T128N/P129A/S222A/T239V/H257A/Q286R/M298Q,
S222A/T239V/H257A/Q286R/M298Q,T128N/P129A/T239V/Q286R/M298Q,
V158D/Q286R/E296V/M298Q,T128N/P129A/Q286R/M298Q/H373F,
Q286R/M298Q/H373F, Q286R/M298Q/Q366N,
S52A/S60A/S222A/H257A/Q28R/M2986Q,
T128N/P129A/S222A/H257A/Q286R/M2986Q, S22A/H257A/Q286R/M298Q.
24. Модифицированный полипептид FVII по любому из пп.1-23, включающий аминокислотную последовательность, приведенную в любой из SEQ ID NOS: 118, 131-141-155, 157, 274-282, 285-288, 290, 292-297, 299, 301-306, 308, 310-314, 316-318, 321-326, 328, 334-342, 355-358, 360 или 364-371.
25. Модифицированный полипептид FVII, включающий модификацию в полипептиде FVII, где модификация введена в положение, соответствующее положению, выбранному из 54, 66, 121, 122, 129 и 132 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII.
26. Модифицированный полипептид FVII по п.25, в котором модификация выбрана из P54S, Q66N, L121S, A122N, Р129А и E132S.
27. Модифицированный полипептид FVII, включающий модификацию в полипептиде FVII, где модификация соответствует модификации, выбранной из T239S, T239Q, T239V, T239L, Т239Н, T239I, Р321К, Р321Е, P321Y, P321S, Q366D, Q366N, Q366V, Q366I, Q366L, Q366M, H373D, Н373Е, H373S, H373F, Н373А, K161S, K161V, H216S, H216K, H216R, S222A, S222K, S222V, S222D, S222N, S222E и H247S в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или в соответствующих остатках в полипептиде FVII.
28. Модифицированный полипептид FVII, включающий две или более модификаций в полипептиде FVII, его аллельном или видовом варианте или его активном фрагменте, в котором две или более модификаций аминокислот выбраны из модификаций, соответствующих Н216А, Н257А, E394N, Р395А, R396S, K109N, A292N, A175S, Н257А и замене Gla из FIX.
29. Модифицированный полипептид FVII по любому из пп.1-28, который является активным или активированным.
30. Модифицированный полипептид FVII по любому из пп.1-29, включающий гетерологичный домен Gla или его часть, достаточную для осуществления связывания фосфолипидов.
31. Модифицированный полипептид FVII по п.30, в котором гетерологичный домен Gla выбран из домена Gla фактора IX (FIX), фактора X (FX), протромбина, белка С, белка S, остеокальцина, белка Gla матрикса, Growth-arrest-specific белка 6 (Gas6) и белка Z.
32. Модифицированный полипептид FVII по п.30 или 31, в котором гетерологичный домен Gla имеет последовательность аминокислот, приведенную в любой из SEQ ID NO: 83-91, 93 и 94, или ее часть, достаточную для осуществления связывания фосфолипидов.
33. Модифицированный полипептид FVII по любому из пп.30-32, в котором весь нативный домен Gla FVII или его непрерывную часть удаляли и заменяли гетерологичным доменом Gla, или его частью, достаточной для осуществления связывания фосфолипидов.
34. Модифицированный полипептид FVII по п.33, в котором нативный домен Gla FVII включает аминокислоты 1-45 в полипептиде FVII с последовательностью аминокислот, приведенной в SEQ ID NO: 3, или соответствующие остатки в полипептиде FVII.
35. Модифицированный полипептид FVII по пп.30-34, в котором гетерологичный домен Gla содержит модификации по сравнению с гетерологичным доменом Gla дикого типа.
36. Модифицированный полипептид FVII по п.32, в котором гетерологичный домен Gla представляет собой домен Gla FIX и модификация представляет собой замену аминокислоты в положении, соответствующем положению, выбранному из 19, 40, 43 и 44 домена Gla FIX, приведенного в SEQ ID NO: 83.
37. Модифицированный полипептид FVII по п.33, в котором модификация выбрана из M19K, E40L, K43I и Q44S.
24.
38. Модифицированный полипептид FVII по любому из пп.35-37, в котором гетерологичный домен Gla содержит дополнительные модификации.
39. Модифицированный полипептид FVII по п.38, в котором гетерологичный домен Gla представляет собой домен Gla FIX и дополнительная модификация представляет собой замену аминокислоты в положении, соответствующем положению 19, 40, 43 и 44 домена Gla FIX, приведенного в SEQ ID NO:
83.
40. Модифицированный полипептид FVII по п.38 или 39, в котором дополнительная модификация выбрана из M19K, E40L, K43I и Q44S.
41. Модифицированный полипептид FVII по любому из пп.35-37, в котором модификация представляет собой M19K/E40L/K43I/Q44S.
42. Модифицированный полипептид FVII по любому из пп.30-41, включающий модификации, выбранные из
СШбЫ/замена Gla из FIX, Q286R/S222A/3aMeHa Gla из FIX, Q286R/H257A/3aMeHa Gla из FIX, Q286R/S222A/H257A/3aMeHa Gla из FIX, Q286R/M298Q/3aMeHa Gla из FIX, {замена Gla из FIX/E40L}/Q286R/M298Q, {замена Gla из FIX/K43I}/Q286R/M298Q, {замена Gla из FIX/Q44S}/Q286R/M298Q, {замена Gla из FIX/M19K}/Q286R/M298Q, {замена Gla из FIX/MI9K7E40L/K43I/Q44S}/Q286R/M298Q, замена Gla из FIX/T128N/P129A/S222A/Q286R, замена Gla из FIX/T128N/P129A/Q286R/M298Q, замена Gla из FIX/S52A/S60A/S222A/Q286R,
замена Gla из FIX/S52A/S60A/Q286R/M298Q, замена Gla из FIX/S222A/T239V/Q286R, замена Gla из FIX/T239V/Q286R/M298Q, замена Gla из FIX/S222A/T239I/Q286R, замена Gla из FIX/T239I/Q286R/M298Q, замена Gla из FIX/S222A/Q286R/H373F, замена Gla из FIX/S222A/Q286R/M298Q, замена Gla FIX/S222A/Q286R/M298Q/H373F, замена Gla из FIX/S222A/H257S/Q286R, замена Gla из FIX/T128N/P129A/A175S/S222A/Q286R, замена Gla из FIX/A 122N/G124S/A175 S/S222A/Q286R, {замена Gla из FIX /K43I}/T128N/P129A/Q286R/M298Q, {замена Gla из FIX /K43I}/Q286R/M298Q/Q366N and {замена Gla из FIX /К431}/ T128N/P129A/Q286R/M298Q/Q366N.
43. Модифицированный полипептид FVII по пп.1-42, включающий одну или более дополнительных модификаций аминокислоты (аминокислот), которые повышают устойчивость к антитромбину-III, увеличивают связывание и/или аффинность к фосфолипидам, повышают аффинность к тканевому фактору, увеличивают собственную активность, увеличивают ТФ-зависимую активность, увеличивают коагулянт-ную активность, изменяют конформацию полипептида для изменения зимогенности, увеличивают каталитическую или коагулянтную активность, сдвигая равновесие между высокоактивной и менее активной конформацией FVIIa в пользу высокоактивных конформаций, повышают устойчивость к протеазам, уменьшают гликозилирование, увеличивают гликозилирование, снижают иммуногенность, повышают устойчивость и/или способствуют химическому связыванию групп.
44. Модифицированный полипептид FVII по пп.1-43, включающий одну или более дополнительных модификаций аминокислоты (аминокислот), выбранных из
43.
S279C/V302C, L280C/N301C, V281C/V302C, S282C/V299C, вставки тирозина в положение 4, F4S, F4T, P10Q, Р10Е, P10D, P10N, Q21N, R28F, R28E, I30C, I30D, I30E, K32D, K32Q, К32Е, K32G, К32Н, К32Т, К32С, К32А, K32S, D33C, D33F, D33E, D33K, А34С, А34Е, A34D, A34I, A34L, А34М, A34V, A34F, A34W, A34Y, R36D, R36E, Т37С, T37D, Т37Е, К38С, К38Е, К38Т, K38D, K38L, K38G, К38А, K38S, K38N, К38Н, L39E, L39Q, L39H, W41N, W41C, W41E, W41D, I42R, I42N, I42S, I42A, I42Q, I42N, I42S, I42A, I42Q, I42K, S43Q, S43N, Y44K, Y44C, Y44D, Y44E, S45C, S45D, S45E, D46C, A51N, S53N, G58N, G59S, G59T, К62Е, K62R, K62D, K62N, K62Q, К62Т, L65Q, L65S, L65N, F71D, F71Y, F71E, F71Q, F71N, P74S, Р74А, А75Е, A75D, Е77А, E82Q, E82N, E82S, Е82Т Т83К, N95S, N95T, G97S, G97T, Y101N, D104N, T106N, K109N, E116D, G117N, G124N, S126N, T128N, L141C, L141D, L141E, E142D, Е142С, К143С , K143D, К143Е, R144E, R144C, R144D, N145Y, N145G, N145F, N145M, N145S, N1451, N145L, N145T, N145V, N145P, N145K, N145H, N145Q, N145E, N145R, N145W, N145D, N145C, K157V, K157L , K157I, К157М, K157F, K157W, К157Р, K157G, K157S, К157Т, К157С, K157Y, K157N, К157Е, K157R, К157Н, K157D, K157Q, V158L, V158I, V158M, V158F, V158W, V158P, V158G, V158S, V158T , V158C, V158Y, V158N, V158E, V158R, V158K, V158H, V158D, V158Q, A175S, А175Т, G179N, I186S, I186T, V188N, R202S, R202T, I205S, I205T, D212N, E220N, I230N, P231N, P236N, G237N, Q250C, V253N, E265N, T267N, E270N, А274М, A274L, А274К, A274R, A274D, A274V, A274I, A274F, A274W, А274Р, A274G, А274Т, А274С, A274Y, A274N, А274Е, А274Н, A274S, A274Q, F275H, R277N, F278S, F278A. F278N, F278Q, F278G, L280N, L288K, L288C, L288D, D289C, D289K, L288E, R290C, R290G, R290A, R290S, R290T, R290K, R290D, R290E, G291E, G291D, G291C, G291N, G291K, А292С, А292К, A292D, А292Е, Т293К, E296V, E296L, E296I, Е296М, E296F, E296W, Е296Р, E296G, E296S, Е296Т, Е296С, E296Y, E296N, Е296К, E296R, Е296Н, E296D, E296Q, M298Q, M298V, M298L, M298I, M298F, M298W, М298Р, M298G, M298S, М298Т, М298С, M298Y, M298N, М298К, M298R, М298Н, М298Е, M298D, P303S, Р303Т, R304Y, R304F, R304L, R304M, R304G, R304T, R304A, R304S, R304N, L305V, L305Y, L305I, L305F, L305A, L305M, L305W, L305P, L305G, L305S, L305T, L305C, L305N, L305E, L305K,
L305R, L305H, L305D, L305Q, M306D, M306N, D309S, D309T, Q312N, Q313K, Q313D, Q313E, S314A, S314V, S3141, S314M, S314F, S314W, S314P, S314G, S314L, S314T, S314C, S314Y, S314N, S314E, S314K, S314R, S314H, S314D, S314Q, R315K, R315G, R315A, R315S, R315T, R315Q, R315C, R315D, R315E, K316D, K316C, K316E, V317C, V317K, V317D, V317E, G318N, N322Y, N322G, N322F, N322M, N322S, N3221, N322L, N322T, N322V, N322P, N322K, N322H, N322Q, N322E, N322R, N322W, N322C, G331N, Y332S, Y332A, Y332N, Y332Q, Y332G, D334G, D334E, D334A, D334V, D334I, D334M, D334F, D334W, D334P, D334L, D334T, D334C, D334Y, D334N, D334K, D334R, D334H, D334S, D334Q, S336G, S336E, S336A, S336V, S336I, S336M, S336F, S336W, S336P, S336L, S336T, S336C, S336Y, S336N, S336K, S336R, S336H, S336D, S336Q, K337L, K337V, K337I, K337M, K337F, K337W, K337P, K337G, K337S, K337T, K337C, K337Y, K337N, K337E, K337R, K337H, K337D, K337Q, K341E, K341Q, K341G, K341T, K341A, K341S, G342N, H348N, R353N, Y357N, I361N, F374P, F374A, F374V, F374I, F374L, F374M, F374W, F374G, F374S, F374T, F374C, F374Y, F374N, F374E, F374K, F374R, F374H, F374D, F374Q, V376N, R379N, L390C, L390K, L390D, L390E, M391D, M391C, M391K, M391N, M391E, R392C, R392D, R392E, S393D, S393C, S393K, S393E, E394K, P395K, E394C, P395D, P395C, P395E, R396K, R396C, R396D, R396E, P397D, P397K, P397C, P397E, G398K, G398C, G398D, G398E, V399C, V399D, V399K, V399E, L400K, L401K, L401C, L401D, L401E, R402D, R402C, R402K, R402E, A403K, A403C, A403D, A403E, P404E, P404D, P404C, P404K, F405K, P406C, K32N/A34S, K32N/A34T, F31N/D33S, F31N/D33T, I30N/K32S, I30N/K32T, A34N/R36S, A34N/R36T, K38N/F40S, K38N/F40T, T37N/L39S, T37N/L39T, R36N / K38S, R36N/K38T, L39N/W41S, L39N/W41T, F40N/I42S, F40N/I42T, I42N/Y44S, I42N/Y44T, Y44N/D46S, Y44N/D46T, D46N/D48S, D46N/D48T, G47N/Q49S, G47N/Q49T, K143N / N145S, K143N / N145T, E142N/R144S, E142N/R144T, L141N/K143S, L141N/K143T, I140N / E142S, I140N/E142T, R144N/A146S, R144N/A146T, A146N/K148S, A146N/K148T, S147N/P149S/, S147N/P149T, R290N/A292S, R290N/A292T, D289N/G291S, D289N/G291T, L288N / R290S, L288N/R290T, L287N/D289S, L287N/D289T, A292N/A294S, A292N/A294T, T293N/L295S, T293N/L295T, R315N/V317S, R315N/V317T, S314N/K316S, S314N/K316T, Q313N/R315S, Q313N/R315T, K316N/G318S, K316N/G318T, V317N/D319S, V317N/D319T, K341N/D343S, K341N/D343T, S339N/K341S, S339N/K341T, D343N/G345S, D343N/G345T, R392N/E394S, R392N / E394T, L390N/R392S, L390N/R392T, K389N/M391S, K389N/M391T, S393N/P395S, S393N/P395T, E394N/R396S, E394N/R396T, P395N/P397S, P395N/P397T, R396N/G398S, R396N/G398T, P397N/V399S, P397N/V399T, G398N/L400S, G398N/L400T, V399N/L401S, V399N/L401T, L400N/R402S, L400N/R402T, L401N/A403S,
L401N/A403T, R402N/P404S, R402N/P404T, A403N/F405S, A403N/F405T, P404N/P406S и
P404N/P406T.
45. Модифицированный полипептид FVII по пп.1-44, где немодифицированный полипептид FVII имеет последовательность аминокислот, приведенную в SEQ ID NO: 3, или представляет собой аллель-ный или видовой вариант полипептида, приведенного в SEQ ID NO: 3.
46. Модифицированный полипептид FVII по любому из пп.1-45, который представляет собой зрелый полипептид.
47. Модифицированный полипептид FVII по любому из пп.1-46, который представляет собой одно-цепочечный полипептид или двухцепочечный полипептид.
48. Модифицированный полипептид FVII по любому из пп.1-47, который включает пост-
трансляционные модификации.
49. Модифицированный полипептид FVII по п.48, в котором пост-трансляционные модификации включают гликозилирование.
50. Модифицированный полипептид FVII по любому из пп.1-49, который является двухцепочечным активированным полипептидом FVIIa.
51. Молекула нуклеиновой кислоты, включающая последовательность нуклеотидов, кодирующую
49.
модифицированный полипептид FVII по любому из пп.1-50.
в фармацевтически приемлемом в фармацевтически приемлемом
52. Вектор, содержащий молекулу нуклеиновой кислоты по п.51.
53. Клетка, включающая вектор по п.52.
54. Фармацевтическая композиция, включающая терапевтически эффективную концентрацию или количество модифицированного полипептида FVII по любому из пп.1-50 в фармацевтически приемлемом носителе.
55. Фармацевтическая композиция, включающая молекулу нуклеиновой кислоты по п.51 в фармацевтически приемлемом носителе.
56. Фармацевтическая композиция, включающая вектор по п.52 носителе.
57. Фармацевтическая композиция, включающая клетку по п.53 носителе.
58. Фармацевтическая композиция по любому из пп.54-57, разработанная для введения одной дозой.
59. Фармацевтическая композиция по любому из пп.54-58, разработанная для введения способом, выбранным из перорального, назального, легочного, буккального, трансдермального, подкожного, ин-традуоденального, энтерального, парентерального, внутривенного или внутримышечного способов введения.
60. Фармацевтическая композиция по любому из пп.54-59, являющаяся лиофилизированной.
61. Способ лечения субъекта, включающий введение субъекту фармацевтической композиции по любому из пп.54-60, где
субъект страдает от заболевания или состояния, которое поддается лечению введением FVII или прокоагулянта, и
заболевание или состояние, подвергающееся лечению, выбрано из нарушений свертывания крови, гематологических нарушений, геморрагических нарушений, гемофилий, дефицита фактора VII, нарушений, связанных с кровотечениями, хирургического кровотечения или кровотечения в результате травмы.
62. Применение модифицированного полипептида FVII по любому из пп.1-50, для лечения заболевания или состояния, выбранного из нарушений свертывания крови, гематологических нарушений, геморрагических нарушений, гемофилий, дефицита фактора VII, нарушений, связанных с кровотечениями, хирургического кровотечения или кровотечения в результате травмы.
63. Применение по п.62, где заболевание или состояние является гемофилией, причем гемофилия представляет собой гемофилию А, или гемофилию В, или гемофилию С.
62.
62.
62.
62.
Перечень последовательностей
<110> Каталист Биосайенсиз, Инк. Эдвин МЭДИСОН Кристофер ТСЭНОС
<120> МОДИФИЦИРОВАННЫЕ ПОЛИПЕПТИДЫ ФАКТОРА VII И ИХ ПРИМЕНЕНИЕ
<130> 3800003.00101 (4919РС)
<140> Неизвестно
<141> подано в данной заявке
<150> 61/124,021 <151> 2008-04-11
<160> 371
<170> FastSEQ для Windows версии 4.0
<210> 1
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> Изоформа предшественника фактора VII А <400> 1
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu lie Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp lie Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 2 <211> 444 <212> белок <213> Homo sapiens
<220>
<223> Изоформа предшестве <400> 2
Met Val Ser Gin Ala Leu Arg Leu
1 5 Gly Cys Leu Ala Ala Val Phe Val 20
Leu His Arg Arg Arg Arg Ala Asn
35 40 Gly Ser Leu Glu Arg Glu Cys Lys
50 55 Ala Arg Glu He Phe Lys Asp Ala 65 70 Ser Tyr Ser Asp Gly Asp Gin Cys 85
Gly Ser Cys Lys Asp Gin Leu Gin 100
Ala Phe Glu Gly Arg Asn Cys Glu 115 120 Cys Val Asn Glu Asn Gly Gly Cys
130 135 Gly Thr Lys Arg Ser Cys Arg Cys 145 150
фактора VII E
Leu Cys Leu 10
Thr Gin Glu 25
Ala Phe Leu
Glu Glu Gin
Glu Arg Thr 75
Ala Ser Ser 90
Ser Tyr He 105
Thr His Lys
His Glu Gly 155
Leu Leu
Glu Ala
Glu Glu
45 Cys Ser 60
Lys Leu Pro Cys Cys Phe
Gly Leu Gin 15
His Gly Val 30
Leu Arg Pro
Phe Glu Glu
Phe Trp He 80
Gin Asn Gly 95
Cys Leu Pro 110
Gin Leu He
Asp Asp 125
Cys Ser Asp His Thr 140
Tyr Ser Leu Leu Ala 160
Ser Cys 165 Glu Lys 180
Val Cys
Ala Val 245 Ser Arg 260
Thr Thr Leu Thr Glu Arg
Asp Gly val Pro He Leu
Asp Glu Gin
Val Pro Gly 275
Pro Val Val
290 Thr Phe Ser 305
Gly Trp Gly
Gin Leu 325
Arg Lys Val 355
Gly Tyr Ser j 370
Pro His Ala ' 385
Ser Trp Gly <
Val Leu Asn Val Pro 340
Gly Asp
¦ Asp Gly . Thr His
¦ Gin Gly
405
Arg Val Ser Gin Tyr 420
Pro Arg Pro Gly Val 435
Thr Pro Thr Val
Arg Asn Ala Ser 185
Pro Lys Gly Glu 200
Cys Gly
: Cys Phe
Arg Val
Asn His
Asp His 295 Thr Leu 310
Leu Asp Arg Leu Ser Pro
• Glu His
Ala Gin 265 Asp lie 280
Val Val
Ala Phe
Arg Gly
Ser Lys 375 Tyr Arg 390
Cys Ala
Met Thr 345 Asn He 360
Asp Ser
Val Arg 315 Ala Thr
330
Gin Asp
Phe Ser
Ala Leu
Cys Leu
Tyr Met 365 Gly Asp 380
Leu Thr Phe Gly Leu Met Pro
Leu Val Ser 320
Glu Leu Met
335 Gin Gin Ser 350
Phe Cys Ala
Ser
Gly
Gly
Gly
Val
400
Val
Tyr
Thr
415
Arg
Ser
Glu
<210> 3
<211> 406
<212> белок
<213> Homo sapiens
<220>
<223> Зрелый фактор VII A <400> 3
Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu
Cys Lys Glu Glu Gin ( 20
Asp Ala Glu Arg Thr :
Gin Cys Ala Ser Ser ! 50
Leu Gin Ser Tyr He ( 65
Cys Glu Thr His Lys : 85
Gly Cys Glu Gin Tyr <
100
Glu
Ala
Arg
Glu
Phe
Lys
Ser
Tyr
Ser
Asp
Gly
Asp
Gly
Gly
Ser
Cys
Lys
Asp
Gin
Pro
Ala
Phe
Glu
Gly
Arg
Asn
Cys
Val
Asn
Glu
Asn
Gly
Thr
Gly
Thr
Lys
Arg
Ser
Cys
Arg
Cys
His
Glu
Gly
Tyr
Ser
Leu
Leu
Ala
Asp
Gly
Val
Ser
Cys
Thr
115
120
125
Pro
Thr
Val
Glu
Tyr
Pro
Cys
Gly
Lys
Pro
Leu
Glu
Lys
Arg
130
135
140
Asn
Ala
Ser
Lys
Pro
Gin
Gly
Arg
Val
Gly
Gly
Lys
Val
Cys
Pro
145
150
155
160
Lys
Gly
Glu
Cys
Pro
Trp
Gin
Val
Leu
Leu
Leu
Val
Asn
Gly
Ala
Gin
165
170
175
Leu
Cys
Gly
Gly
Thr
Leu
Asn
Thr
Trp
Val
Val
Ser
Ala
Ala
180
185
190
His
Cys
Phe
Asp
Lys
Lys
Asn
Trp
Arg
Asn
Leu
Ala
Val
Leu
195
200
205
Gly
Glu
His
Asp
Leu
Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
210
215
220
Val
Ala
Gin
Val
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
225
230
235
240
His
Asp
Ala
Leu
Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
245
250
255
His
Val
Val
Pro
Leu
Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
260
265
270
Leu
Ala
Phe
Val
Arg
Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly
Gin
Leu
Leu
275
280
285
Asp
Arg
Gly Ala
Thr
Ala
Leu
Glu
Leu
Met
Val
Leu
Asn
Val
Pro
Arg
290
295
300
Leu
Met
Thr
Gin
Asp
Cys
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly
Asp
Ser
305
310
315
320
Pro
Asn
Thr
Glu
Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
325
330
335
Lys
Asp
Ser
Cys
Lys
Gly
Asp
Ser
Gly
Gly
Pro
His
Ala
Thr
His
Tyr
340
345
350
Arg
Gly
Thr
Trp
Tyr
Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly
Cys
355
360
365
Ala
Thr
Val
Gly
His
Phe
Gly Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
370
375
380
Glu
Trp
Leu
Gin
Lys
Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro
Gly
Val
Leu
385
390
395
400
Leu
Arg
Ala
Pro
Phe
Pro
<210> 4
<211> 447
<212> белок
<213> Bos taurus
<220>
<223> Предшестве
с фактора VII
<400> 4
Met Leu Ser Gin
Ala
Trp Ala Leu
Ala
Leu
Leu
Cys
Phe
Leu
Leu
Ser
Leu Trp Gly Ser
Leu
Pro Ala Val
Phe
Leu
Pro
Gin
Glu
Gin
Ala
Leu
Ser He Leu His
Arg
Pro Arg Arg
Ala
Asn
Gly
Phe
Leu
Glu
Glu
Leu
Leu Pro Gly Ser
Leu
Glu Arg Glu
Cys
Arg
Glu
Glu
Leu
Cys
Ser
Phe
Glu Glu Ala His
Glu
He Phe Arg
Asn
Glu
Glu
Arg
Thr
Arg
Gin
Phe
Trp Val Ser Tyr
Asn
Asp Gly Asp
Gin
Cys
Ala
Ser
Ser
Pro
Cys
Gin
Met Leu 210 Pro Ala 225
Arg Gly
Glu Gly
Gin Tyr
Ala Gin 290 Asp Pro 305
Val Ser
Leu Met
Gin Ser
Cys Ala 370 Gly Gly 385
Val Val Tyr Thr His Pro
Asn Gly Ala 215
Val Ser Ala
230 Thr Ala Val 245
Gin Glu Arg
Gly Gin Thr
Ala Leu Gly 295
Ala Asp Gin
310 Gly Gin Leu 325
Leu Val Pro
Ser Asp Gly 375
Ala Thr Arg
390 Gly Glu Gly 405
Ser Arg Tyr Arg Gin Gly
Gin Leu 105 Asn Cys 120
Gly Gly Cys Trp Ala Pro
Ala His
Leu Gly
Arg Val 265 Asp His 280
Asp His
Thr Leu
Leu Glu
Arg Leu 345 Gly Pro 360
Ser Lys
Phe Arg
Cys Ala
Thr Ala 425 Phe Phe
Cys Gly Gly 220
Cys Phe Glu
235 Glu His Asp 250
Ala Gin He
Asp Val Ala
Val Ala Pro 300
Ala Phe Val 315
Arg Gly Val 330
Leu Thr Gin
Val Val Thr
Asp Ala Cys 380
Gly Thr Trp 395
Ala Ala Gly 410
Trp Leu Arg
He Val 270 Leu Leu 285
Leu Cys
Arg Phe
Thr Ala .
Asp Cys 350 Asp Asn : 365
Lys Gly J
<210> 5
<211> 446
<212> белок
<213> Mus musculus
<220>
<223> Предшественник фактора VII <400> 5
Gin Glu
30 Leu Leu 45
Met Val Pro Gin Ala His Gly Leu Leu Leu Leu Cys
15 10 Leu Gin Gly Pro Leu Gly Thr Ala Val Phe He Thr
20 25 His Gly Val Leu His Arg Gin Arg Arg Ala Asn Ser 35 40
Leu Trp Pro Gly Ser Leu Glu Arg Glu Cys Asn Glu
Pro Glu . 75 Cys Ala
Lys Gin
80 Pro Cys
Phe Glu Glu Ala Arg Glu He Phe Lys Ser
65 70
Phe Trp He Val Tyr Ser Asp Gly Asp Gin
85 90
Glu Gin Cys
Arg Thr
Ser Asn
Lys Ser Tyr Val Cys Phe 110
Cys Asp 140 Cys His 155
Lys Val
Glu Lys Ser Lys Asn Glu 125
Tyr Thr 160 Pro Cys 175
Gin Gly
Ser Arg 190 Cys Pro 205
Ala Val
Gin Tyr Cys Arg Glu Asp Glu Tyr
. Cys Gly 220 Cys Phe 235
Glu His
Thr Gin
Asp He
Val Val 300 Ala Arg 315 i Arg Gly
Met Thr
Lys He
Asp Ala 380 Gly Thr 395
Ala He Trp Leu Leu Pro
Ser Ser Gly Glu i
Asp Asn
Asp Phe
Val He 1
270 Ala Leu 285
Pro Leu
He Arg
Ala Thr .
Gin Asp (
350 Thr Glu . 365
Cys Lys
Trp Tyr
Gly His
Val Arg 430 Leu Leu 445
<210> 6
<211> 466
<212> белок
<213> Pan paniscus
<220>
<223> Предшественник фактора VII
<221> неопределенный <222> 228, 231
<223> Хаа может быть любой аминокислотой <400> б
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Glu Ala Ser Gly Gly
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe He
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn .
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Leu
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys .
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys
165 170
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Asn Arg Asn Ala
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly i
210 215 220
Pro Trp Gin Xaa Leu Leu Xaa Val Asn Gly Ala Gin Leu Cys i
225 230 235
Thr Leu lie Asn Thr He Trp Val Ala Ser Ala Ala His Cys
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu :
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala i
275 280 285
He He Pro Ser Thr Tyr He Pro Gly Thr Thr Asn His Asp
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val '
305 310 315
Leu Cys Leu Pro Glu Arg Ala Phe Ser Glu Arg Thr Leu Ala
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg '
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly
405 410
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Ser
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala
450 455 460
Phe Pro 465
<210> 7
<211> 466
<212> белок
<213> Pan troglodytes
<220>
<223> Предшественник фактора VII <220>
<221> неопределенный <222> 35, 36
<223> Xaa может быть любой аминокисл <400> 7
Met Val Ser Gin Ala Leu Arg Leu Leu
1 5 Gly Cys Leu Ala Ala Gly Gly Val Ala
20 25 Arg Asp Xaa Xaa Trp Lys Pro Gly Pro
35 40 Glu Glu Ala His Gly Val Leu His Arg
50 55 Leu Glu Glu Leu Arg Pro Gly Ser Leu 65 70 Gin Cys Ser Phe Glu Glu Ala Arg Glu 85
Thr Lys Leu Phe Trp He Ser Tyr Ser 100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu
130 135 Lys Asp Asp Gin Leu He Cys Val Asn 145 150 Tyr Cys Ser Asp His Thr Gly Thr Lys 165
Gly Tyr Ser Leu Leu Ala Asp Gly Val 180 185 Tyr Pro Cys Gly Lys He Pro He Leu
195 200 Pro Gin Gly Arg He Val Gly Gly Lys
210 215 Pro Trp Gin Val Leu Leu Leu Val Asn 225 230 Thr Leu He Asn Thr He Trp Val Val 245
Lys He Lys Asn Trp Arg Asn Leu He 260 265 Leu Ser Glu His Asp Gly Asp Glu Gin
275 280 He He Pro Ser Thr Tyr He Pro Gly
290 295 Leu Leu Arg Leu His Gin Pro Val Val 305 310 Leu Cys Leu Pro Glu Arg Ala Phe Ser
Leu Leu
Ser Gly
Val Phe 45
Arg Ala 60
Glu Cys Lys Asp Asp Gin
Cys Leu 10
Glu Ala
His Arg
Arg Arg
Glu Arg
75 He Phe 90
Asp Gly
Lys Asp
Gly Arg
Glu Asn 155 Arg Ser 170
Ser Cys
Glu Lys
Val Cys
Gly Ala 235 Ser Ala 250
Ala Val Ser Arg Thr Thr
Gly Leu Gin 15
Gly Glu Thr 30
He Thr Gin
Asn Ala Phe
Lys Glu Glu 80
Leu Glu Arg 95
Cys Ala Ser 110
Gin Ser Tyr
Gin Leu i 125
Cys Arg Thr Pro
Asn Cys Glu Thr Tyr 140
Gly Gly i
Cys Glu Gin 160
Cys His Glu 175
Thr Val Glu 190
Ala Ser Lys
Arg Asn 205
Ala His Leu Gly
Pro Lys Gly Glu Cys 220
Gin Leu
Cys Gly Gly 240
Cys Phe Asp
255 Glu His Asp 270
Ala Gin Val
Arg Val 285
Val Val Pro 320
Ala Phe Val
Asn His Asp He Ala 300
Asp His
Leu Thr 315
Glu Arg Thr Leu
Ser Leu 340 Leu Glu 355
Leu Gin
¦ Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg 325
Val Ser
Leu Met
Gin Ser
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Gly Trp
Val Leu 360 Arg Lys 375
Gly Tyr
Pro His
Ser Trp
Arg Val 440 Pro Arg 455
330 Gly Gin 345
Asn Val
Val Gly
Ser Asp
Ala Thr 410 Gly Gin 425
Ser Gin Pro Gly
Leu Leu
Pro Arg
Asp Ser 380 Gly Ser 395
His Tyr
Gly Cys
Tyr He
Val Leu 460
Asp Arg 350 Leu Met 365
Pro Asn
Lys Asp
Arg Gly
Ala Ser 430 Glu Trp 445
Leu Arg
335
Gly Ala
Thr Gin
He Thr
Ser Cys 400 Thr Trp 415
Val Gly Leu Gin Ala Pro
<210> 8 <211> 444 <212> белок
<213> Oryctolagus cuniculus <220>
<223> Предшественник фактора VII <400> 8
Met Ala Pro Gin Ala Arg Gly Leu Gly
1 5 Gin Ala Ser Leu Ala Ala Val Phe He
20 25 Val Leu Arg Arg Gin Arg Arg Ala Asn
Pro Gly Ser Leu Glu Arg Glu Cys Lys
50 55 Glu Ala Arg Glu Val Phe Gin Ser Thr 65 70 He Thr Tyr Asn Asp Gly Asp Gin Cys 85
Gly Gly Ser Cys Glu Asp Gin He Gin 100 105 Ala Asp Phe Glu Gly Arg Asn Cys Glu
115 120 He Cys Met Tyr Glu Asn Gly Gly Cys
130 135 Val Gly Ser Gin Arg Ser Cys Arg Cys 145 150 Pro Asn Gly Val Ser Cys Thr Pro Thr 165
Val Pro Ala Leu Glu Lys Arg Gly Ala 180 185 Val Gly Gly Lys Val Cys Pro Lys Gly
195 200 Leu Met Asn Gly Ser Thr Leu Leu Cys
210 215 His Trp Val Val Ser Ala Ala His Cys 225 230
Ala Leu 15
His Ser Leu Arg Phe Glu
Glu Ala 30
Glu Glu 45
Leu Cys Ser 10
Thr Gin Glu Ser Phe Leu Glu Glu Leu
Phe Trp
80 Gin Asn
Glu Arg Thr 75
Ala Ser Asn
Cys Ser
Lys Gin
Pro Cys 90 95 Ser Tyr He Cys Phe Cys Leu 110
Glu Gin Tyr 140
His Glu Gly 155
Val Asp Tyr 170
Ser Asn Pro
Lys Asn Lys Asn Asp Gin Leu 125
Leu Leu 160 Gly Lys 175
Arg He
Cys Ser Asp His
Tyr Th:
Pro Cys
Gin Gly 190
Gly Gly Ser 220
Phe Asp Lys 235
Glu Cys Pro Trp Gin Ala Ala 205
Ser Leu 240
Leu Leu Asp Thr Leu Ser
Gin Pro 290 Arg Asn 305
Ser Gly
Met Ala
Ser Glu
Ala Gly 370 Gly Pro 385
Val Ser Thr Arg Lys Leu
Glu Gin 260 Pro Gly 275
Ala Ala
Phe Ser
Trp Gly
He Asp 340 His Lys 355
Tyr Leu
His Ala
Trp Gly
Val Ser 420 His His 435
Leu Gly Glu
His Val Ala 265
Asp His Asp
280 Asn Asn Val 295
Thr Leu Ala
Leu Tyr Arg
Arg Leu Met 345
Ser Pro Glu
360 Ser Lys Asp 375
Tyr His Gly
He Val 245
Val Arg
Lys Thr
Leu Thr
Glu Ser 310 Gin Leu 325
Val Pro
Pro Gly
Asp Gly
Thr Ser 390
Glu Gly Cys Ala Ala 405
Arg Tyr Thr Glu Trp 425
Gly He Gin Arg His
His Asp 250
Gin Leu
He Ala
Val Pro
Thr He 315 Gly Ala 330
Thr Gin
Val Thr
Ala Cys
Thr Trp 395 Val Gly 410
Leu Ser
Leu Ser
He Met
Leu Leu 285 Leu Cys 300
Arg Phe
Leu Ala
Asp Cys
Gly Asn 365 Lys Gly 380
Tyr Leu
Glu His Glu
255 Pro Asp Lys 270
Arg Leu Leu
Leu Pro Glu
Ser Arg Val 320
Arg Glu Leu 335
Val Glu Gin 350
Met Phe Cys
Asp Ser Gly
Thr Gly Val 400
Gly Val Tyr 415
Met Arg Ser 430
<210> 9 <211> 446 <212> белок
<213> Rattus norvegicus <220>
<223> Предшественник фактора VII
<400> 9
Met
Val
Pro
Gin
Thr
His
Leu
Gin
Gly
Pro
Leu
Gly
His
Gly
Val
Leu
His
Arg
Leu
Trp
Ser
Ser
Ser
Leu
Phe
Glu
Glu
Ala
Arg
Glu
Phe
Trp
Thr
Tyr
Ser
: Leu Leu 10
. Phe He
¦ Ala Asn
L Cys Asn
: Ser Pro
i Gin Cys
Leu Lys
Cys Glu
Asp Cys
Ser Cys 155 Pro Lys
170
Asn Phe
Tyr Phe
Thr Gin
Ser Leu 45
Glu Glu 60
Glu Arg
Ala Ser
Ser Tyr
Lys Asn 125 Asp Gin 140
His Glu Val Glu Ser Arg
Leu Leu Gin 15
Glu Glu Ala 30
Leu Glu Glu
Arg Cys Ser
Thr Lys Gin 80
Asn Pro Cys 95
Val Cys Phe 110
Lys Asn Glu
Tyr Cys Arg
Asp Tyr Val 160
Tyr Pro Cys 175
Pro Gin Gly 190
Asn He 245 Thr Glu 260
Thr Arg Pro Val Ala Phe
Ser
Gly
Trp
325
Met
Val
340
Ala
Lys
His
355
Ala
Gly
Tyr
Gly
Pro
His
Ser Trp 405 Arg Val 420
Leu Arg
Lys 435
Asn Glu 215 Val Thr 230
Thr Val
Cys Pro 200
Ala Leu
Ala Ala
Val Leu
Arg Leu 265 Thr Asp 280
Thr Asp
Lys Gly
Leu Cys
Gin Val Gly Arg
His Cys 235 Gly Glu 250
Val Glu
Thr Phe 295 Ser Glu 310
Gly Gin
Leu Ala 315 Asp Arg 330
Leu Met
His Asp Tyr Val
Asn Thr
Leu Leu
Glu Val Pro Arg 345
Ser Ala Asn Thr Pro Arg 360
Ala Thr 390 Gly Glu
His Gly 395 Ala Ala 410
Asp Trp
. Tyr He 425
He Ser Arg Val
Met Asp Gly Thr Lys Asp His Tyr Gly Cys
440
Ser Gin Val Gly
Glu Cys 205 Gly Ala
220
Phe Asp His Asp Gin Val
Gly Ala
Thr Gin
He Thr 365 Ala Cys 380
Thr Trp He Gly Leu Val Ser Leu
Pro Trp Gin
Val Leu Leu
Lys Phe Gly 240
Phe Ser Glu
255 He Met Pro 270
Leu Val Arg
Arg Phe Ser 320
Thr Ala Leu 335
Asp Cys Leu 350
Glu Asn Met
Lys Gly Asp
Tyr Leu Thr 400
His He Gly
415 Lys Tyr Met 430 Leu
<210> 10
<211> 469
<212> белок
<213> Macaca mulatta
<220>
<223> Предшественник фактора VII <400> 10
Met Val Ser Arg Ala Leu Gly Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Ala Thr Phe Leu Pro Gin Ala Gly Ser Leu Arg
Pro Gin Glu Glu Lys Thr Gin Asp Leu Leu Trp Lys Pro Gly Pro His
35 40 45
Arg Val Phe Val Thr Gin Glu Glu Ala His Gly Val Leu His Arg Gin
50 55 60
Arg Arg Ala Asn Ser Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu
65 70 75 80
Arg Glu Cys Lys Glu Glu Gin Cys Ser Phe Glu Glu Ala Arg Glu He
Phe Lys Asp Leu Glu Arg Thr Lys Leu Phe Trp He Ser Tyr Ser Asp
100 105 110
Gly Asp Gin Cys Ala Ser Asn Pro Cys Gin Asn Gly Gly Ser Cys Lys
115 120 125
Asp Gin Leu Gin Ser Tyr He Cys Phe Cys Leu Pro Ser Phe Glu Gly
130 135 140
Arg Asn Tyr Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly
145 150 155 160
Cys Glu Gin Tyr Cys Ser Asp His Ala Gly Ala Lys Arg Ser Cys Trp
165 170 175
Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Met Pro
180 185 190
Thr Val Glu Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn
195 200 205
Ala Ser Lys Pro Gin Gly Arg He Val Gly Gly Arg Val Cys Pro Lys
210 215 220
Gly Glu Cys Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu
225 230 235 240
Cys Gly Gly Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His
245 250 255
Cys Phe Asp Lys He Lys Ser Trp Arg Asn Leu Thr Ala Val Leu Gly
260 265 270
Glu His Asp Leu Ser Glu His Glu Gly Asp Glu Gin Ser Arg Arg Val
275 280 285
Ala Gin Val He He Pro Ser Thr Tyr Val Leu Gly Ala Thr Asn His
290 295 300
Asp He Ala Leu Leu Arg Leu Gin Gin Pro Val Val Leu Thr Asp His
305 310 315 320
Val Val Pro Leu Cys Leu Pro Glu Arg Met Phe Ser Glu Arg Thr Leu
325 330 335
Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp
340 345 350
Arg Gly Ala Thr Ala Leu Glu Leu Met Ala Leu Asn Val Pro Arg Leu
355 360 365
Met Thr Gin Asp Cys Leu Gin Gin Ser Gin Lys Ala Glu Ala Ser Pro
370 375 380
Asn He Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Arg
385 390 395 400
Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr Arg Tyr Arg
405 410 415
Gly Thr Trp Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala
420 425 430
Ala Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu
435 440 445
Trp Leu Gin Lys Leu Met His Ser Glu Pro Arg Pro Gly Val Leu Leu
450 455 460
Arg Ala Pro Phe Pro 465
<210> 11
<211> 445
<212> белок
<213> Sus scrofa
<220>
<223> Предшественник фактора VII (изоформа В) <400> 11
Met Ala Ser Leu Arg Pro Ala Leu Leu Cys Leu Leu Leu Cys Leu Gin
Gly Ser Leu Ala Ala Val Phe Val Gly His Glu Glu Ala His Ser Leu
20 25 30
Leu His Arg Phe Arg Arg Ala Asn Ser Phe Leu Glu Glu Leu Trp Pro
35 40 45
Gly Ser Leu Glu Arg Glu Cys Arg Glu Glu Gin Cys Ser Phe Glu Glu
Lys Leu 210 Trp Val 225
Asp Leu
Asp Glu
Val Pro
Pro Val 290 Ser Phe 305
Gly Trp
Ala He
Arg Arg
Gly Tyr 370 Pro His 385
Ser Trp Arg Val Pro Pro
195
Ala Ala 230 Val Leu 245
Arg Pro
Thr Asp Thr Asp
Cys Pro Lys Gly Ala Leu Val Ser Thr Val
Gin Glu 260 Gly Lys 275
Arg Thr 310 Leu Leu 325
Pro Arg
Gin Val 340 Arg Pro 355
Leu Asp
Ala Leu Ser Glu Gly Arg
Ser Glu
Gin Cys
Leu Gin
Cys Glu 120 Gly Cys 135
Trp Cys
Pro Thr
Asn Asp
Lys Gly 200 Leu Cys 215
His Cys
Gly Glu
Val Ala
His Asp 280 His Val 295
Pro Ser 360 Lys Asp 375
Arg Gly
Leu Ala
Glu Arg
Ala Ser
90 Ala Tyr 105
Thr Asn
Glu Gin
His Glu
Val Glu 170 Ser Asn 185
Glu Cys
Gly Gly
Phe Asp
His Asp 250 Gin Val 265
Leu Ala
Val Pro
Phe He
Gly Ala 330 Thr Gin 345
He Thr Ala Cys Thr Trp
Leu Asn Gly 95
Cys Pro Glu 110
Gin Leu He
Thr Arg Gin Phe Trp Val 75
Asn Pro Cys He Cys Phe
Lys Lys Ser < 125
Tyr Cys Ser Asp His Ala 140
Gly Tyr Ala Leu Gin Glu 155 160 Tyr Pro Cys Gly Lys He 175
Pro Gin Gly Arg He Val 190
Pro Trp Gin Ala Met Leu 205
Thr Leu Leu Asn Thr Ser 220
Arg He Arg Ser Trp Lys 235 240 Leu Ser Lys Asp Glu Gly 255
Phe Val Pro Asp Lys Tyr 270
Leu Val Arg Leu Ala Arg 285
Leu Cys Leu Pro Glu Arg 300
Arg Phe Ser Ala Val Ser 315 320 Lys Ala Arg Val Leu Met 335
Asp Asn Met 365
Lys Gly Asp
380 Phe Leu Thr 395
Arg Phe Gly
Asp Cys Leu Glu Gin Ala 350
Phe Cys Ala
Ser Gly Gly
Gly Val Val 400
Val Tyr Thr
415 Ser Ala Pro 430
<210> 12 <211> 446 <212> белок
<213> Canis familiaris <220>
<223> Предшественник фактора VII <400> 12
Met Val Ala Trp Ala Gly Glu Leu Ala Leu Leu Cys Phe Leu Leu Gly
15 10 15
Pro Asp Asp 115
Leu He Cys 130
His Ala Glu 145
Gin Asp Asp
He Val Gly 195
Ala Val Lys
210 Ala Ala Trp 225
Trp Lys Asn
Lys Tyr He 275
Arg Thr Pro
290 Glu Lys Thr 305
Val Ser Gly
Gin Ser Arg 355
Cys Ala Gly
370 Gly Gly Pro 385
Val Val Ser
Tyr Thr Arg
Ser Ser His 435
Met Asn Ala Arg
Val Asp Val Val
Val Ala Phe Ser
Tyr Leu
His Ala
Trp Gly 405 Val Ser 420
Thr Leu
Ala Ala Val Phe Leu 25
Gin Arg Arg Ala Asn 40
Glu Arg Glu Cys Arg 55
Glu Asp Gly Arg
He Phe Gin Asp Val 70
Asp Gly
Asp Gin Cys 90
Gin Leu Gin 105
Asn Cys Glu 120
Gly Gly Cys
Glu Asn 135
Glu Lys Val Cys
Arg Ser Cys Trp Cys 150
Ser Cys
Met Pro He 170
Arg He Gly 185
Pro Lys Gly 200
Leu Leu Cys
Gly Lys
215
Glu Arg Lys Thr
Ser Ala Ala His Cys 230
Val Val
Leu Gly Glu 250
His Val Ala
265 Asn His Asp 280
Asp His Val
Tyr Thr 295
Val Pro Ser Gly
Glu Arg Thr Leu Ala 310
Gin Leu
Leu Asp Arg 330
Arg Val Met
Asp Gly 375 Thr Lys 390
Glu Gly
345 Ser Pro Ala 360
Ser Lys Asp
Thr Gin
Ser Phe
Glu Glu 60
Asp Arg 75
Ala Ser
Ser Tyr
Thr Asp
Gin Gin 140 His Glu 155
Val Glu
Ser Asn
Glu Cys
Gly Gly 220 Phe Glu 235
His Asp
Arg Val
He Ala
Val Pro 300 Phe He 315
Gly Ala
Thr Gin
He Thr
Ala Cys 380 Thr Trp 395
Glu Gly
Leu Glu i 45
Gin Cys
Thr Arg
Asn Pro '
He Cys 110 Lys Lys . 125
Tyr Cys
Gly Tyr
Tyr Pro
Pro Gin 190 Pro Trp 205
Thr Leu
Arg He
Leu Ser
He Val 270 Leu Leu 285
Leu Cys
Arg Phe
Thr Ala
Asp Cys 350 Glu Asn 365
Gin Leu 1
430 Leu Pro
Gin Gly ,
<210> 13 <211> 433 <212> белок
<213> Brachydanio rerio
<220>
<223> Предшественник фактора VII <400> 13
Met Ser Leu Leu Leu Val Phe Ser Val
1 5 His Ser Ala Ala Val Phe Val His Arg .
20 25 He Arg Ser Lys Arg Ala Asn Ser Gly
35 40 Gly Asn Leu Glu Arg Glu Cys Leu Glu
50 55 Ala Arg Glu Val Phe Glu His Thr Glu . 65 70 He Tyr Asp Val Lys Asp His Cys Ala
85 90 95
Gly Leu Cys Thr Thr Gin Asn Ala Asp Ser Tyr Met Cys Leu Cys .
100 105 110
Pro Gly Phe Ser Gly Arg His Cys Glu Gin Ser He Gly Asp Val
115 120 125
Asp Ser Cys Leu His Asp Asn Gly Gly Cys Glu His Phe Cys Thr
130 135 140
Gin Asp Gly Arg Arg Asn Cys Ser Cys Ala Asp Gly Tyr Tyr Leu \
145 150 155
Asn Gly Gly Gin Lys Cys Arg Ser His Glu Val Phe Pro Cys Gly :
165 170 175
Val Pro Leu Leu Gin Ala Gly Lys Ala Ala Asp His Gin Val Asp :
180 185 190
Arg Ser Arg He Val Gly Gly Ser Glu Cys Pro Lys Gly His Cys
195 200 205
Trp Gin Val Leu Leu Lys Tyr Gly Glu Lys Gly Phe Cys Gly Gly '
210 215 220
He Tyr Lys Pro Thr Trp He Leu Thr Ala Ala His Cys Leu Glu
225 230 235
Leu Lys Val Lys Phe Leu Arg He Val Ala Gly Glu His Asp Leu '
245 250 255
Val Asp Glu Gly Thr Glu Gin Leu He Gin Val Asp Gin Met Phe
260 265 270
His Pro Ala Tyr Val Ser Glu Thr Ala Asp Ser Asp He Ala Leu
275 280 285
Arg Leu Arg Thr Pro He Val Tyr Ser Val Tyr Ala Val Pro Val
290 295 300
Leu Pro Leu Arg Glu Met Ala Glu Arg Glu Leu Trp Ala Val Ser
305 310 315
His Thr Val Ser Gly Trp Gly Lys Arg Ser Glu Asp Gly Pro Thr
325 330 335
Arg Leu Leu Arg Arg Leu Leu Val Pro Arg He Arg Thr Gin Glu
340 345 350
Val Gin Val Ser Asn Leu Thr Leu Thr Ser Asn Met Phe Cys Ala
355 360 365
Tyr He Glu Gly Arg Gin Asp Ser Cys Lys Gly Asp Ser Gly Gly
370 375 380
Leu Val Thr Arg Tyr Arg Asp Thr Ala Phe Leu Leu Gly He Val
385 390 395
Trp Gly Lys Gly Cys Ala Arg Pro Gly Ser Tyr Gly He Tyr Thr
405 410 415
Val Ser Asn Tyr Leu Gin Trp He Arg Gin Thr Thr Asn Thr Thr
420 425 430
His
<210> 14
<211> 441
<212> белок
<213> Fugu rubripes
<220>
<223> Предшественник фактора VII
<400> 14
Met
Arg
Leu
Arg
Val
Phe
Phe
Thr
Leu
Val
Phe
Thr
Phe
Thr
His
Cys
Arg
Ala
Ala
Ser
Val
Phe
Leu
Asp Ala Asp
Lys
Ala
His
Asp
Val
Leu
Val
Arg
Thr
Arg
Arg
Tyr
Asn
Ser
Gly
Trp
Leu
Glu
Glu
Leu
Gin
Lys
Gly
Asp
Leu
Lys
Arg
Glu
Cys
Leu
Glu
Glu
Cys
Ser
Tyr
Glu
Glu
Ala
Arg
Glu
Val
Phe
Glu
His
Thr
Lys
Thr
Thr
Asp
Glu
Phe
Trp
Lys
Tyr
Asn
Arg
Pro
Asn
Ser
Cys
Lys
Ser
Asn
Pro
Cys
Leu
Asn
Gly
Gly
Ser
Cys
Ser
Ala
Glu
Gly
Ser
Ser
Tyr
Thr
Cys
Phe
Cys
Leu
Pro
100
105
110
Glu
Phe
Ser
Gly
Val
Asp
Cys
Glu
Leu
Glu
Tyr
Gin
Thr
Val
Pro
Asp
115
120
125
Thr
Cys
Leu
Leu
Glu
Asn
Gly
Gly
Cys
Glu
His
Phe
Cys
His
Glu
Asn
130
135
140
Ser
Ala
Gly
Gin
Arg
Gly
Asn
Cys
Ser
Cys
Ala
Asp
Gly
Tyr
Asp
Leu
145
150
155
160
Asp
Val
Asp
Gly
Leu
Ser
Cys
Lys
Ala
Lys
Glu
Ser
Val
Ala
Cys
Gly
165
170
175
Met
Val
Leu
Ser
Ala
Gin
Phe
Glu
His
Asn
Gin
Leu
Asn
Pro
Arg
Ala
180
185
190
Arg
Val
Gly
Gly
Asn
Glu
Cys
Pro
Lys
Gly Glu
Cys
Pro
Trp
Gin
195
200
205
Val
Leu
Leu
Val
Tyr
Lys
Gly
Lys
Gly
Phe
Cys
Gly
Gly Val
Tyr
210
215
220
Lys
Pro
Thr
Trp
Leu
Thr
Ala
Ser
His
Cys
Met
Ala
Asp
Asp
225
230
235
240
Val
Gin
Phe
Leu
Lys
Val
Val
Ala
Gly
Glu
His
Asn
Thr
Glu
Val
Asp
245
250
255
Glu
Gly
Thr
Glu
Gin
Gin
Val
Ser
Glu
Met
His
Glu
260
265
270
Lys
Tyr
Val
Pro
Arg
Thr
Ala
Asp
Asn
Asp
Ala
Leu
Leu
His
Leu
275
280
285
Ala
Val
Pro
Thr
Tyr
Thr
Thr
Tyr
Ala
Pro
Val
Cys
Leu
Pro
290
295
300
Thr
Arg
Pro
Leu
Ala
Glu
Arg
Glu
Leu
Trp
Ala
Val
Ser
Leu
His
Thr
305
310
315
320
Val
Ser
Gly
Trp
Gly
Arg
Arg
Ser
Glu
Asn
Gly
Pro
Thr
Ser
His
Leu
325
330
335
Leu
Arg
Gin
Leu
Lys
Val
Pro
Arg
Arg
Thr
Gin
Gin
Cys
Glu
340
345
350
Glu
Ser
Gly
Val
Val
Leu
Thr
Gin
Asn
Met
Phe
Cys
Ala
Gly
Tyr
Met
355
360
365
Glu
Gly Arg
Gin
Asp
Ser
Cys
Lys
Gly
Asp
Ser
Gly
Gly
Pro
Leu
Val
370
375
380
Thr
Lys
Tyr
Lys
Lys
Thr
Val
Phe
Leu
Leu
Gly
Val
Ser
Trp
Gly
385
390
395
400
Lys
Gly
Cys
Ala
Arg
Pro
Gly
Asn
Tyr
Gly
Tyr
Thr
Arg
Val
Ala
405
410
415
Asn Tyr Leu Glu Trp He His Asn Arg Thr Ala Thr Val Asn Gin Pro
420 425 430
Thr Asn Asn Thr Glu Asn Phe Thr Thr 435 440
<210> 15
<211> 425
<212> белок
<213> Gallus gallus
<220>
<223> Предшественник фактора VII <400> 15
Met Val Ser Arg Gin Cys Val Ala Leu
1 5 Val Pro Pro Ser Leu Glu Ala Val Phe
Ser He Phe Gin Arg His Arg Arg Ala
35 40 Lys Leu Gly Pro Leu Glu Arg Glu Cys
50 55 Glu Glu Ala Arg Glu He Tyr Arg Asp
Trp His He Tyr Ser Asp Pro Asn Gin 85
Asn Gly Gly Ser Cys Asp Asp Gin Phe 100 105 Pro Pro Glu Tyr Glu Gly Lys Ser Cys
115 120 Leu Lys Cys He Tyr Asp Asn Gly Gly
130 135 Glu Gin Ser Glu Lys Arg Val Cys Phe 145 150 Ala Ser Asp Gly Val Ser Cys He Pro 165
Thr He Pro Val Leu Ala Arg Lys Asn 180 185 Val Gly Gly Val Thr Cys Pro Pro Gly
195 200 He He Gin Asp Gin Lys Gly Lys Cys
210 215 Glu Trp Val Val Thr Ala Ala His Cys 225 230 Gin Leu Arg Val Arg Leu Gly Glu Tyr 245
Thr Glu Gin Glu Ser Gly Val Ser Lys 260 265 Thr He Gly Gin Val Asn His Asp He
275 280 Pro Val Asn Leu Thr Asp Phe Val Val
290 295 Arg Phe Ala Val Tyr Glu Leu Ser Ser 305 310 Gly Trp Gly Arg Leu Leu Asp Gly Gly 325
Arg Val His Leu Pro Arg Val Lys Thr 340 345 Asn Leu Asn He Thr Glu Asn Met Phe 355 360
Leu Leu Cys Phe Pro Leu Leu 10 15 Leu Lys Gin Glu Glu Ala Asn 30
Asn Ser Phe Phe Glu Glu He 45
He Glu Glu Lys Cys Ser Phe 60
Asp Glu Arg Thr Lys Glu Phe
75 80 Cys Asp Ser Ser Pro Cys Gin
Lys Lys Asp Ser Cys Lys Gly Asp Ser
370 375 Tyr Lys Asn Thr Trp Phe Leu Thr Gly 385 390 Cys Ala Val Glu Gly Ser Tyr Gly Val 405
He Asn Trp Leu Lys Arg His Met Glu 420 425
Gly Gly Pro His Ala Thr Lys
380
He Val Ser Trp Gly Lys Gly
395 400
Tyr Thr Arg Val Ser Arg Tyr
410 415
<210> 16
<211> 444
<212> белок
<213> Pongo pygmaeus
<220>
<223> Фактор VII (фрагмент)
Gly
Val
Ala
Glu
Ala
Leu
Gly
Pro
His
Arg
Leu
His
Arg
Arg
Arg
Gly
Ser
Leu
Glu
Arg
Ala
Arg
Glu
Phe
65 70 Ser Tyr Ser Asp Gly Asp Gin 85
Gly Ser Cys Lys Asp Gin Leu 100
Asp Phe Glu Gly Arg Asn Cys 115
Cys Val Asn Glu Asn Gly Gly 130 135 Gly Ala Lys Arg Ser Cys Trp 145 150 Asp Gly Val Ser Cys Thr Pro 165
Pro He Leu Glu Lys Arg Asn 180
Gly Gly Lys Val Cys Pro Lys 195
Leu Val Asn Gly Ala Gin Leu 210 215 Trp Val Val Ser Ala Ala His 225 230 Asn Leu He Ala Val Leu Gly 245
Asp Glu Gin Ser Arg Arg Val 260
Val Pro Gly Thr Thr Asn His 275
Pro Val Val Leu Thr Asp His 290 295 Thr Phe Ser Glu Arg Thr Leu 305 310 Gly Trp Gly Gin Leu Leu Asp 325
Gly Glu
He Thr
25 Asn Thr 40
Lys Glu
Leu Glu
Cys Ala
Gin Ser 105 Glu Met 120
Cys Glu
Cys His
Thr Val
Ala Ser 185 Gly Glu 200
Cys Gly
Cys Phe
Glu His
Ala Gin 265 Asp He 280
Val Val Ala Phe Arg Gly
Thr Arg 10
Gin Glu
Phe Leu
Glu Gin
Arg Thr
75 Ser Ser 90
Tyr He
Tyr Lys
Gin Tyr
Glu Gly 155 Glu Tyr 170
Lys Pro
Cys Pro
Gly Thr
Asp Lys 235 Asp Leu 250
Val He Ala Leu Pro Leu
Asp Met
Glu Ala
Glu Glu
45 Cys Ser 60
Lys Leu Pro Cys Cys Phe
Pro Cys Gin Gly
Gin Trp Lys 15
His Gly Val 30
Leu Arg Pro
Phe Glu Glu
Phe Trp He 80
Gin Asn Gly 95
Cys Leu Pro 110
Gin Leu He
Leu Leu Ala 160
Gly Lys He 175
Arg He Val 190
Val Leu Leu
Pro Glu Arg
Leu Val Ser 320
Glu Leu Met 335
Ala Leu Asn Val Pro Arg Leu Met Thr Gin Asp Cys Leu Gin Gin Ser
340 345 350
Arg Lys Val Gly Asp Ser Pro Asn He Thr Glu Tyr Met Phe Cys Ala
355 360 365
Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly
370 375 380
Pro His Ala Thr Arg Tyr Arg Gly Thr Trp Tyr Leu Thr Gly He Val
385 390 395 400
Ser Trp Gly Gin Gly Cys Ala Ala Val Gly His Phe Gly Val Tyr Thr
405 410 415
Arg Val Ser Gin Tyr He Glu Trp Leu Gin Lys Leu Met Cys Ser Glu
420 425 430
Pro Arg Pro Gly Val Leu Leu Arg Ala Pro Phe Pro 435 440
<211> 221
<212> белок
<213> Gorilla gorilla
<223> Фактор VII
<221> неопределенный <222> 172, 177
<223> Xaa может быть любой аминокислотой
Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val Arg Phe Ser Leu Val
85 90 95
Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala Thr Ala Leu Glu Leu
100 105 110
Met Val Leu Asn Val Pro Arg Leu Met Thr Gin Asp Cys Leu Gin Gin
115 120 125
<211> 466
<212> белок
<213> Homo sapiens
<223> FVII, вариант L13P
Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr Glu Tyr Met Phe Cys
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 19
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник F64L) <400> 19
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Leu
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
85 90 95
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 20
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник L73Q)
<400> 20
Gly Gly
30 Phe Val 45
Ala Asn
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg
Leu Glu Glu Leu Arg Pro Gly Ser Gin Glu Arg Glu Cys Lys
Asp Ala
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys
85 90
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys
165 170
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys 245 250
Leu Gin 15
Glu Thr
Thr Gin
Ala Phe
Glu Glu
80 Glu Arg 95
Ala Ser
Ser Tyr
Thr His
Glu Gin 160 His Glu 175
Val Glu
Ser Lys
Glu Cys
Gly Gly 240 Phe Asp 255
Lys
Lys
Asn
Trp Arg
Asn
Leu
Ala
Val
Leu Gly Glu His
Asp
260
265
270
Leu
Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
Val
Ala
Gin
Val
275
280
285
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
His
Asp
Ala
290
295
300
Leu
Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
His
Val
Val
Pro
305
310
315
320
Leu
Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
Leu
Ala
Phe
Val
325
330
335
Arg
Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly
Gin
Leu
Leu
Asp
Arg
Gly
Ala
340
345
350
Thr
Ala
Leu
Glu
Leu
Met
Val
Leu
Asn
Val
Pro
Arg
Leu
Met
Thr
Gin
355
360
365
Asp
Cys
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly
Asp
Ser
Pro
Asn
Thr
370
375
380
Glu
Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
Lys
Asp
Ser
Cys
385
390
395
400
Lys
Gly
Asp
Ser
Gly
Gly
Pro
His
Ala
Thr
His
Tyr
Arg
Gly
Thr
Trp
405
410
415
Tyr
Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly Cys
Ala
Thr
Val
Gly
420
425
430
His
Phe
Gly Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
Glu
Trp
Leu
Gin
435
440
445
Lys
Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro
Gly
Val
Leu
Leu
Arg
Ala
Pro
450
455
460
Phe
Pro
465
<210> 21
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> FVII вариант (предшественник E79Q) <400> 21
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin
115 120
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 165 170
Gly Gly
30 Phe Val 45
Ala Asn
Cys Lys
Asp Ala
Gin Cys 110 Leu Gin 125
Cys Glu Gly Cys Arg Cys
Leu Gin 15
Glu Thr
Thr Gin
Ala Phe
Gin Glu
80 Glu Arg 95
Ala Ser
Ser Tyr
Thr His
Glu Gin 160 His Glu 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 22
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник S120P) <400> 22
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
85 90 95
Thr Lys Leu Phe Trp He 100
Ser Pro Cys Gin Asn Gly 115
He Cys Phe Cys Leu Pro 130
Lys Asp Asp Gin Leu He 145 150 Tyr Cys Ser Asp His Thr 165
Gly Tyr Ser Leu Leu Ala 180
Tyr Pro Cys Gly Lys He 195
Pro Gin Gly Arg He Val 210
Pro Trp Gin Val Leu Leu 225 230 Thr Leu He Asn Thr He 245
Lys He Lys Asn Trp Arg 260
Leu Ser Glu His Asp Gly 275
He He Pro Ser Thr Tyr 290
Leu Leu Arg Leu His Gin 305 310 Leu Cys Leu Pro Glu Arg 325
Arg Phe Ser Leu Val Ser 340
Thr Ala Leu Glu Leu Met 355
Asp Cys Leu Gin Gin Ser 370
Glu Tyr Met Phe Cys Ala 385 390 Lys Gly Asp Ser Gly Gly 405
Tyr Leu Thr Gly He Val 420
His Phe Gly Val Tyr Thr 435
Lys Leu Met Arg Ser Glu
450 Phe Pro 465
Ser Tyr Ser Asp Gly 105
Gly Pro Cys Lys Asp 120
Ala Phe Glu Gly Arg 135
Cys Val Asn Glu Asn 155
Gly Thr Lys Arg Ser 170
Asp Gly Val Ser Cys 185
Pro He Leu Glu Lys 200
Gly Gly Lys Val Cys 215
Leu Val Asn Gly Ala 235
Trp Val Val Ser Ala 250
Asn Leu He Ala Val 265
Asp Glu Gin Ser Arg 280
Val Pro Gly Thr Thr 295
Pro Val Val Leu Thr 315
Thr Phe Ser Glu Arg 330
Gly Trp Gly Gin Leu 345
Val Leu Asn Val Pro 360
Arg Lys Val Gly Asp 375
Gly Tyr Ser Asp Gly 395
Pro His Ala Thr His 410
Ser Trp Gly Gin Gly 425
Arg Val Ser Gin Tyr 440
Pro Arg Pro Gly Val 455
Asp Gin Cys Ala Ser 110
Gin Leu Gin Ser Tyr 125
Asn Cys Glu Thr His 140
Gly Gly Cys Glu Gin 160
Cys Arg Cys His Glu 175
Thr Pro Thr Val Glu 190
Arg
Asn
Ala
Ser
Lys
205
Pro
Lys
Gly
Glu
Cys
220
Gin
Leu
Cys
Gly
Gly
240
Ala
His
Cys
Phe
Asp
255
Leu
Gly
Glu
His
Asp
270
Arg
Val
Ala
Gin
Val
285
Asn His Asp He Ala 300
Asp His Val Val Pro 320
Thr Leu Ala Phe Val 335
Leu Asp Arg Gly Ala 350
Arg Leu Met Thr Gin 365
Ser Pro Asn He Thr 380
<210> 23 <211> 466 <212> белок <213> Homo sapiens
<220>
<223> вариант FVII (предшественник C121F) <4C0> 23
Phe Pro 465
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
1 5 10 15
<210> 24
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник L125P) <400> 24
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
85 90 95
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Pro Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 25
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник Y128C)
Leu Glu Glu Leu Arg Pro Gly 65 70 Gin Cys Ser Phe Glu Glu Ala 85
Thr Lys Leu Phe Trp He Ser 100
Ser Pro Cys Gin Asn Gly Gly 115
He Cys Phe Cys Leu Pro Ala 130 135 Lys Asp Asp Gin Leu He Cys 145 150 Tyr Cys Ser Asp His Thr Gly 165
Gly Tyr Ser Leu Leu Ala Asp 180
Tyr Pro Cys Gly Lys He Pro 195
Pro Gin Gly Arg He Val Gly 210 215 Pro Trp Gin Val Leu Leu Leu 225 230 Thr Leu He Asn Thr He Trp 245
Lys He Lys Asn Trp Arg Asn 260
Leu Ser Glu His Asp Gly Asp 275
He He Pro Ser Thr Tyr Val 290 295 Leu Leu Arg Leu His Gin Pro 305 310 Leu Cys Leu Pro Glu Arg Thr 325
Leu Leu
Val Ala
25 Gly Pro 40
His Arg
Ser Leu
Arg Glu
Tyr Ser 105 Ser Cys 120
Phe Glu
Val Asn
Thr Lys
Gly Val 185 He Leu 200
Gly Lys
Val Asn
Val Val
Leu He 265 Glu Gin 280
Pro Gly Val Val Phe Ser
Leu Leu
Ser Gly
Val Phe 45
Arg Ala 60
Glu Cys Lys Asp Asp Gin
Gly Leu Gin
Gly Glu Thr
Val Thr Gin
Asn Ala Phe
Lys Glu Glu
Ala Glu Arg
Cys Ala Ser
110
Gin Ser Cys
Glu Thr His
Cys Glu Gin 160
Cys His Glu 175
Thr Val Glu 190
Ala Ser Lys
Gly Glu Cys
Cys Gly Gly 240
Cys Phe Asp
255 Glu His Asp 270
Arg Val Ala Gin Val 285
Asn His Asp He Ala 300
Asp Hi
Val Val Pro 320
Ala Phe Val 335
Arg Phe
Thr Ala
Asp Cys 370 Glu Tyr 385
Lys Gly
Tyr Leu
His Phe
Lys Leu 450 Phe Pro 465
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Pro His
Ser Trp
Arg Val 440 Pro Arg 455
Gly Gin 345
Asn Val
Val Gly
Ser Asp
Ala Thr 410 Gly Gin 425
Ser Gin
Leu Leu Pro Arg
Gly Cys Tyr He
Asp Arg 350 Leu Met 365
Pro Asn
Glu Trp
445
Leu Arg
Gly Ala
Thr Gin
He Thr
Ser Cys 400 Thr Trp 415
Val Gly Leu Gin Ala Pro
<210> 26 <211> 466 <212> белок <213> Homo sapiens
<220>
Leu Leu Gly Leu Gin 15
Ser Gly Gly Glu Thr 30
Val Phe Val Thr Gin 45
Arg Ala Asn Ala Phe 60
Glu Cys Lys Glu Glu
<223> вариант FVII {предшественник R139K) <400> 26
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Lys
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala 245 250
Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His
405 410 Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly
420 425 His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr
435 440 Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val
450 455 Phe Pro 465
Leu Gly Glu His Asp 270
Arg Val Ala Gin Val 285
Asn His Asp He Ala 300
Asp His Val Val Pro 320
Thr Leu Ala Phe Val 335
Leu Asp Arg Gly Ala 350
Arg Leu Met Thr Gin 365
Ser Pro Asn He Thr 380
Ser Lys Asp Ser Cys 400
Tyr Arg Gly Thr Trp 415
Cys Ala Thr Val Gly 430
He Glu Trp Leu Gin 445
Leu Leu Arg Ala Pro 460
<210> 27
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник R139Q) <400> 27
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Gin
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser 165 170
Leu Leu Gly
Ser Gly Gly 30
Val Phe Val 45
Arg Ala Asn . 60
Glu Cys Lys
Lys Asp Ala
Asp Gin Cys 110
Gin Leu Gin 125
Asn Cys Glu 1 140
Gly Gly Cys i Cys Arg Cys :
Gly Туг
Ser
Leu
Leu
Ala
Asp
Gly
Val
Ser
Cys
Thr
Pro
Thr
Val
Glu
180
185
190
Tyr Pro
Cys
Gly
Lys
Pro
Leu
Glu
Lys
Arg
Asn
Ala
Ser
Lys
195
200
205
Pro Gin
Gly
Arg
Val
Gly
Gly
Lys
Val
Cys
Pro
Lys
Gly
Glu
Cys
210
215
220
Pro Trp
Gin
Val
Leu
Leu
Leu
Val
Asn
Gly
Ala
Gin
Leu
Cys
Gly
Gly
225
230
235
240
Thr Leu
Asn
Thr
Trp
Val
Val
Ser
Ala
Ala
His
Cys
Phe
Asp
245
250
255
Lys He
Lys
Asn
Trp Arg
Asn
Leu
Ala
Val
Leu
Gly
Glu
His
Asp
260
265
270
Leu Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
Val
Ala
Gin
Val
275
280
285
He He
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
His
Asp
Ala
290
295
300
Leu Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
His
Val
Val
Pro
305
310
315
320
Leu Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
Leu
Ala
Phe
Val
325
330
335
Arg Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly
Gin
Leu
Leu
Asp
Arg
Gly Ala
340
345
350
Thr Ala
Leu
Glu
Leu
Met
Val
Leu
Asn
Val
Pro
Arg
Leu
Met
Thr
Gin
355
360
365
Asp Cys
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly
Asp
Ser
Pro
Asn
Thr
370
375
380
Glu Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
Lys
Asp
Ser
Cys
385
390
395
400
Lys Gly
Asp
Ser
Gly
Gly
Pro
His
Ala
Thr
His
Tyr
Arg
Gly
Thr
Trp
405
410
415
Tyr Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly
Cys
Ala
Thr
Val
Gly
420
425
430
His Phe
Gly
Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
Glu
Trp
Leu
Gin
435
440
445
Lys Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro
Gly
Val
Leu
Leu
Arg
Ala
Pro
450
455
460
Phe Pro
465
<210> 2i
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVH R139W
<400> 2i
Met Val
Ser
Gin
Ala
Leu
Arg
Leu
Leu
Cys
Leu
Leu
Leu
Gly
Leu
Gin
Gly Cys
Leu
Ala
Ala
Gly
Gly
Val
Ala
Lys
Ala
Ser
Gly
Gly
Glu
Thr
Arg Asp Met
Pro
Trp
Lys
Pro
Gly
Pro
His
Arg
Val
Phe
Val
Thr
Gin
Glu Glu
Ala
His
Gly
Val
Leu
His
Arg
Arg
Arg
Arg
Ala
Asn
Ala
Phe
Leu Glu
Glu
Leu
Arg
Pro
Gly
Ser
Leu
Glu
Arg
Glu
Cys
Lys
Glu
Glu
Gin Cys
Ser
Phe
Glu
Glu
Ala
Arg
Glu
Phe
Lys
Asp
Ala
Glu Arg
<210> 29
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник C151S) <400> 29
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Ser Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His
405 410 Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly
420 425 His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr
435 440 Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val
450 455 Phe Pro 465
<210> 30
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> вариант FVII (предшественник E154K) <400> 30
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55 Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Lys Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His 405 410
Gin Leu 125 Asn Cys 140
Gly Gly
Cys Arg
Thr Pro 1
Gly Glu Cys
Arg Asn 205 Pro Lys 220
Gin Leu i
Ala His '
Leu Gly
Arg Val .
285 Asn His . 300
Asp His '
Thr Leu .
Leu Asp .
Asn He Thr
Arg Leu :
365 Ser Pro 380
Ser Lys
Tyr Arg
Cys Ala
He Glu 445 Leu Leu 460
Leu Gin 15
Glu Thr
Thr Gin
Ala Phe
Glu Glu
80 Glu Arg 95
Ala Ser
Ser Tyr
Thr His
Glu Gin 160 His Glu 175
Val Glu
Ser Lys
Glu Cys
Gly Gly 240 Phe Asp 255
His Asp
Gin Val
He Ala
Val Pro 320 Phe Val 335
Gly Ala
Arg Ala Pro
Leu Leu Gly
Ser Gly Gly 30
Val Phe Val 45
Arg Ala Asn 60
Glu Cys Lys
Lys Asp Ala
Asp Gin Cys 110
Gin Leu Gin 125
Asn Cys Glu 140
Gly Gly Cys
Cys Arg Cys
Thr Pro Thr 190
Arg Asn Ala
205 Pro Lys Gly 220
Gin Leu Cys
Ala His Cys
Leu Gly Glu 270
Arg Val Ala 285
Asn His Asp 300
Asp His Val
Thr Leu Ala
Thr Gin
He Thr
Ser Cys 400
Tyr Arg Gly Thr Trp 415
Leu Asp Arg 350
Arg Leu Met 365
Ser Pro Asn 380
Ser Lys Asp
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 31
<211> 466
<212> белок
<213> Homo sapien
<220>
<223> вариант FVII (предшественник G157C)
<400> 31
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn
Leu Gin
Glu Thr
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala
85 90
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Cys Cys
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys
165 170
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys
245 250
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala 325 330
80 Glu Arg 95
Ala Ser Ser Tyr Thr His
Ser Lys Glu Cys
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 32
<211> 466
<212> белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник G157S) <400> 32
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala 245 250
Ser Gly
Val Phe
Arg Ala 60
Glu Cys
Lys Asp
Asp Gin
Gin Leu 125
Cys Arg Thr Pro
Arg Asn
205 Pro Lys 220
Gin Leu Ala His
Asn Cys Glu Thr His 140
Gly Se:
Cys Glu Gin 160
Cys His Glu 175
> Thr Val Glu 190
Ala Ser Lys
Gly Glu Cys
Cys Gly Gly 240
Cys Phe Asp 255
Lys Не Leu Ser
Arg Phe
Thr Ala
Asp Cys 370 Glu Tyr 385
Lys Gly
450 Phe Pro 465
Lys Asn Trp
260 Glu His Asp 275
Pro Ser Thr
Leu Pro Glu 325
Ser Leu Val
340 Leu Glu Leu 355
Leu Gin Gin
Arg Asn
Gly Asp
Tyr Val 295 Gin Pro 310
Arg Thr
Leu He 265 Glu Gin 280
Leu Thr 315 Glu Arg 330
Gin Leu Val Pro Gly Asp
Pro Gly Thr Thr
Ser Gly Met Val
Val Val Phe Ser
Trp Gly 345 Leu Asn 360
Ser Arg Lys Val 375
Gly Glu 270 Val Ala 285
His Asp His Val Leu Ala
Asp Arg 350 Leu Met 365
Ser Pro Asn 380
His Asp
Gin Val
He Ala
Val Pro 320 Phe Val 335
Gly Ala Thr Gin He Thr
<210> 33
<2H> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник G157V) <400> 33
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Val Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 34
<211> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник Q160R) <400> 34
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp He 100
Ser Pro Cys Gin Asn Gly 115
He Cys Phe Cys Leu Pro 130
Lys Asp Asp Gin Leu He 145 150 Tyr Cys Ser Asp His Thr 165
Gly Tyr Ser Leu Leu Ala 180
Tyr Pro Cys Gly Lys He 195
Pro Gin Gly Arg He Val 210
Pro Trp Gin Val Leu Leu 225 230 Thr Leu He Asn Thr He 245
Lys He Lys Asn Trp Arg 260
Leu Ser Glu His Asp Gly 275
He He Pro Ser Thr Tyr 290
Leu Leu Arg Leu His Gin 305 310 Leu Cys Leu Pro Glu Arg 325
Arg Phe Ser Leu Val Ser 340
Thr Ala Leu Glu Leu Met 355
Asp Cys Leu Gin Gin Ser 370
Glu Tyr Met Phe Cys Ala 385 390 Lys Gly Asp Ser Gly Gly 405
Tyr Leu Thr Gly He Val 420
His Phe Gly Val Tyr Thr 435
Lys Leu Met Arg Ser Glu
450 Phe Pro 465
Ser Tyr Ser Asp Gly 105
Gly Ser Cys Lys Asp 120
Ala Phe Glu Gly Arg 135
Cys
Val
Asn
Glu
Asn
155
Gly
Thr
Lys
Arg
Ser
170
Asp Gly
Val
Ser
Cys
185
Pro
Leu
Glu
Lys
200
Gly
Gly
Lys
Val
Cys
215
Leu
Val
Asn
Gly
Ala
235
Trp
Val
Val
Ser
Ala
250
Asn
Leu
Ala
Val
265
Asp Glu Gin Ser Arg 280
Val Pro Gly Thr Thr 295
Pro Val Val Leu Thr 315
Thr Phe Ser Glu Arg 330
Gly Trp Gly Gin Leu 345
Val Leu Asn Val Pro 360
Arg Lys Val Gly Asp 375
Gly Tyr Ser Asp Gly 395
Pro His Ala Thr His 410
Ser Trp Gly Gin Gly 425
Arg Val Ser Gin Tyr 440
Pro Arg Pro Gly Val 455
Asp Gin Cys Ala Ser 110
Gin Leu Gin Ser Tyr 125
Asn Cys Glu Thr His 140
Gly Gly Cys Glu Arg 160
Cys Arg Cys His Glu 175
Thr Pro Thr Val Glu 190
Arg Asn Ala Ser Lys 205
Pro
Lys
Gly
Glu
Cys
220
Gin
Leu
Cys
Gly
Gly
240
Ala
His
Cys
Phe
Asp
255
Leu
Gly
Glu
His
Asp
270
Arg
Val
Ala
Gin
Val
285
Asn His Asp He Ala 300
Asp His Val Val Pro 320
Thr Leu Ala Phe Val 335
Leu Asp Arg Gly Ala 350
Arg Leu Met Thr Gin 365
Ser Pro Asn He Thr 380
<210> 35 <211> 466 <212> белок <213> Homo sapiens
<220>
<223> Вариант FVII (предшественник P194T) <400> 35
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly
Cys
Leu
Ala
Ala
Gly
Gly
Val
Ala
Lys
Ala
Ser
Gly
Gly
Glu
Thr
Arg
Asp
Met
Pro
Trp
Lys
Pro
Gly
Pro
His
Arg
Val
Phe
Val
Thr
Gin
Glu
Glu
Ala
His
Gly
Val
Leu
His
Arg
Arg
Arg
Arg
Ala
Asn
Ala
Phe
Leu
Glu
Glu
Leu
Arg
Pro
Gly
Ser
Leu
Glu
Arg
Glu
Cys
Lys
Glu
Glu
Gin
Cys
Ser
Phe
Glu
Glu
Ala
Arg
Glu
Phe
Lys
Asp
Ala
Glu
Arg
Thr
Lys
Leu
Phe
Trp
Ser
Tyr
Ser
Asp
Gly Asp
Gin
Cys
Ala
Ser
100
105
110
Ser
Pro
Cys
Gin
Asn
Gly
Gly
Ser
Cys
Lys
Asp
Gin
Leu
Gin
Ser
Tyr
115
120
125
Cys
Phe
Cys
Leu
Pro
Ala
Phe
Glu
Gly
Arg
Asn
Cys
Glu
Thr
His
130
135
140
Lys
Asp
Asp
Gin
Leu
Cys
Val
Asn
Glu
Asn Gly
Gly
Cys
Glu
Gin
145
150
155
160
Tyr
Cys
Ser
Asp
His
Thr
Gly
Thr
Lys
Arg
Ser
Cys
Arg
Cys
His
Glu
165
170
175
Gly
Tyr
Ser
Leu
Leu
Ala
Asp
Gly
Val
Ser
Cys
Thr
Pro
Thr
Val
Glu
180
185
190
Tyr
Thr
Cys
Gly
Lys
Pro
Leu
Glu
Lys
Arg
Asn
Ala
Ser
Lys
195
200
205
Pro
Gin
Gly
Arg
Val
Gly
Gly
Lys
Val
Cys
Pro
Lys
Gly
Glu
Cys
210
215
220
Pro
Trp
Gin
Val
Leu
Leu
Leu
Val
Asn Gly
Ala
Gin
Leu
Cys
Gly Gly
225
230
235
240
Thr
Leu
Asn
Thr
Trp
Val
Val
Ser
Ala
Ala
His
Cys
Phe
Asp
245
250
255
Lys
Lys
Asn
Trp
Arg
Asn
Leu
Ala
Val
Leu
Gly
Glu
His
Asp
260
265
270
Leu
Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
Val
Ala
Gin
Val
275
280
285
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
His
Asp
Ala
290
295
300
Leu
Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
His
Val
Val
Pro
305
310
315
320
Leu
Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
Leu
Ala
Phe
Val
325
330
335
Arg
Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly Gin
Leu
Leu
Asp
Arg
Gly Ala
340
345
350
Thr
Ala
Leu
Glu
Leu
Met
Val
Leu
Asn
Val
Pro
Arg
Leu
Met
Thr
Gin
355
360
365
Asp
Cys
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly
Asp
Ser
Pro
Asn
Thr
370
375
380
Glu
Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
Lys
Asp
Ser
Cys
385
390
395
400
Lys
Gly
Asp
Ser
Gly
Gly
Pro
His
Ala
Thr
His
Tyr
Arg
Gly
Thr
Trp
405
410
415
Tyr
Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly Cys
Ala
Thr
Val
Gly
420
425
430
His
Phe
Gly
Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
Glu
Trp
Leu
Gin
435
440
445
Lys
Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro Gly
Val
Leu
Leu
Arg
Ala
Pro
450
455
460
Phe
Pro
465
<210> 36
<211> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник C195R) <400> 36
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 37
<211> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник K197E) <400> 37
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Glu He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg 325 330
Leu Leu Gly :
Ser Gly Gly ( 30
Val Phe Val 45
Arg Ala Asn i 60
Glu Cys Lys
Lys Asp Ala
Asp Gin Cys 110
Gin Leu Gin 125
Glu Gin 160 His Glu 175
Val Glu Ser Lys Glu Cys
Asn Cys Glu 140
Gly Gly Cys
Cys Arg Cys
Thr Pro Thr 190
Arg Asn Ala
205 Pro Lys Gly 220
Gin Leu Cys
Gly Gly 240
Gin Val He Ala
Ala His Cys Phe Asp 255
His Asp
Leu Gly Glu 270
Arg Val Ala
285 Asn His Asp 300
Asp His Val
Val Pro 320
Thr Leu Ala Phe Val 335
<210> 39
<211> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник G216D)
Gly Туг Tyr Pro
Lys Не
Leu Ser
He He 290 Leu Leu 305
Leu Cys
Lys Leu 450 Phe Pro 465
Asp
Gly
Val
Ser
Cys
Thr
Pro
Thr
185
190
Pro
Leu
Glu
Lys
Arg
Asn
Ala
200
205
Gly
Asp
Lys
Val
Cys
Pro
Lys
Gly
215
220
Leu
Val
Asn
Gly
Ala
Gin
Leu
Cys
235
Trp
Val
Val
Ser
Ala
Ala
His
Cys
Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
Ser Glu 330 Gly Gin 345
Asn Val
Thr Phe
Gly Trp
Val Leu 360 Arg Lys 375
Gly Tyr
His Gin 310 Glu Arg 325
Val Ser
Leu Met
Gin Ser
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Val Pro 320 Phe Val 335
Gly Ala
Thr Gin
He Thr
Ser Cys 400 Thr Trp 415
Val Gly Leu Gin Ala Pro
280 285 Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala 295 300 Arg Leu His Gin Pro Val Val Leu Thr Asp His Val
Asp Arg 350 Leu Met 365
Pro Asn
Lys Asp
Arg Gly
Ala Thr 430 Glu Trp
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
310 315 Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala
Leu Leu
Asp Ser 380 Gly Ser 395
His Tyr
Pro Arg
Val Gly
Ser Asp
Pro His Ala Thr 410
Ser Trp Gly Gin Gly Cys 425
Arg Val Ser Gin Tyr He
440 445
Pro Gly Val Leu Leu Arg 460
Pro Arg 455
<210> 40
<211> 466
<212> Белок
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник C238Y) <400> 40
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
He Cys 130 Lys Asp 145
Tyr Cys
Gly Tyr
Tyr Pro
Pro Gin 210 Pro Trp 225
Thr Leu
Lys He
Leu Ser
He He 290 Leu Leu 305
Leu Cys
Arg Phe
Thr Ala
Asp Cys 370 Glu Tyr 385
Lys Gly
Tyr Leu
His Phe
Lys Leu 450 Phe Pro
Leu Phe 1
100 Cys Gin . 115 Phe Cys
Gly Ser 120 Ala Phe 135
Cys Val
Trp He Ser Tyr Asn Gly Leu P:
Asp Gin
150
Ser Asp His Thr Gly Thr 165
Cys Gly 195 Gly Arg
Pro He 200 Gly Gly 215
Leu Val
Ser Leu Leu Ala Asp Gly 180
Leu Leu 230 Thr He 245
Trp Arg
Lys He He Val
Gin Val
Glu His 275
Pro Ser
Asp Glu 280 Val Pro 295
Pro Val
His Gin 310 Glu Arg 325
Val Ser
He Asn Thr He Trp Val Lys Asn Trp Arg Asn Leu Asp Gly Thr Tyr
Arg Leu Leu Pro
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
Thr Phe
Leu Met
Gin Ser
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Gly Trp
Val Leu 360 Arg Lys 375
Gly Tyr
Pro His
Ser Trp
Arg Val 440 Pro Arg 455
Ser Asp 105
Cys Lys
Glu Gly
Asn Glu
Lys Arg 170 Val Ser 185
Leu Glu
Lys Val
Asn Gly
Val Ser 250 He Ala 265
Gin Ser
Gly Thr
Val Leu
Ser Glu 330 Gly Gin 345
Asn Val Val Gly Ser Asp
Gly Asp Gin Cys Ala Ser 110
Asp Gin Leu Gin Ser Tyr 125
Arg Asn Cys Glu Thr His 140
Asn Gly Gly Cys Glu Gin 155 160 Ser Cys Arg Cys His Glu 175
Cys Thr Pro Thr Val Glu 190
Lys Arg Asn Ala Ser Lys 205
Cys Pro Lys Gly Glu Cys 220
Ala Gin Leu Tyr Gly Gly 235 240 Ala Ala His Cys Phe Asp 255
Val Leu Gly Glu His Asp 270
Arg Arg Val Ala Gin Val 285
Thr Asn His Asp He Ala 300
Thr Asp His Val Val Pro 315 320 Arg Thr Leu Ala Phe Val 335
Leu Leu Asp Arg Gly Ala 350
Met Thr Gin
Asn He Thr
Asp Ser Cys 400
Gly Thr Trp 415
Thr Val Gly 430
Trp Leu Gin
Pro Arg Leu 365
Asp Ser Pro
380 Gly Ser Lys 395
His Tyr Arg
Ala Thr 410
Gly Gin Gly Cys Ala 425
Ser Gin
Tyr He Glu 1 445
Pro Gly Val Leu Leu Arg Ala Pro
<210> 41
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник T241N) <400> 41
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala 20
Arg Asp Met Pro Trp
Glu Glu Ala His Gly 50
Leu Glu Glu Leu Arg 65
Gin Cys Ser Phe Glu 85
Thr Lys Leu Phe Trp 100
Ser Pro Cys Gin Asn 115
He Cys Phe Cys Leu 130
Lys Asp Asp Gin Leu 145
Tyr Cys Ser Asp His 165
Gly Tyr Ser Leu Leu 180
Tyr Pro Cys Gly Lys 195
Pro Gin Gly Arg He 210
Pro Trp Gin Val Leu 225
Asn Leu He Asn Thr 245
Lys He Lys Asn Trp 260
Leu Ser Glu His Asp 275
He He Pro Ser Thr 290
Leu Leu Arg Leu His 305
Leu Cys Leu Pro Glu 325
Arg Phe Ser Leu Val 340
Thr Ala Leu Glu Leu 355
Asp Cys Leu Gin Gin 370
Glu Tyr Met Phe Cys 385
Lys Gly Asp Ser Gly 405
Tyr Leu Thr Gly He 420
His Phe Gly Val Tyr 435
Lys Leu Met Arg Ser
450 Phe Pro 465
<210> 42 <211> 466 <212> БЕЛОК <213> Homo sapiens
<220>
<223> Вариант FVII (предшественник C254Y)
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 43
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник A266T) <400> 43
Gly Glu Thr 30
Val Thr Gin
Asn Ala Phe
Lys Glu Glu 80
Ala Glu Arg 95
Cys Ala Ser 110
Gin Ser Tyr Glu Thr His
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin
100 105
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro
180 185
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn
195 200 205
Pro Gin Gly Arg He Val. Gly Gly Lys Val Cys Pro Lys
210 . " 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His
245 250 Lys lie Lys Asn Trp Arg Asn Leu He Thr Val Leu Gly i
2 60 2 65
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val
275 280 ' 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg 325 330
Ser Leu 340 Leu Glu 355
Leu Gin
Lys Leu 1
450 Phe Pro 465
Val Ser Gly Leu Met Val
Gin Ser Arg ' 375 Cys Ala Gly
390 Gly Gly P:
Ser Glu Pro 455
Trp Gly 345 Leu Asn 360
Trp Gly 425 Val Ser 440
Arg Pro
Lys Val
Asp Gly 395 Thr His 410
Gin Gly Gin Tyr Gly Val
Arg Leu 365 Ser Pro 380
Ser Lys
Tyr Arg
Cys Ala
He Glu 445 Leu Leu
Arg Gly Ala 350
Met Thr Gin
Asn He Thr
Asp Ser Cys 400
Gly Thr Trp 415
Thr Val Gly 430
Trp Leu Gin Arg Ala Pro
<210> 44
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник <400> 44
Met Val Ser Gin Ala Leu Arg Leu Leu
1 5 Gly Cys Leu Ala Ala Gly Gly Val Al;
Arg Asp Met Pro Trp Lys Pro Gly Pro
35 40 Glu Glu Ala His Gly Val Leu His Arg
50 55 Leu Glu Glu Leu Arg Pro Gly Ser Leu 65 70 Gin Cys Ser Phe Glu Glu Ala Arg Glu 85
Gly Leu Gin 15
Gly Glu Thr 30
Val Thr Gin
Asn Ala Phe
Lys Glu Glu 80
Ala Glu Arg 95
Cys Ala Ser 110
Gin Ser Tyr
Glu Thr His
Cys Glu Gin 160
Cys His Glu
175 Thr Val Glu 190
Ala Ser Lys
Gly Glu Cys
Cys Gly Gly 240
Cys Phe Asp 255
Не Не 290 Leu Leu 305
Leu Cys
Asp Cys 370 Glu Tyr 385
Lys Gly
Tyr Leu
His Phe
Lys Leu 450 Phe Pro 465
Lys Asn 260 Glu His 275
Pro Ser
Arg Leu
Leu Pro
Ser Leu 340 Leu Glu
355
Leu Gin Met Phe Asp Ser Thr Gly
420 Gly Val 435
Met Arg
Trp Arg
Asp Gly
Thr Tyr
His Gin 310 Glu Arg 325
Val Ser
Leu Met
Gin Ser
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Asp Glu 280 Val Pro 295
Pro Val
Thr Phe
Gly Trp
Val Leu 360 Arg Lys 375
Gly Tyr Pro His Ser Trp Arg Val
440 Pro Arg 455
Gly Thr
Val Leu
Ser Glu 330 Gly Gin 345
Asn Val
Val Gly
Ser Asp
Ala Thr 410 Gly Gin 425
Ser Gin
Val Leu
Trp Arg
Thr Asn 300 Thr Asp 315
Arg Thr
Leu Leu
Pro Arg
Asp Ser 380 Gly Ser 395
His Tyr Gly Cys Tyr He
Val Pro 320 Phe Val 335
Gly Ala
Thr Gin
He Thr
Ser Cys 400 Thr Trp 415
Ala Thr 430 Glu Trp
Val Gly Leu Gin Leu Arg Ala Pro
<210> 45
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшествен
V295D)
<400> 45
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Asp Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
410
415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 46
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник D302H) <400> 46
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
<210> 47 <211> 466 <212> БЕЛОК <213> Homo sapiens
<220>
<223> Вариант FVII (предшественник D302N) <400> 47
Phe Pro 465
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
<210> 48
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник А304Т)
Туг Leu Thr Gly Не Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 49
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшесч <400> 49
Met Val Ser Gin Ala Leu Arg
1 5 Gly Cys Leu Ala Ala Gly Gly 20
Arg Asp Met Pro Trp Lys Pro 35
Glu Glu Ala His Gly Val Leu
50 55 Leu Glu Glu Leu Arg Pro Gly 65 70 Gin Cys Ser Phe Glu Glu Ala 85
Thr Lys Leu Phe Trp He Ser 100
Ser Pro Cys Gin Asn Gly Gly 115
He Cys Phe Cys Leu Pro Ala 130 135 Lys Asp Asp Gin Leu He Cys 145 150 Tyr Cys Ser Asp His Thr Gly 165
Gly Tyr Ser Leu Leu Ala Asp 180
Tyr Pro Cys Gly Lys He Pro
195
Pro Gin Gly Arg He Val Gly 210 215 Pro Trp Gin Val Leu Leu Leu 225 230 Thr Leu He Asn Thr He Trp 245
Lys He Lys Asn Trp Arg Asn 260
Leu Ser Glu His Asp Gly Asp 275
He He Pro Ser Thr Tyr Val 290 295 Leu Leu Arg Leu His Gin Pro 305 310 Leu Cys Leu Pro Glu Arg Thr 325
Leu Leu Cys 10
Val Ala Lys 25
Gly Pro His 40
His Arg Arg Ser Leu Glu
Arg Glu He
Tyr Ser Asp 105
Ser Cys Lys 120
Phe Glu Gly Val Asn Glu
Val Asn Gly
Val Val Ser 250
Leu He Ala 265
Glu Gin Ser 280
Pro Gly Thr Val Val Leu
Leu Leu
Ala Ser
Arg Val
Arg Arg 60
Arg Glu 75
Phe Lys
Gly Asp
Asp Gin
Arg Asn 140 Asn Gly 155
Cys
Thr
Pro
Lys
Arg
Asn
205
Cys
Pro
Lys
220
Ala
Gin
Leu
235
Ala
Ala
His
Ser Cys
Val Leu
Arg Arg
Thr Asn 300 Thr Asp 315
Arg Thr
Leu Gly
Gly Gly
30 Phe Val 45
Ala Asn
Cys Lys
Asp Ala
Gin Cys 110 Leu Gin 125
Cys Glu
Gly Glu 270 Val Ala 285
His Asp His Val Leu Ala
Leu Gin 15
Glu Thr
Thr Gin
Ala Phe
Glu Glu
80 Glu Arg 95
Ala Ser Ser Tyr Thr His
' Glu Cys
; Gly Gly
240
i Phe Asp
255
His Asp
Gin Val
He Val
Val Pro 320 Phe Val 335
Gly
Gin
Lys
Glu 275 Pro
His
Leu
Ser
Leu 355 Leu
Met
Asp
Thr
Не Не 290 Leu Leu 305
Leu Cys
Lys Leu 450 Phe Pro 465
Leu Leu 180
Gly Lys
Arg He
Val Leu
Asn Thr 245 Asn Trp 260
His Asp
Ser Thr
Leu His
Pro Glu 325 Leu Val 340
Glu Leu
Gin Gin
Phe Cys
Ser Gly 405 Gly He 420
Val Tyr
Gly 435
Met Arg Ser
Ala Asp
He Pro
Val Gly 215 Leu Leu 230
He Trp
Arg Asn
Gly Asp
Tyr Val 295 Gin Pro 310
Arg Thr
Ser Gly
Met Val
Ser Arg 375 Ala Gly 390
Gly Pro
Val Ser
Thr Arg
Glu Pro 455
Gly Val 185 He Leu 200
Gly Lys
Val Asn
Val Val
Leu He 265 Glu Gin 280
Pro Gly
Val Val
Phe Ser
Trp Gly 345 Leu Asn 360
Lys Val
Tyr Ser
His Ala
Trp Gly 425 Val Ser 440
Arg Pro
Gly Ala 235 Ser Ala 250
Ala Val
Ser Arg
Thr Thr
Leu Thr 315 Glu Arg 330
Gin Leu
Val Pro
Gly Asp
Asp Gly 395 Thr His 410
Gin Gly Gin Tyr Gly Val
Arg Asn 205 Pro Lys 220
Gin Leu
Ala His
Leu Gly
Arg Val 285 Asn His 300
Asp His
Thr Leu
Leu Asp
Arg Leu 365 Ser Pro 380
Ser Lys
Tyr Arg
Cys Ala
He Glu 445 Leu Leu 460
Thr Val 190
Ala Ser
Gly Glu
Cys Gly
Cys Phe 255 Glu His 270
Ala Gin
Asp He
Val Val
Ala Phe 335 Arg Gly 350
Met Thr
Asn He
Gly Gin Arg Ala Pro
Asp Ser
Gly Thr 415 Thr Val 430
Trp Leu
<210> 52
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник V312M) <400> 52
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
85 90 95
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Met Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 53
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник E325K) <400> 53
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Lys Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His
405 410 Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly
420 425 His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr
435 440 Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val
450 455 Phe Pro 465
<210> 54
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник T332M) <400> 54
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His 405 410
Ser Gly Gly 30
Val Phe Val 45
Arg Ala Asn . 60
Glu Cys Lys '
Lys Asp Ala
Asp Gin Cys .
110
Gin Leu Gin 125
Asn Cys Glu 140
Gly Gly Cys
Thr Pro Thr 190
Arg Asn Ala
205 Pro Lys Gly 220
Gin Leu Cys
Leu Gly Glu : 270
Arg Val Ala i 285
Asn His Asp 300
Asp His Val '
Thr Leu Ala
Leu Asp Arg 350
Arg Leu Met
365 Ser Pro Asn 380
Ser Lys Asp
Cys Ala Thr 430
He Glu Trp 445
Leu Leu
Ser Gly
Val Phe 45
Arg Ala 60
Glu Cys Lys Asp Asp Gin
Leu Leu Arg . 460
Gly Leu Gin 15
Gly Glu Thr 30
Val Thr Gin
Asn Ala Phe
Lys Glu Glu 80
Ala Glu Arg 95
Cys Ala Ser 110
Gin Ser Tyr
Gin Leu ' 125
Asn Cys Glu Thr His 140
Gly Gly
Cys
Glu
Gin
160
Cys
His
Glu
175
Thr
Val
Glu
190
Ala
Ser
Lys
Arg Asn . 205
Ala His Leu Gly
Pro Lys Gly Glu Cys 220
Gin Leu
Cys Gly Gly 240
Cys Phe Asp 255
Glu His Asp 270
Ala Gin Val
Arg Val 285
Asn His Asp He Ala 300
Asp His
Met Leu
Leu Asp
Arg Leu 365 Ser Pro 380
Ser Lys
Val Val Pro 320
Ala Phe Val
335 Arg Gly Ala 350
Met Thr Gin Asn He Thr Asp Ser Cys
400
Tyr Arg Gly Thr Trp 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val. Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 55
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник V341F)
<400> 55
Met Val Ser Gin Ala Leu Arg Leu
1 5 Gly Cys Leu Ala Ala Gly Gly Val
Leu Glu Glu Leu Arg Pro Gly Ser Arg Tyr
Arg Asp Met Pro Trp Lys Pro 35
Glu Glu Ala His Gly Val Leu
Gin Cys Ser Phe Glu Glu Ala 85
Thr Lys Leu Phe Trp He Ser 100
Ser Pro Cys Gin Asn Gly Gly
115 120 He Cys Phe Cys Leu Pro Ala Phe
130 135 Lys Asp Asp Gin Leu He Cys Val 145 150 Tyr Cys Ser Asp His Thr Gly Thr 165
Gly Tyr Ser Leu Leu Ala Asp Gly 180
Tyr Pro Cys Gly Lys He Pro He 195 200 Pro Gin Gly Arg He Val Gly Gly
210 215 Pro Trp Gin Val Leu Leu. Leu Val 225 230 Thr Leu He Asn Thr He Trp Val 245
Lys He Lys Asn Trp Arg Asn Leu 260
Leu Ser Glu His Asp Gly Asp Glu 275 280 He He Pro Ser Thr Tyr Val Pro
290 295 Leu Leu Arg Leu His Gin Pro Val 305 310 Leu Cys Leu Pro Glu Arg Thr Phe 325
Cys Leu Leu 10
Lys Ala Ser
His Arg Val
Arg Arq Arg 60
Glu Arg Glu 75
He Phe Lys 90
Asp Gly Asp
Leu
Ala
Pro
Arg
Leu
Glu
Ser 105 Cys
Glu
Asn
Lys
Val 185 Leu
Leu Gly Leu Gin 15
Gly Gly i
30 Phe Val 45
Ala Asn .
80 Glu Arg 95
Ala Ser
Ser Tyr
Thr His
Glu Gin 160 His Glu 175
Val Glu Ser Lys Glu Cys
Glu Thr Thr Gin Ala Phe Glu Glu
Cys Lys Asp Ala
Gin Cys 110
Gly Cys Arg Cys
Lys Asp Gin Leu Gin 125
Cys Glu
Gly Arg Asn 140
Glu Asn Gly 155
Pro Thr 190 Asn Ala 205
Lys Gly
Arg Ser Cys 170
Ser Cys Thr
Val Cys Pro 220
Gly Ala Gin
235 Ser Ala Ala
Glu Lys Arg
Ly:
Asn Gly Ala Gin Leu Cys
He .
265
Gin
Gin Val He Ala
Gly Glu 270 Val Ala 285
His Asp His Val ' Leu Ala
Val Ser Ala Ala His Cys 250
Thr Thr Asn 300
Leu Thr Asp
315 Glu Arg Thr 330
Ala Val Leu Ser Arg Arg
335
Gly Val Ser
Lys Leu 450 Phe Pro 4 65
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
Phe Ser
Leu Met
Gin Ser
Cys Ala 390 Gly Gly 405
He Val Tyr Thr Ser Glu
Val Leu 360 Arg Lys 375
Gly Tyr
Val Gly
Ser Asp
Asp Arg 350 Leu Met 365
Pro Asn
Lys Asp
Arg Gly
Ala Thr 430 Glu Trp 445 . Leu Arg .
<210> 56
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник A352T)
Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
Thr Pro Thr ' 190
Arg Asn Ala 205
Pro Lys Gly i 220
Gin Leu Cys '
Ala His Cys
Lys Не
Leu Ser
He He 290 Leu Leu 305
Leu Cys
Arg Phe
Thr Ala
Asp Cys 370 Glu Tyr 385
Lys Gly
Tyr Leu
His Phe
Lys Leu 450 Phe Pro 465
Lys Asn 260 Glu His 275
Pro Ser
Arg Leu
Leu Pro
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
Trp Arg Asn
Asp Gly Asp
Thr Tyr Val 295
His Gin Pro
310 Glu Arg Thr 325
Val Ser Gly
Leu Met Val
Gin Ser Arg 375
Cys Ala Gly
390 Gly Gly Pro 405
He Val Ser
Tyr Thr Arg
Ser Glu Pro 455
Leu He 265 Glu Gin 280
Pro Gly
Val Val
Phe Ser
Trp Gly 345 Leu Asn 360
Lys Val
Tyr Ser
His Ala
Trp Gly 425 Val Ser 440
Arg Pro
Ala Val Leu
Ser Arg Arg
Thr Thr Asn 300
Leu Thr Asp 315
Glu Arg Thr 330
Arg
Gin Leu Leu
Val Pr
Gly Asp Ser 380
Asp Gly Ser
395 Thr His Tyr 410
Gin Gly Cys
Gly Glu 270 Val Ala 285
His Asp
His Val
Leu Ala
Asp Arg i
350 Leu Met ' 365
Pro Asn Lys Asp , Arg Gly
<210> 57
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник A354V)
Arg
Leu
Leu
Cys
Gly
Val
Ala
Lys
Pro
Gly
Pro
His
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Val Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 58
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник M358I) <400> 58
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
15 10 15
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Phe Pro 465
<210> 5 9
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник M358V) <400> 59
Met
Val
Ser
Gin
Ala
Leu
Arg
Leu
Leu
Cys
Leu
Leu
Leu
Gly
Leu
Gin
Gly Cys
Leu
Ala
Ala
Gly
Gly
Val
Ala
Lys
Ala
Ser
Gly
Gly Glu
Thr
Arg
Asp
Met
Pro
Trp
Lys
Pro
Gly
Pro
His
Arg
Val
Phe
Val
Thr
Gin
Glu
Glu
Ala
His
Gly
Val
Leu
His
Arg
Arg
Arg
Arg
Ala
Asn
Ala
Phe
Leu
Glu
Glu
Leu
Arg
Pro
Gly
Ser
Leu
Glu
Arg
Glu
Cys
Lys
Glu
Glu
Gin
Cys
Ser
Phe
Glu
Glu
Ala
Arg
Glu
Phe
Lys
Asp
Ala
Glu
Arg
Thr
Lys
Leu
Phe
Trp
Ser
Tyr
Ser
Asp
Gly
Asp
Gin
Cys
Ala
Ser
100
105
110
Ser
Pro
Cys
Gin
Asn
Gly
Gly
Ser
Cys
Lys
Asp
Gin
Leu
Gin
Ser
Tyr
115
120
125
Cys
Phe
Cys
Leu
Pro
Ala
Phe
Glu
Gly
Arg
Asn
Cys
Glu
Thr
His
130
135
140
Lys
Asp
Asp
Gin
Leu
Cys
Val
Asn
Glu
Asn
Gly Gly Cys
Glu
Gin
145
150
155
160
Tyr
Cys
Ser
Asp
His
Thr
Gly Thr
Lys
Arg
Ser
Cys
Arg
Cys
His
Glu
165
170
175
Gly
Tyr
Ser
Leu
Leu
Ala
Asp
Gly
Val
Ser
Cys
Thr
Pro
Thr
Val
Glu
180
185
190
Tyr
Pro
Cys
Gly
Lys
Pro
Leu
Glu
Lys
Arg
Asn
Ala
Ser
Lys
195
200
205
Pro
Gin
Gly
Arg
Val
Gly Gly
Lys
Val
Cys
Pro
Lys
Gly
Glu
Cys
210
215
220
Pro
Trp
Gin
Val
Leu
Leu
Leu
Val
Asn
Gly
Ala
Gin
Leu
Cys
Gly
Gly
225
230
235
240
Thr
Leu
Asn
Thr
Trp
Val
Val
Ser
Ala
Ala
His
Cys
Phe
Asp
245
250
255
Lys
Lys
Asn
Trp
Arg
Asn
Leu
Ala
Val
Leu
Gly
Glu
His
Asp
260
265
270
Leu
Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
Val
Ala
Gin
Val
275
280
285
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
His
Asp
Ala
290
295
300
Leu
Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
His
Val
Val
Pro
305
310
315
320
Leu
Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
Leu
Ala
Phe
Val
325
330
335
Arg
Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly
Gin
Leu
Leu
Asp
Arg
Gly
Ala
340
345
350
Thr
Ala
Leu
Glu
Leu
Val
Val
Leu
Asn
Val
Pro
Arg
Leu
Met
Thr
Gin
355
360
365
Asp
Cys
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly Asp
Ser
Pro
Asn
Thr
370
375
380
Glu
Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
Lys
Asp
Ser
Cys
385
390
395
400
Lys
Gly
Asp
Ser
Gly Gly
Pro
His
Ala
Thr
His
Tyr
Arg
Gly
Thr
Trp
405
410
415
Tyr
Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly Cys
Ala
Thr
Val
Gly
420
425
430
His
Phe
Gly
Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
Glu
Trp
Leu
Gin
435
440
445
Lys
Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro
Gly
Val
Leu
Leu
Arg
Ala
Pro
450
455
460
Phe
Pro
465
<210> 60
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник P363R) <400> 60
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
Leu Gly Leu Gin 15
Gly Gly Glu Thr 30
Phe Val Thr Gin 45
Ala Asn Ala Phe
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg
325 330 Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu
340 345 Thr Ala Leu Glu Leu Met Val Leu Asn Val Arg
355 360 Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp
370 375
Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly
385 390 395
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His 405 410
Cys Lys Glu Glu 80
Asp Ala Glu Arg 95
Gin Cys Ala Ser 110
Leu Gin Ser Tyr 125
Cys Glu Thr His
Gly Cys Glu Gin 160
Arg Cys His Glu 175
Pro Thr Val Glu 190
Asn Ala Ser Lys 205
Lys Gly Glu Cys
Leu Cys Gly Gly 240
His Cys Phe Asp 255
Gly Glu His Asp 270
Val Ala Gin Val 285
His Asp He Ala
His Val Val Pro
320
Leu Ala Phe Val 335
Asp Arg Gly Ala 350
Leu Met Thr Gin 365
Pro Asn He Thr
Lys Asp Ser Cys 400
Arg Gly Thr Trp 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly
420 425 His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr
435 440 Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val
450 455 Phe Pro 465
Ala Thr Val Gly 430
Glu Trp Leu Gin 445
Leu Arg Ala Pro
<210> 61
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник R364Q) <400> 61
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala
245 250 Lys He Lys Asn Trp Arg Asn Leu He Ala Val
260 265 Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg
275 280 He He Pro Ser Thr Tyr Val Pro Gly Thr Thr
290 295
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr
305 310 315
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg 325 330
Leu Leu
Ser Gly
Val Phe 45
Arg Ala 60
Glu Cys Lys Asp Asp Gin
Gly Leu Gin 15
Gly Glu Thr 30
Val Thr Gin
Asn Ala Phe
Lys Glu Glu 80
Ala Glu Arg 95
Cys Ala Ser 110
Gin Ser Tyr
Gin Leu i 125
Asn Cys Glu Thr His 140
Gly Gly i
Arg Asn 205
Ala His Leu Gly
Pro Lys Gly Glu Cys 220
Gin Leu
Cys Gly Gly 240
Cys Phe Asp
255 Glu His Asp 270
Ala Gin Val
Arg Val 285
Asn His Asp He Ala 300
Asp His Val Val Pro 320
Thr Leu Ala Phe Val 335
Arg Phe Ser
Leu Val 340
Glu Leu :
Ser Gly 405
Tyr Leu Thr Gly He 420
His Phe Gly Val Tyr 435
Lys Leu Met Arg Ser
450 Phe Pro 465
<210> 62
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник T367S) <400> 62
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu
15 10 Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala
20 25 Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg
35 40 Glu Glu Ala His Gly Val Leu His Arg Arg Arg
50 55
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg
65 70 75
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe
85 90 Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly
100 105 Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp
115 120 He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg
130 135
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn
145 150 155
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser
165 170 Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys
180 185 Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys
195 200 Pro Gin Gly Arg He Val Gly Gly Lys Val Cys
210 215
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala
225 230 235
Thr Leu He Asn Thr He Trp Val Val Ser Ala 245 250
Leu Gly
Gly Gly i
30 Phe Val 45
Ala Asn
Cys Lys
Asp Ala
Gin Cys .
110 Leu Gin 125
Cys Glu
Gly Cys
Arg Cys
Pro Thr 190 Asn Ala 205
Lys Gly Leu Cys His Cys
Lys He Leu Ser
Arg Phe Thr Ala
Tyr Leu
His Phe
Lys Leu 450 Phe Pro 465
Lys Asn Trp
260 Glu His Asp 275
Pro Ser Thr
Leu Pro Glu 325
Ser Leu Val
340 Leu Glu Leu 355
Leu Gin Gin
Asp Ser Gly 405
Thr Gly He 420
Gly Val Tyr 435
Met Arg Ser
Arg Asn
Gly Asp
Tyr Val 295 Gin Pro 310
Arg Thr
Ser Gly
Met Val
Ser Arg 375 Ala Gly 390
Gly Pro
Val Ser
Thr Arg
Glu Pro 455
Leu He 265 Glu Gin 280
Pro Gly
Val Val
Phe Ser
Trp Gly 345 Leu Asn 360
Lys Val
Tyr Ser
His Ala
Trp Gly 425 Val Ser 440
Arg Pro
Ala Val
Ser Arg
Thr Thr
Leu Thr 315 Glu Arg 330
Gin Leu
Val Pro
Gly Asp
Asp Gly 395 Thr His 410
Gin Gly
Leu Gly Glu 270
Arg Val Ala 285
Asn His Asp 300
Asp His Val
Leu Asp Arg 350
Arg Leu Met 365
Ser Pro Asn 380
Ser Lys Asp
His Asp Gin Val He Ala
Ser Gin He Thr
r Cys 400 Thr Trp 415
Val Gly
<210> 63
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник C370F)
Met
Val
Ser
Gin
Ala
Leu
Arg
Leu
Leu
Cys
Leu
Leu
Leu
Gly
Leu
Gin
Gly
Cys
Leu
Ala
Ala
Gly
Gly Val
Ala
Lys
Ala
Ser
Gly
Gly
Glu
Thr
Arg
Asp
Met 35
Pro
Trp
Lys
Pro
Gly 40
Pro
His
Arg
Val
Phe 45
Val
Thr
Gin
Glu
Glu 50
Ala
His
Gly
Val
Leu 55
His
Arg
Arg
Arg
Arg 60
Ala
Asn
Ala
Phe
Leu
Glu
Glu
Leu
Arg
Pro
Gly
Ser
Leu
Glu
Arg
Glu
Cys
Lys
Glu
Glu
Gin
Cys
Ser
Phe
Glu
Glu
Ala
Arg
Glu
Phe
Lys
Asp Ala
Glu
Arg
Thr
Lys
Leu
Phe 100
Trp
Ser
Tyr
Ser 105
Asp
Gly
Asp
Gin
Cys 110
Ala
Ser
Ser
Pro
Cys 115
Gin
Asn
Gly
Gly
Ser 120
Cys
Lys
Asp
Gin
Leu 125
Gin
Ser
Tyr
Cys 130
Phe
Cys
Leu
Pro
Ala 135
Phe
Glu
Gly
Arg
Asn 140
Cys
Glu
Thr
His
Lys
Asp
Asp
Gin
Leu
Cys
Val
Asn
Glu
Asn
Gly
Gly
Cys
Glu
Gin
145
150
155
160
Tyr
Cys
Ser
Asp
His 165
Thr
Gly
Thr
Lys
Arg 170
Ser
Cys
Arg
Cys
His 175
Glu
Gly
Tyr
Ser
Leu
Leu
Ala
Asp
Gly Val
Ser
Cys
Thr
Pro
Thr
Val
Glu
180
185
190
Туг
Pro
Cys
Gly
Lys
Pro
Leu
Glu
Lys
Arg
Asn
Ala
Ser
Lys
195
200
205
Pro
Gin
Gly Arg
Val
Gly Gly
Lys
Val
Cys
Pro
Lys
Gly
Glu
Cys
210
215
220
Pro
Trp
Gin
Val
Leu
Leu
Leu
Val
Asn
Gly
Ala
Gin
Leu
Cys
Gly
Gly
225
230
235
240
Thr
Leu
Asn
Thr
Trp
Val
Val
Ser
Ala
Ala
His
Cys
Phe
Asp
245
250
255
Lys
Lys
Asn
Trp
Arg
Asn
Leu
Ala
Val
Leu
Gly
Glu
His
Asp
260
265
270
Leu
Ser
Glu
His
Asp
Gly
Asp
Glu
Gin
Ser
Arg
Arg
Val
Ala
Gin
Val
275
280
285
Pro
Ser
Thr
Tyr
Val
Pro
Gly
Thr
Thr
Asn
His
Asp
Ala
290
295
300
Leu
Leu
Arg
Leu
His
Gin
Pro
Val
Val
Leu
Thr
Asp
His
Val
Val
Pro
305
310
315
320
Leu
Cys
Leu
Pro
Glu
Arg
Thr
Phe
Ser
Glu
Arg
Thr
Leu
Ala
Phe
Val
325
330
335
Arg
Phe
Ser
Leu
Val
Ser
Gly
Trp
Gly
Gin
Leu
Leu
Asp
Arg
Gly
Ala
340
345
350
Thr
Ala
Leu
Glu
Leu
Met
Val
Leu
Asn
Val
Pro
Arg
Leu
Met
Thr
Gin
355
360
365
Asp
Phe
Leu
Gin
Gin
Ser
Arg
Lys
Val
Gly
Asp
Ser
Pro
Asn
Thr
370
375
380
Glu
Tyr
Met
Phe
Cys
Ala
Gly
Tyr
Ser
Asp
Gly
Ser
Lys
Asp
Ser
Cys
385
390
395
400
Lys
Gly
Asp
Ser
Gly
Gly
Pro
His
Ala
Thr
His
Tyr
Arg
Gly
Thr
Trp
405
410
415
Tyr
Leu
Thr
Gly
Val
Ser
Trp
Gly
Gin
Gly
Cys
Ala
Thr
Val
Gly
420
425
430
His
Phe
Gly Val
Tyr
Thr
Arg
Val
Ser
Gin
Tyr
Glu
Trp
Leu
Gin
435
440
445
Lys
Leu
Met
Arg
Ser
Glu
Pro
Arg
Pro
Gly
Val
Leu
Leu
Arg
Ala
Pro
450
455
460
Phe
Pro
465
<210> 64
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник C389G) <400> 64
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
Gly Cys Leu Ala Ala Gly Gly Val Ala Lys Ala Ser Gly Gly Glu Thr
20 25 30
Arg Asp Met Pro Trp Lys Pro Gly Pro His Arg Val Phe Val Thr Gin
35 40 45
Glu Glu Ala His Gly Val Leu His Arg Arg Arg Arg Ala Asn Ala Phe
50 55 60
Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu Cys Lys Glu Glu
65 70 75 80
Gin Cys Ser Phe Glu Glu Ala Arg Glu He Phe Lys Asp Ala Glu Arg
Thr Lys Leu Phe Trp He Ser Tyr Ser Asp Gly Asp Gin Cys Ala Ser
100 105 110
Ser Pro Cys Gin Asn Gly Gly Ser Cys Lys Asp Gin Leu Gin Ser Tyr
115 120 125
He Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn Cys Glu Thr His
130 135 140
Lys Asp Asp Gin Leu He Cys Val Asn Glu Asn Gly Gly Cys Glu Gin
145 150 155 160
Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys Arg Cys His Glu
165 170 175
Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr Pro Thr Val Glu
180 185 190
Tyr Pro Cys Gly Lys He Pro He Leu Glu Lys Arg Asn Ala Ser Lys
195 200 205
Pro Gin Gly Arg He Val Gly Gly Lys Val Cys Pro Lys Gly Glu Cys
210 215 220
Pro Trp Gin Val Leu Leu Leu Val Asn Gly Ala Gin Leu Cys Gly Gly
225 230 235 240
Thr Leu He Asn Thr He Trp Val Val Ser Ala Ala His Cys Phe Asp
245 250 255
Lys He Lys Asn Trp Arg Asn Leu He Ala Val Leu Gly Glu His Asp
260 265 270
Leu Ser Glu His Asp Gly Asp Glu Gin Ser Arg Arg Val Ala Gin Val
275 280 285
He He Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn His Asp He Ala
290 295 300
Leu Leu Arg Leu His Gin Pro Val Val Leu Thr Asp His Val Val Pro
305 310 315 320
Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr Leu Ala Phe Val
325 330 335
Arg Phe Ser Leu Val Ser Gly Trp Gly Gin Leu Leu Asp Arg Gly Ala
340 345 350
Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg Leu Met Thr Gin
355 360 365
Asp Cys Leu Gin Gin Ser Arg Lys Val Gly Asp Ser Pro Asn He Thr
370 375 380
Glu Tyr Met Phe Gly Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys
385 390 395 400
Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp
405 410 415
Tyr Leu Thr Gly He Val Ser Trp Gly Gin Gly Cys Ala Thr Val Gly
420 425 430
His Phe Gly Val Tyr Thr Arg Val Ser Gin Tyr He Glu Trp Leu Gin
435 440 445
Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro
450 455 460
Phe Pro 465
<210> 65
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант FVII (предшественник G391S) <400> 65
Met Val Ser Gin Ala Leu Arg Leu Leu Cys Leu Leu Leu Gly Leu Gin
He Cys 130 Lys Asp 145
Tyr Cys
Gly Tyr
Tyr Pro
Pro Gin 210 Pro Trp 225
Thr Leu
Lys He
Leu Ser
He He 290 Leu Leu 305
Leu Cys
Arg Phe
Thr Ala
Asp Cys 370 Glu Tyr 385
Lys Gly
Tyr Leu
His Phe
Lys Leu 450 Phe Pro
Asp Gin
Ser Asp
Ser Leu 180 Cys Gly 195
Gly Arg
Gin Val
He Asn
Lys Asn 260 Glu His 275
Pro Ser
Arg Leu
Leu Pro
Ser Leu 340 Leu Glu 355
Leu Gin
Met Phe
Asp Ser
Thr Gly 420 Gly Val 435
Met Arg
Leu Pro Ala 135
Leu He Cys 150
His Thr Gly Thr Lys Arg 165 170 Leu Ala Asp Gly Val Ser 185
Lys He Pro He Leu Glu 200
He Val Gly Gly Lys Val 215
Leu Leu Leu Val Asn Gly 230
Thr He Trp Val Val Ser 245 250 Trp Arg Asn Leu He Ala 265
Asp Gly Asp Glu Gin Ser 280
Thr Tyr Val Pro Gly Thr 295
His Gin Pro Val Val Leu 310
Glu Arg Thr Phe Ser Glu 325 330 Val Ser Gly Trp Gly Gin 345
Leu Met Val Leu Asn Val 360
Lys Val Gly
Tyr Ser Asp
His Ala Thr 410
Trp Gly Gin 425
Val Ser Gin 440
Arg Pro Gly
Gin Ser Arg 375
Cys Ala Ser
390 Gly Gly Pro 405
He Val Ser
Tyr Thr Arg
Ser Glu Pro 455
Ala Ser
Arg Val
Arg Arg 60
Arg Glu 75
Phe Lys
Gly Asp
Asp Gin
Arg Asn 140 Asn Gly 155
Ser Cys
Cys Thr
Lys Arg
Cys Pro 220 Ala Gin 235
Ala Ala
Val Leu
Arg Arg
Thr Asn 300 Thr Asp 315
Arg Thr
Leu Leu
Pro Arg
Asp Ser 380 Gly Ser 395
His Tyr
Gly Cys
Tyr He
Val Leu 460
Gly Gly
30 Phe Val 45
Ala Asn
Cys Lys
Asp Ala
Gin Cys 110 Leu Gin 125
Cys Glu
Gly Cys
Arg Cys
Pro Thr 190 Asn Ala 205
Lys Gly
Leu Cys
His Cys
Gly Glu 270 Val Ala 285
His Asp
His Val
Leu Ala
Asp Arg 350 Leu Met 365
Pro Asn
Glu Thr
Thr Gin
Ala Phe
Glu Glu
80 Glu Arg 95
Ala Ser
Ser Tyr
Thr His
Glu Gin 160 His Glu 175
Val Glu
Ser Lys
Glu Cys
Gly Gly 240 Phe Asp 255
His Asp
Gin Val
He Ala
Val Pro 320 Phe Val 335
Gly Ala
<210> 66
<211> 466
<212> БЕЛОК
<213> Homo sapiens
<220>
<223> Вариант F